Vorremmo ringraziare Monika Tarnowska, Cornelia Albrecht, e Ewa Skoczylas per l&#39;eccellente assistenza tecnica. Questo studio è stato finanziato dal FNS Sinergia concessione CRSI33-125.073 a PP.

<ol>
	<li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat. Rev. Genetics. 6, 507-512 (2005).</li><li>Johansson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+zoo+of+mice+for+genetic+analyses:+a+comprehensive+protocol+for+the+rapid+generation+of+BAC+transgenic+mice.">Building a zoo of mice for genetic analyses: a comprehensive protocol for the rapid generation of BAC transgenic mice.</a> Genesis. 48, 264-280 (2010).</li><li>Skarnes, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+knockout+resource+for+the+genome-wide+study+of+mouse+gene+function.">A conditional knockout resource for the genome-wide study of mouse gene function.</a> Nature. 474, 337-342 (2011).</li><li>Carbery, I. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186, 451-459 (2010).</li><li>Meyer, M., de Angelis, M. H., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+by+homologous+recombination+in+mouse+zygotes+mediated+by+zinc-finger+nucleases.">Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 15022-15026 (2010).</li><li>Cui, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+integration+in+rat+and+mouse+embryos+with+zinc-finger+nucleases.">Targeted integration in rat and mouse embryos with zinc-finger nucleases.</a> Nat. Biotechnol. 29, 64-67 (2011).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat. Biotechnol. 31, 23-24 (2013).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+production+of+mouse+disease+models+by+embryo+microinjection+of+TALENs+and+oligodeoxynucleotides.">Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides.</a> Proc. Natl. Acad. Sci. U.S.A. 110, 3782-3787 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-Step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153, 910-918 (2013).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genetics. 11, 636-646 (2010).</li><li>ZFN, T. A. L. E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Joung, J. K., Sander, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TALENs:+a+widely+applicable+technology+for+targeted+genome+editing.">TALENs: a widely applicable technology for targeted genome editing.</a> Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013).</li><li>Cermak, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+design+and+assembly+of+custom+TALEN+and+other+TAL+effector-based+constructs+for+DNA+targeting.">Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting.</a> Nucleic Acids Res. 39, (2011).</li><li>Reyon, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH+assembly+of+TALENs+for+high-throughput+genome+editing.">FLASH assembly of TALENs for high-throughput genome editing.</a> Nat. Biotechnol. 30, 460-465 (2012).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcription+activator-like+effector+toolbox+for+genome+engineering.">A transcription activator-like effector toolbox for genome engineering.</a> Nat. Protoc. 7, 171-192 (2012).</li><li>Kim, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+library+of+TAL+effector+nucleases+spanning+the+human+genome.">A library of TAL effector nucleases spanning the human genome.</a> Nat. Biotechnol. 31, 251-258 (2013).</li><li>Schmid-Burgk, J. L., Schmidt, T., Kaiser, V., Honing, K., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ligation-independent+cloning+technique+for+high-throughput+assembly+of+transcription+activator-like+effector+genes.">A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes.</a> Nat. Biotechnol. 31, 76-81 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat. Biotechnol. 31, 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat. Biotechnol. 31, 822-826 (2013).</li><li>Hermann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+OPEN+zinc+finger+nucleases+for+direct+gene+targeting+of+the+ROSA26+locus+in+mouse+embryos.">Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos.</a> PLoS ONE. 7, (2012).</li><li>Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+disease+mutations+by+gene+targeting+in+one-cell+mouse+embryos.">Modeling disease mutations by gene targeting in one-cell mouse embryos.</a> Proc. Natl. Acad. Sci. U.S.A. 109, 9354-9359 (2012).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat. Biotechnol. 29, 143-148 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Doyon, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+zinc-finger-nuclease+activity+with+improved+obligate+heterodimeric+architectures.">Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures.</a> Nat. Methods. 8, 74-79 (2011).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Wefers, B., Wurst, W., K&#252;hn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Haueter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+vasectomy-overexpression+of+Prm1-EGFP+fusion+protein+in+elongating+spermatids+causes+dominant+male+sterility+in+mice.">Genetic vasectomy-overexpression of Prm1-EGFP fusion protein in elongating spermatids causes dominant male sterility in mice.</a> Genesis. 48, 151-160 (2010).</li><li>Perez-Pinera, P., Ousterout, D. G., Brown, M. T., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+to+the+ROSA26+locus+directed+by+engineered+zinc+finger+nucleases.">Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.</a> Nucleic Acids Res. 40, 3741-3752 (2012).</li><li>Bultmann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+transcriptional+activation+of+silent+oct4+pluripotency+gene+by+combining+designer+TALEs+and+inhibition+of+epigenetic+modifiers.">Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.</a> Nucleic Acids Res. 40, 5368-5377 (2012).</li><li>Valton, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+TALE+DNA+binding+domain+sensitivity+to+cytosine+methylation.">Overcoming TALE DNA binding domain sensitivity to cytosine methylation.</a> J. Biol. Chem. 287, 38427-38432 (2012).</li><li>Cradick, T. J., Ambrosini, G., Iseli, C., Bucher, P., McCaffrey, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN-Site+searches+genomes+for+zinc+finger+nuclease+target+sites+and+off-target+sites.">ZFN-Site searches genomes for zinc finger nuclease target sites and off-target sites.</a> BMC Bioinform. 12, (2011).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Byers, S. L., Payson, S. J., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+ten+inbred+mouse+strains+following+assisted+reproductive+technologies+(ARTs).">Performance of ten inbred mouse strains following assisted reproductive technologies (ARTs).</a> Theriogenology. 65, 1716-1726 (2006).</li><li>Luo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+strategies+for+6+commonly+used+mouse+strains.">Superovulation strategies for 6 commonly used mouse strains.</a> J. Am. Assoc. Lab. Animal Sci. 50, 471-478 (2011).</li><li>Pease, S., Saunders, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> International Society for Transgenic Technologies. Advanced protocols for animal transgenesis : an ISTT manual. , (2011).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+human+genome+engineering+via+Cas9.">RNA-Guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li></ol>

Gli autori dichiarano nessun conflitto di interessi.

Genoma approcci editing nucleasi-driven Designer hanno notevolmente ampliato la gamma di specie suscettibili di modifiche mirate dei rispettivi genomi 10,12. Nei topi,-gene targeting nelle cellule ES è una tecnica standard per oltre due decenni; tuttavia, si è rivelato difficile per adattarsi alle cellule staminali provenienti da specie diverse del mouse, anche se c&#39;è stata qualche recente successo in cellule ES ratto. Anche con la disponibilità di &quot;off-the-shelf&quot; cloni di cellule ES topo gene targeting fornite da consorzi come EUCOMM, KOMP, o NorCOMM 3 modifica del genoma da ZFN e TALEN fornisce una maggiore precisione e flessibilità per quanto riguarda la gamma di modifiche che possono essere introdotto nel genoma del mouse. Fondatore animali portatori di mutazioni nucleasi-mediata sembrano essere altamente linea germinale competente 4-6,20,21, che non è sempre il caso di chimere provenienti da blastocisti iniezioni di cellule staminali. Pertanto, in alcuni casi microiniezione di desnucleasi igner possono provocare generazione significativamente più veloce delle linee di nuovi mouse con modificazioni del genoma mirati. Il successo generazione di topi knockout per iniezione di ZFN e TALEN dipende in larga misura l&#39;attività della coppia nucleasi iniettato. Talens hanno dimostrato di avere un alto tasso di successo in mira una vasta gamma di geni in un numero di organismi; Tuttavia, studi recenti suggeriscono che TALEN legame è sensibile alla citosina metilazione 30,31. Così, coppie nucleasi appena generati, per esempio Talens clonati in vettori pCAG-T7, possono essere trasfettate transitoriamente in una linea cellulare di topo come NIH-3T3 o Neuro -2a, che imitano lo stato della cromatina embrione di topo in una certa misura. Qui, nucleasica può essere stimata utilizzando la T7 endonucleasi test o una restrizione digest del prodotto di PCR come descritto nel capitolo 5 prima sintesi di mRNA e microiniezione. Si consiglia di sequenziamento della regione genomica di interesse nel rispettoive linea cellulare e il ceppo del mouse utilizzato per esperimenti di microiniezione. In zigoti del mouse, diverse coppie Talen o ZFN lavoreranno in maniera ottimale a diverse concentrazioni di mRNA e quindi la concentrazione di lavoro ottimale della microiniezione nucleasi mRNA possono essere determinati sperimentalmente. A seconda della coppia di nucleasi, una concentrazione troppo bassa comporterà alcuna scissione, mentre troppo alta può causare letalità embrionale. A seconda della coppia nucleasi, abbiamo avuto successo usando concentrazioni di mRNA totale compresi fra 2 ng / ml e alto come 200 mcg / ul. Questi effetti sono difficili da prevedere da esperimenti in coltura cellulare e la concentrazione ottimale nucleasi sia per la sopravvivenza degli embrioni e la velocità di modifica del locus bersaglio deve essere determinato empiricamente. Altamente attivo ZFN o TALEN possono fendere la loro sequenza bersaglio oltre la fase unicellulare dell&#39;embrione microiniezione e quindi causare complessi schemi di mutagenesi und mosaicismo in fondatori. Noi e altri 4 abbiamo osservato tre o più alleli mutati distinte in un unico fondatore (Figura 5C). Così, quando si stabilisce una nuova linea di topi da questi fondatori, prole devono essere attentamente monitorati mediante sequenziamento per la presenza della mutazione favorevole da saggi di digestione forniscono la prova che solo una mutazione indefinito è presente. Una delle critiche spesso hanno espresso contro i sistemi ZFN e Talen è la possibilità che questi nucleases sono anche in grado di scindere sequenze presenti altrove nel genoma che sono simili ai siti di destinazione. Tali effetti off-target sono stati osservati con i reagenti di prima generazione utilizzando il dominio omodimerica FokI e costrutti eterodimero stati progettati per alleviare gli effetti 25 off-target. Potenziali siti off-bersaglio possono essere previsti in una certa misura in silico 32,33 e screening mediante PCR e sequenziamento. Un evidente vantaggio of usando ZFNs e Talens per la generazione di topi piuttosto che linee cellulari è la possibilità di rimuovere off mutazioni di destinazione non collegate alla modificazione del genoma desiderato eseguendo diversi reincroci ad un ceppo selvatico di scelta. Per l&#39;analisi di un gran numero di topi fondatori, prossima generazione sequenziamento dei prodotti di PCR generati dal locus nucleasi targeting e in silico previsti off-target loci potrebbe offrire una lettura qualitativa e quantitativa alternativa ai saggi di digestione dei prodotti di PCR. Le tecniche di riproduzione assistita descritte in questo protocollo sono ottimizzati per i ceppi mouse standard utilizzati per esperimenti di microiniezione come C57BL/6J o B6D2F1. I topi di diversa origine, quali ceppi dell&#39;esoincrocio, in linea di principio essere utilizzati per approcci modifica del genoma e potrebbero fornire un background genetico più adatto per domande di ricerca specifiche. Le prestazioni di tecniche di riproduzione assistita come la superovulazione può essere predicatoCTED per un numero di ceppi 34-36 ma potrebbe richiedere ulteriore ottimizzazione per i ceppi non standard al fine di ottenere un numero sufficiente di embrioni per nucleasi microiniezione. Oltre ZFN e TALEN, nuove nucleasi di design come il sistema CRISPR/Cas9 RNA-guidata 9,37,38 ora sono stati introdotti per applicazioni di editing genoma. Tutti i metodi per la microiniezione e l&#39;analisi di animali fondatori qui descritti sono applicabili a CRISPR/Cas9 e le modalità future di modifica del genoma anche.

I topi sono di gran lunga la piattaforma più popolare per la generazione di modelli animali transgenici. Il toolbox versatile per l&#39;ingegneria genetica dell&#39;embrione topo 1-3 è stato recentemente prorogato di approcci di modifica del genoma basato su nucleases stilisti come nucleasi dito di zinco (ZFN) 4-6, trascrizione nucleases effettrici attivatore-like (Talen) 7,8, ed i cluster brevi ripetizioni palindromiche regolarmente intervallati (CRISPR) / Sistema CRISPR-associato (CAS) 9 9. ZFN e la funzione TALEN come coppie di due domini progettati su misura a base di proteine ​​che legano il DNA (array di proteine ​​dita di zinco e ripetere variabile di-residui (RVDS), rispettivamente) che sono ciascuno accoppiato al endonucleasi FokI 10-12. Viceversa, la specificità di taglio del DNA Cas9-mediata è fornito da transattivazione RNA CRISPR (crRNA e tracrRNA, che possono anche essere combinati in una singola molecola di RNA chimerico guida definito RNA) 11 che agiscono in un complesso con l&#39;Proteine ​​CRISPR. Talens con una sequenza definita di RVDS può essere rapidamente costruito dagli sperimentatori individuali con una moltitudine di strategie di assemblaggio scegliere 13-17. CRISPR/Cas9 promette ancor meno generazione ad alta intensità di manodopera di nucleasi di design, tuttavia la specificità della guida RNA-DNA-binding non è ancora completamente risolto 18,19. Generazione di ZFNs misura è stata finora limitata a laboratori accademici specializzati e fornitori commerciali come Sangamo Biosciences e il servizio Sigma CompoZr. In generale, genome editing con nucleasi design mira a introdurre doppie rotture del filamento (DSB) a loci genomici definito, che poi attirano fine nonhomologous giunzione (NHEJ) o ricombinazione omologa (HR) di riparazione del DNA macchinari 10,12. Riparazione NHEJ-mediata di un DSB provoca spesso l&#39;introduzione di inserzioni e delezioni in prossimità del sito di riparazione. Così NHEJ riparazione cun essere sfruttati per buttare giù la funzione di un gene bersaglio introducendo una mutazione frame-shift ai geni codificanti proteine ​​sequenza 4,7,9. In alternativa, aggiunta o sostituzione di informazioni genetiche definite possono essere raggiunti realizzando un donatore DNA insieme alle nucleasi progettista. Un donatore di DNA comprende ricercatore-progettato sequenze di DNA fiancheggiati da regioni di omologia con il locus bersaglio, quindi servire come modello per la riparazione DSB da HR. Entrambi i plasmidi 5,6,20 e singolo filamento oligonucleotidi 8,9,21 sono stati utilizzati con successo come donatori. Né-NHEJ né HR-mediata editing genoma richiedono l&#39;introduzione di un marcatore selezionabile nel genoma dell&#39;embrione mouse, che rende queste strategie particolarmente adatto per la creazione di piccole alterazioni nella sequenza nucleotidica senza disturbare l&#39;architettura genetica complessiva. In questo protocollo si descrivono tutte le procedure essenziali per l&#39;editing genoma nellaembrione di topo usando Talens. Questi includono 1) individuazione di un sito di destinazione TALEN 22, 2) la costruzione di Talens dal Golden Gate clonazione 13, 3) la sintesi in vitro di TALEN mRNA, 4) la microiniezione di mRNA TALEN in ovociti di topo fecondati, 5) le procedure chirurgiche per il trasferimento di embrioni e 6) analisi di mutagenesi TALEN indotta in animali fondatori. Ci concentriamo su TALEN mRNA microiniezione e lo screening dei fondatori per NHEJ-indotte inserzioni / delezioni. A questo scopo abbiamo generato bifunzionali costrutti Talen che permettono sia l&#39;espressione in cellule di mammifero, quando trasfettate come plasmidi e nella sintesi in vitro di TALEN mRNA per microiniezione in embrioni di topo. Questi costrutti comprendono una spina dorsale RACCONTO troncato 23 fusi per eterodimerica FokI domini 24,25 per ottimizzare la modifica del genoma nelle cellule di mammifero. Questo protocollo può anche essere adottata per microiniezione di altre nucleasi di design o per le iniezioni combinate di nucleasi di designe costrutti donatori (disegno di donatori di DNA è stata descritta in eccellenti pubblicazioni tecniche Wefers et al. 26,27). Dichiarazione etica Tutti gli esperimenti sugli animali sono stati eseguiti in conformità con le linee guida e regolamenti del veterinario cantonale del Canton Zurigo.

<table border="0" cellpadding="0" cellspacing="0" width="524">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">BsaI</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">R0535S or L</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Esp3I</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">ER0451</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T4 Ligase</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0202S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Spectinomycin</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">S0692-1ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ampicillin&#160;</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">A0166</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">X-Gal</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">B4252</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">IPTG</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">I6758</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Plasmid-Safe nuclease</td>
			<td style="width:111px;">Epicentre</td>
			<td style="width:119px;">E3101K</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">27106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAGEN Plasmid Midi Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">12143</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAquick PCR Purification Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">28106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">mMESSAGE mMACHINE T7 Ultra Kit</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM1345</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NucAway Spin Columns</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM10070</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNaseZAP</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">R2020-250ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NorthernMax Formaldyde Load Dye</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM8552</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNA Millennium Markers</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM7150</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">10x TBE buffer</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">B52</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T7 endonuclease</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0302S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">pGEM-T EasyVector System I</td>
			<td style="width:111px;">Promega</td>
			<td style="width:119px;">A3600</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">S-7563</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">pregnant mare&#39;s serum gonadotrophin (PMSG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">G4877</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">human chorionic gonadotropin (hCG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">CG5</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M2 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7167</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M16 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7292</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Mineral oil, embryo tested</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M8410</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ketamine</td>
			<td style="width:111px;">CentraVet</td>
			<td style="width:119px;">Ket 201</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Xylazine</td>
			<td style="width:111px;">Sigma Aldrich</td>
			<td style="width:119px;">46995</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Equipment/Tools</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Inverted microscope with Nomarski DIC optics (for example Nikon Eclipse TE200)</td>
			<td style="width:111px;">Nikon</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Micromanipulator units (for example Narishige, NT88NF)</td>
			<td style="width:111px;">&#160;Narishige</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo holding capillaries</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;">B100-75-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo injection capillaries</td>
			<td style="width:111px;">Narishige</td>
			<td style="width:119px;">GD-1</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Capillary puller (for example Sutter P97)</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Microforge (for example Narishige MF-900)</td>
			<td style="width:111px;">Narishige&#160;</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Walton skin scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14077-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14041-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical probe</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">10140-03</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clip system (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12031-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clips (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12032-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dumont fine forceps 5</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11254-20</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria curvrd forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11370-31</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria fine forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11399-80</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dietrich bulldog clamp</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">18038-45</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Animals</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">C57BL/6J mice</td>
			<td style="width:111px;">Jackson labs</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">CD-1 mice</td>
			<td style="width:111px;">Charles river</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
	</tbody>
</table>

mouse genome engineering using designer nucleases

Topi transgenici portatori modificazioni sito-specifiche genoma (knockout, knock-in) sono di importanza vitale per sezionare sistemi biologici complessi nonché per la modellazione malattie umane e testare strategie terapeutiche. I recenti progressi nell&#39;uso di nucleasi design come nucleasi dito di zinco (ZFNs), trascrizione attivatore-come nucleases effettrici (Talens), ed i cluster brevi ripetizioni palindromiche regolarmente intervallati (CRISPR) / CRISPR-associato (CAS) Sistema 9 per il sito- specifico ingegneria genomica aperta la possibilità di effettuare una rapida modificazione genoma mirata in virtualmente qualsiasi specie di laboratorio senza la necessità di fare affidamento su staminali embrionali (ES) tecnologia cellulare. Un esperimento editing genoma inizia tipicamente con l&#39;identificazione di design nucleasi siti bersaglio all&#39;interno di un gene di interesse seguita dalla costruzione di domini leganti il ​​DNA personalizzati per dirigere l&#39;attività nucleasi al locus genomico investigatore definito. Plasmidi Designer nucleasi sono in vitro &lt;/ Em&gt; trascritto per produrre mRNA per la microiniezione degli ovociti di topo fecondati. Qui, forniamo un protocollo per realizzare la modifica del genoma di mira da iniezione diretta di TALEN mRNA in oociti di topo fecondati.

Abbiamo costruito plasmidi destinazione compatibili con l&#39;assieme dorato GateTALEN pubblicato da Cermak et al. 13 che permettono l&#39;espressione di Talens in cellule di mammifero e in vitro sintesi di mRNA dal promotore T7 fago (Figura 1C). Questi plasmidi carry domains Foki eterodimeriche (mutazioni eld o KKR) oggi dimostrati ridurre gli effetti fuori bersaglio relativamente per omodimeri Foki ea potenziare l&#39;attività scissione rispetto alla prima generazione FokI eterodimeri 25,29. Le reazioni di montaggio Golden gate # 1 e # 2 sono di solito molto efficiente e ogni colonia bianca, quando analizzato da colonia PCR, mostra il modello previsto per il particolare numero di RVDS clonati (Figure 1B e 1D). Gel di analisi in vitro sintetizzato mRNA (Figura 2) dovrebbe rivelare una singola banda distinguibile con poca o nessuna sbavatura per ogni campione analizzato. Ci dovrebbe essere un cambiamento chiara dimensione tra i campioni L1/R1 e L2/R2, L3/R3, che indica poliadenilazione successo. Animali fondatori possono essere sottoposti a screening per alleli mutati NHEJ indotte mediante genotipizzazione PCR seguito da digestione T7 endonucleasi (figura 3) o una digestione di restrizione usando un enzima che scinde la sequenza wild type all&#39;interno della regione distanziatore della coppia nucleasi (Figura 4). Il saggio T7 endonucleasi è applicabile a qualsiasi tipo di mutazione indipendentemente dalla sequenza genomica specifica all&#39;interno della regione distanziatore della coppia nucleasi iniettato; tuttavia, si rileva solo i disallineamenti tra i filamenti di DNA in prodotti di PCR eteroduplici. Così, nel raro caso in cui uno dei fondatori porta due alleli mutati in modo identico, i prodotti di PCR potrebbero non mostrare alcun modello T7 digestione. Questa distinzione è tuttavia sempre possibile quando un sito di restrizione specifico si trova all&#39;interno della regione spacer nucleasi che verrà eliminato NHEJIndotta inserzioni / delezioni (Figura 5). Qui, le bande non digerito indicano la presenza di mutazioni, e l&#39;assenza di qualsiasi prodotto digeriti suggerisce fortemente fondatore trasportano mutazioni in entrambi gli alleli del gene targeting (contrassegnati con l&#39;asterisco sono obbligatori in Figura 4b). <img alt="Figura 1" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig1highres.jpg" src="/files/ftp_upload/50930/50930fig1.jpg" width="600" /> Figura 1. Golden Gate clonazione di Talen RVDS in eterodimeriche vettori pCAG-T7-Destination. A) Assemblea dei RVD matrici in vettori pFUS. Ecco un esempio viene mostrato per una coppia di TALEN con singoli array TALE composto da 15 RVDS e 17 RVDS, rispettivamente (per array TALE più di 21 RVDS, tre assemblee pFUS-RVDS sono necessari, non mostrato). Le frecce indicano primer per b) i prodotti pFUS specifico reazioni colonia PCR PCR.amplificato dalle assemblee pFUS corrette in genere mostrano una banda corrispondente alla durata totale di tutte RVDS clonati (ad esempio circa 1,1 kb per 10 RVDS) e C &quot;scala&quot; dei piccoli gruppi meno importanti a causa della natura ripetitiva di array RVD.) assemblaggio finale di array pFUS-RVD e un plasmide contenente l&#39;ultima ripetizione (PLR) in eterodimeriche vettori di espressione Talen con FokIELD e FokIKKR varianti, rispettivamente. La spina dorsale TALEN (annotato come N e C) ricorda l&#39;architettura pubblicato da Miller et al. 23 Il CAG (CMV elemento presto enhancer / pollo beta-actina) promotore assicura alti livelli di espressione in cellule di mammifero trasfettate, mentre il promotore T7 fago permette in sintesi vitro mRNA (utilizzare SacI per la linearizzazione del vettore a valle del codone di stop nucleasi). D) Colony PCR utilizzando primer indicati dalle frecce C) permette di identificare correttamente montato Talens. Full-lungezzah prodotti di PCR sono spesso meno evidenti, mentre l &#39;&quot;effetto scala&quot; rappresenta un indicatore affidabile di montaggio successo. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig1highres.jpg" target="_blank">Clicca qui per vedere l&#39;immagine ingrandita</a> . <img alt="Figura 2" fo:content-width="3in" fo:src="/files/ftp_upload/50930/50930fig2highres.jpg" src="/files/ftp_upload/50930/50930fig2.jpg" width="300" /> Figura 2. . Controllo di qualità dei nuclease mRNA in sintesi vitro mediante elettroforesi su gel di agarosio mRNA ZFN sono mostrati come esempio (L, sinistra ZFN, R, destra ZFN). I campioni L1/R1 mostrano mRNA prima di poliadenilazione, i campioni L2/R2 spettacolo poliadenilato mRNA e L3/R3 mostra purificato mRNA poliadenilato. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig2highres.jpg" target="_blank">Clicca qui per vedere l&#39;immagine ingrandita</a> . <img<html> alt = &quot;Figura 3&quot; fo: content-width = &quot;6in&quot; fo: src = &quot;/ files/ftp_upload/50930/50930fig3highres.jpg&quot; src = &quot;/ files/ftp_upload/50930/50930fig3.jpg&quot; width = &quot;600&quot; /&gt; Figura 3. Esempio di endonucleasi saggio T7 utilizzato per l&#39;identificazione di animali fondatori portatori di mutazioni nucleasi indotta del locus bersaglio. A) Una coppia TALEN è stato progettato per fendere all&#39;interno della regione codificante del mouse gene della proteina prionica (PRNP, sequenza bersaglio TALEN può essere fornito su richiesta). Un prodotto di PCR viene generato utilizzando un primer forward (F) situato 110 bp a monte e un primer reverse (R) 250 bp a valle del sito di clivaggio TALEN. B) Il prodotto di PCR viene successivamente sottoposto a heteroduplex formazione e T7 digestione con endonucleasi. C) TALEN mutagenesi indotta all&#39;interno della regione genomica mirata di singoli fondatori è rivelato dalla presenza di un full-length prodotto PCR con prodotti di digestione di 250 e 110 bps.50930/50930fig3highres.jpg &quot;target =&quot; _blank &quot;&gt; Clicca qui per vedere l&#39;immagine ingrandita. <img alt="Figura 4" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig4highres.jpg" src="/files/ftp_upload/50930/50930fig4.jpg" width="600" /> Figura 4. Esempio di una restrizione digest di prodotti di PCR utilizzati per l&#39;identificazione degli animali fondatori portatori di mutazioni nucleasi-indotte del luogo di destinazione. ZFN specifici per il mouse Rosa26 locus 29 bersaglio di un sito di restrizione XbaI all&#39;interno introni 1. A) Fondatori sono stati proiettati per la genotipizzazione PCR utilizzando un primer forward (F) situato a 500 bp a monte e un primer reverse (R) 250 bp a valle del sito di taglio. B) Digestione dei prodotti di PCR con XbaI svela i modelli di digestione che indicano topi con mutazioni bi-alleliche (contrassegnati con asterisco), mono alleliche mutazioni (bande digerito e digerito, ad esempio animali 2)e topi WT (digestione completa, ad esempio animali 21). C) sequenziamento di topi con potenziali modifiche bi-allelica mostra fino a 3 (24 animali) distinti inserzioni / delezioni. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig4highres.jpg" target="_blank">Clicca qui per vedere l&#39;immagine ingrandita</a> . <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Nome del Primer </td><td> Sequenza 5 &#39;a 3&#39; </td></tr><tr><td> pCR8_F1 </td><td> ttgatgcctggcagttccct </td></tr><tr><td> pCR8_R1 </td><td> cgaaccgaacaggcttatgt </td></tr><tr><td> TAL_F1 </td><td> ttggcgtcggcaaacagtgg </td></tr><tr><td> TAL_R2 </td><td> ggcgacgaggtggtcgttgg </td></tr><tr><td> TAL_Seq_5-1 </td><td> catcgcgcaatgcactgac </td></tr></tbody></table> Tabella 1. Sequenze di primer utilizzati per la PCR e sequenziamento delle colonie all&#39;interno del gruppo di Golden Gate TALENprotocollo. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Plasmide / Collezione </td><td> Collaboratore </td><td> Addgene ID </td><td> Commenti </td></tr><tr><td> Golden Gate TALEN e TAL Effector Kit 2.0 </td><td> Voytas lab </td><td> 1000000024 </td><td> Contiene tutti i plasmidi necessari per l&#39;assemblaggio Golden Gate TALEN </td></tr><tr><td> vettori di destinazione pCAG-T7-TALEN -KKR/ELD </td><td> Pelczar lab </td><td> 40131, 40132 </td><td> Add-on plasmidi per l&#39;espressione TALEN in cellule di mammifero e in vitro sintesi di mRNA </td></tr></tbody></table> Tabella 2. Plasmidi e collezioni plasmidi necessari per il montaggio Golden Gate TALEN possono essere ottenuti da Addgene ( <a href="http://www.addgene.org">www.addgene.org</a> ). <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> OnlineRisorsa </td><td> Commenti </td></tr><tr><td> http://tale-nt.cac.cornell.edu </td><td> Progettazione di TALEN; TALEN previsione off-target </td></tr><tr><td> http://zifit.partners.org/ZiFiT/ </td><td> Progettazione di TALEN, APERTO ZFN, CoDA ZFN, CRISPR/Cas9 </td></tr><tr><td> http://www.genome-engineering.org </td><td> Progettazione di TALEN, CRISPR/Cas9; CRISPR/Cas9 previsione off-target </td></tr><tr><td> http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html </td><td> Assemblea dei TALEN sequenze per la conferma dei risultati di sequenziamento </td></tr><tr><td> http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html </td><td> Progettazione di assemblaggio modulare ZFN </td></tr><tr><td> www.genomecenter.ucdavis.edu/s egallab / segallabsoftware </td><td> Progettazione di assemblaggio modulare ZFN </td></tr></tbody></table> Tabella 3. Risorse online per la progettazione ZFN, TALEN, e CRISPR/Cas9. </strong&gt;

Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

Mouse Genome Engineering Using Designer Nucleases

Nucleasi di stilisti come nucleasi dito di zinco (ZFNs) e attivatore di trascrizione come nucleases effettrici (Talens) possono essere utilizzati per modificare il genoma di embrioni preimpianto di topo attivando sia la fine nonhomologous giunzione (NHEJ) e la ricombinazione omologa (HR) percorsi. Questi progressi consentono la rapida generazione di mouse con precise modificazioni genetiche.

Genoma Ingegneria mouse usando Nucleases Designer

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

mouse-genome-engineering-using-designer-nucleases

Research

JoVE Journal

Biology

28.6K Views.  University of Zurich.  Nucleasi di stilisti come nucleasi dito di zinco (ZFNs) e attivatore di trascrizione come nucleases effettrici (Talens) possono essere utilizzati per modificare il genoma di embrioni preimpianto di topo attivando sia la fine nonhomologous giunzione (NHEJ) e la ricombinazione omologa (HR) percorsi. Questi progressi consentono la rapida generazione di mouse con precise modificazioni genetiche. 

Video: Mouse Genome Engineering Using Designer Nucleases

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

Dissezione lordo e Arti di epiteli sensoriali dell&#39;orecchio interno in adulti Zebrafish ( Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Ricerca

Biologia

Engineering Cell-permeable Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can make use of the translocating ability of so-called cell penetrating peptides (CPPs), also designated as protein transduction domains (PTDs). The TAT-CPP derived from the human immunodeficiency virus type 1 (HIV-1) Tat (trans-activator of transcription) protein has been widely used. The positively charged TAT promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or/and direct membrane penetration2. In combination with a nuclear localization signal (NLS) fusion proteins are able to enter the nucleus exhibiting functionality. Our video presentation demonstrates, as an exemplification for the engineering of cell-permeable proteins, the construction, production and application of a cell-permeable version of the DNA-modifying enzyme Cre.
Cre is a site-specific recombinase that is able to recognize and recombine 34 base pair loxP sites in mammalian cells in vitro and in vivo. Therefore the Cre/loxP system is widely used to conditionally induce mutations in the genome of living cells3,4. The delivery of active Cre recombinase to cells, however, represents a limitation.
We describe the pSESAME vector system, which allows a direct insertion of the gene-of-interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner. Rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility. We demonstrate how to express and purify recombinant cell-permeant proteins in and from E. coli. The functionality of the recombinant Cre protein is finally validated in cell culture by assessing its intracellular recombinase activity.

Protein transduction enables the direct delivery of biologically active proteins into cells. In contrast to conventional methods such as DNA transfection or viral transduction this non-invasive paradigm allows highly efficient cellular manipulation in a titratable manner circumventing cellular toxicity and the risk of oncogenic transformation by permanent genetic modification.

Ingegneria Cell-permeabile proteine

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Genome-wide Analysis of Aminoacylation (Charging) Levels of tRNA Using Microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both prokaryotic and eukaryotic cells lead to translational regulation which is a major cellular mechanism of stress response. Familiar examples are the stringent response in E. coli and the Gcn2 stress response pathway in yeast ([2-6]). Recent work in E. coli and S. cerevisiae have shown that tRNA charging patterns are highly dynamic and depends on the type of stress experienced by cells [1, 6, 7]. The highly dynamic, variable nature of tRNA charging makes it essential to determine changes in tRNA charging levels at the genomic scale, in order to fully elucidate cellular response to environmental variations. In this review we present a method for simultaneously measuring the relative charging levels of all tRNAs in S. cerevisiae . While the protocol presented here is for yeast, this protocol has been successfully applied for determining relative charging levels in a wide variety of organisms including E. coli and human cell cultures[7, 8].

Genome-wide Analysis of Aminoacylation Charging Levels of tRNA Using Microarrays

We describe a method for microarray analysis to determine relative aminoacylation levels of all tRNAs from S. cerivisiae.

Genoma Analisi dei Aminoacylation (carica) I livelli di tRNA usando i microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both ...

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Genoma Analisi mediante ChIP per identificare Isoform obiettivi specifici per Gene

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Human cancer and response to therapy is better represented in orthotopic animal models. This paper describes the development of an orthotopic mouse model of ovarian cancer, treatment of cancer via oral delivery of drugs, and monitoring of tumor cell behavior in response to drug treatment in real time using in vivo imaging system. In this orthotopic model, ovarian tumor cells expressing luciferase are applied topically by injecting them directly into the mouse bursa where each ovary is enclosed. Upon injection of D-luciferin, a substrate of firefly luciferase, luciferase-expressing cells generate bioluminescence signals. This signal is detected by the in vivo imaging system and allows for a non-invasive means of monitoring tumor growth, distribution, and regression in individual animals. Drug administration via oral gavage allows for a maximum dosing volume of 10 mL/kg body weight to be delivered directly to the stomach and closely resembles delivery of drugs in clinical treatments. Therefore, techniques described here, development of an orthotopic mouse model of ovarian cancer, oral delivery of drugs, and in vivo imaging, are useful for better understanding of human ovarian cancer and treatment and will improve targeting this disease.

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Orthotopic animal models of ovarian cancer replicate better human disease and therefore enhance our understanding of cancer progression and tumor response to therapy. A mouse model receives an intrabursal injection of luciferase-expressing ovarian tumor cells. Treatment is administered via oral gavage. Tumor growth is monitored by in vivo imaging system.

Imaging in vivo e trattamenti terapeutici in un modello di mouse ortotopico di cancro ovarico

Human cancer and response to therapy is better represented in orthotopic animal models.  This paper describes the development of an orthotopic mouse model ...

Flow Cytometry Purification of Mouse Meiotic Cells

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the unique differentiation programs that are manifest during meiosis. Two principal methods have been developed to purify, to varying degrees, various meiotic fractions from both adult and immature animals: elutriation or Staput (sedimentation) using BSA and/or percoll gradients. Both of these methods rely on cell size and density to separate meiotic cells1-5. Overall, except for few cell populations6, these protocols fail to yield sufficient purity of the numerous meiotic cell populations that are necessary for detailed molecular analyses. Moreover, with such methods usually one type of meiotic cells can be purified at a given time, which adds an extra level of complexity regarding the reproducibility and homogeneity when comparing meiotic cell samples.
Here, we describe a refined method that allows one to easily visualize, identify, and purify meiotic cells, from germ cells to round spermatids, using FACS combined with Hoechst 33342 staining7,8. This method provides an overall snapshot of the entire meiotic process and allows one to highly purify viable cells from most stage of meiosis. These purified cells can then be analyzed in detail for molecular changes that accompany progression through meiosis, for example changes in gene expression9,10and the dynamics of nucleosome occupancy at hotspots of meiotic recombination11.

An efficient method to obtain highly purified viable meiotic fractions from mouse testis is described, which combines a refined cell dissociation protocol with fluorescent activated cell sorting (FACS). This method takes advantage of differences in the DNA content and nuclear density of discrete meiotic fractions.

Purificazione Citometria a flusso di cellule di topo Meiotic

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

Genome-Wide Screen per le destinazioni miRNA utilizzo di target Biblioteca MISSION ID

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

Genome Editing con nucleasi zinco Finger CompoZr personalizzati (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

In Vivo Modellazione del genoma umano Morbid utilizzando Danio rerio

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.

Genome Editing in<em&gt; Mexicanus Astianatte</em&gt; Uso Trascrizione Activator simile Effector nucleasi (Talens)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...

Methods Article

Genoma Ingegneria mouse usando Nucleases Designer