Name: use of bisection to reduce mitochondrial dna in the bovine oocyte
Uploaded: 2022-07-06T13:40:00.000+00:00
Duration: 6 min 15 s
Description: Watch this Scientific Journal Video about Use of Bisection to Reduce Mitochondrial DNA in the Bovine Oocyte at JoVE.com

The authors wish to thank their colleagues at Utah State University, the Reproductive Science researchers at the San Diego Zoo, and Dr. Rebecca Krisher at Genus PLC.

The following protocol follows the animal care and ethics guidelines provided by Utah State University.
1. Media preparation
<ol>
	<li>Prior to oocyte handling, prepare the following solutions, as described in Table 1: 400 &#181;L of Hyaluronidase Solution, 500 &#181;L of T2 media, 1,020 &#181;L of T20 media, and 800 &#181;L of T10 media.</li>
	<li>Divide the T10 media into two wells of a four-well plate, 400 &#181;L per well. Label one well with &#34;M&#34; and the second well with &#34;MR.&#34; Place in a 5% CO2 incubator until after bisection.</li>
	<li>Prepare 500 &#181;L of Cytochalasin B (CB)/Synthetic Oviductal Fluid with HEPES (HSOF). Aliquot 50 &#181;L of CB/HSOF solution into a separate 1.5 mL centrifuge tube.</li>
	<li>Prepare 40 &#181;L of Pronase Solution. Centrifuge for at least 30 s at 2,680 x g. Mix 20 &#181;L of the supernatant with 20 &#181;L of T2 to a new centrifuge tube; this forms a diluted, 5 mg/mL pronase solution.</li>
	<li>Prepare 3 mL of HSOF. On a search plate, separately deposit four 400 &#181;L drops; place this plate under a stereomicroscope.</li>
	<li>Prepare 500 &#181;L of CB/T20 solution.</li>
</ol>
2. In vitro maturation (IVM) of bovine oocytes
<ol>
	<li>IVM: Culture aspirated cumulus-oocyte complexes (COCs) at 38.5 &#176;C in a 5% CO2 incubator for 21 h in a four-well dish of maturation media containing 10% FBS, 0.26 IU/mL FSH, and 100 U/mL penicillin/streptomycin.</li>
	<li>Perform the following steps to denude the oocytes.
	<ol>
		<li>Collect the desired number of the COCs using a 200 &#181;L pipette, and deposit them at the bottom of a 1.5 &#181;L centrifuge tube.</li>
		<li>Add the same volume of 0.6 mg/mL hyaluronidase to the centrifuge tube with the oocytes (i.e., if the volume of oocytes and IVM media is 100 &#181;L, add 100 &#181;L of hyaluronidase).</li>
		<li>Pipette the solution up and down without creating bubbles, until all the cumulus cells have been removed.</li>
	</ol>
	</li>
	<li>Check the maturation of the oocytes.
	<ol>
		<li>Use the pipette to add 200 &#181;L of HSOF from one of the four HSOF drops on the search plate to the oocyte/hyaluronidase solution.</li>
		<li>Transfer the oocytes from the hyaluronidase/HSOF drop and place them in unused 400 &#181;L of HSOF drop. Wash them with two additional HSOF drops to assist in removing hyaluronidase and cumulus cell remnants.</li>
		<li>Using a mouth pipette (or a 10 &#181;L pipette and tip) and high microscopic magnification, roll and select the oocytes based on polar body presence.</li>
		<li>After sorting the oocytes, collect the desired number of MII oocytes to be bisected, and place them in 400 &#181;L of HSOF drop. 
		NOTE: If the oocytes have been outside of the incubator for longer than 30 min, oocytes may be placed back into a well of maturation media and placed in a CO2-controlled incubator to rest for at least 30 min. Limit the number of oocytes to be bisected to an amount that is feasible to finish bisecting in approximately 30 min to minimize time outside of incubation. If ooplasts are to be fused with a somatic cell, activated, and cultured as embryos, oocytes should be enucleated at this time.</li>
	</ol>
	</li>
</ol>
3. Centrifugation of the oocytes
NOTE: If oocytes were placed in the incubator in maturation media, move them to the HSOF drop from which they were most recently collected.
<ol>
	<li>Using a mouth pipette, collect the selected mature oocytes from the HSOF drop, and place them into the 1.5 mL tube containing 50 &#181;L of the HSOF/CB solution. Centrifuge the oocytes at 15,000 x g for 12 min. 
	NOTE: It is not detrimental for bubbles to be present in the centrifuge tube.</li>
	<li>While the oocytes are being centrifuged, prepare the bisection plate.
	<ol>
		<li>Make the pattern as shown in Figure 1 on the lid of a 60 mm petri dish (20 &#181;L per drop), and fully cover the drops with mineral oil.</li>
		<li>Using a thin-tipped marker, mark the lines underneath the dish, as shown in Figure 2.
		<ol>
			<li>Draw a box around the pronase drop and a line between the CB/T20 drops and the bottom row of T20 drops.</li>
		</ol>
		</li>
		<li>Cover the dish with an opaque lid until centrifugation is complete to prevent osmolarity changes of microdrops.</li>
	</ol>
	</li>
	<li>As soon as centrifugation is complete, use a 200 &#181;L pipette to collect the oocytes within the solution, and move them into an empty portion of a new search plate with four 400 &#181;L HSOF drops.</li>
	<li>Collect and wash the oocytes through the four HSOF drops.</li>
</ol>
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/64060/64060fig01.jpg" /> 
Figure 1: Bisection plate. All drops shown have a 20 &#181;L volume. The plate has a diameter of 60 mm. Drops have been completely covered with mineral oil. Oocytes will first be placed in the uppermost and leftmost T2 drop (indicated here with a star). PRO/T2: 10 &#181;L of pronase and 10 &#181;L of T2, combined prior to creating microdrops. CB/T20: 1 &#181;L of cytochalasin B per 1 mL of T20, combined prior to creating microdrops. <a href="https://www.jove.com/files/ftp_upload/64060/64060fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/64060/64060fig02.jpg" /> 
Figure 2: Marked bisection plate. Lines are drawn with a thin-tipped marker on the bottom of the plate, to provide location references for observations and oocyte and ooplast transfers made underneath the microscope. Oocytes will first be placed in the uppermost and leftmost T2 drop (indicated here with a star). <a href="https://www.jove.com/files/ftp_upload/64060/64060fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
4. Preparation of the oocyte for bisection
NOTE: The following process involves preparation of the oocytes for bisection.
<ol>
	<li>Turn the heating stage on to 37 &#176;C.</li>
	<li>Use a mouth pipette to move the centrifuged oocytes from the HSOF drop to the top left T2 drop of the bisection plate, then wash the oocytes through the next three drops on the top row (T2, T20, T20).</li>
	<li>Deposit the oocytes in one of the pronase drops, assuring there is little to no contact between them. 
	NOTE: The removal of the zona pellucida can take varying amounts of time, but typically occurs between 30-120 s with the use of a heating stage. The absence of a heating stage will extend this time.</li>
	<li>Observe the oocytes until there is clear deformation of the zonae pellucidae (see Figure 3).</li>
	<li>Once a single oocyte zona pellucida has become deformed, move that oocyte to the neighboring T2 drop. Repeat as additional oocytes become deformed, until all oocytes have been removed from the pronase and placed in the T2 drop.</li>
	<li>Observe the oocytes until only a thin layer of the zone pellucida remains.</li>
	<li>Wash the oocytes through the next three drops within the row (T2, T20, T20), then deposit them in vertical lines within the CB/T20 drops (see Figure 4).
	<ol>
		<li>Begin with fewer oocytes in the vertical lines and increase the number of oocytes per drop as bisection skills progress.</li>
	</ol>
	</li>
</ol>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/64060/64060fig03.jpg" /> 
Figure 3: Removal of zona pellucida using pronase. (80x) An oocyte zona pellucida will begin to appear deformed when the pronase has affected the zona pellucida enough for the oocyte to be moved to the adjacent T2 drop. <a href="https://www.jove.com/files/ftp_upload/64060/64060fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/64060/64060fig04.jpg" /> 
Figure 4: Oocyte orientation in bisection drops. (80x) Zona-free oocytes are deposited in a near-vertical orientation within each CB/T20 drop prior to bisection. <a href="https://www.jove.com/files/ftp_upload/64060/64060fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
5. Bisection of the oocytes
<ol>
	<li>Focus on the first, left-most CB/T20 (bisection) drop that contains oocytes, and use a mouth pipette to rotate the oocytes, so that the mitochondria-dense portion of each oocyte is either facing toward or away from the microscope&#39;s arm. 
	NOTE: The mitochondria-dense portion will not contain lipids, which appear as the darkest portion of the oocyte following centrifugation.</li>
	<li>Rest the tip of the microblade to the left of the topmost oocyte, in line with the space directly above the mitochondria-dense portion. Keeping the tip of the blade in the same place, carefully lower the blade to cut all the way through the oocyte.
	<ol>
		<li>Ensure that the mitochondria-dense ooplast and mitochondria-reduced ooplast are similar in size; bisection should cut each oocyte in half to produce two ooplasts. 
		NOTE: Comparative sizes of ooplasts produced from a single oocyte may vary based on research goals; if mitochondria-reduced ooplasts are to be fused with a somatic cell, their volume should be greater than the mitochondria-dense ooplasts&#39;.</li>
		<li>Ensure that the blade is bisecting the oocyte above the mitochondria-dense portion and below the lipid-dense portion, in the clearest segment of the centrifuged oocyte.</li>
	</ol>
	</li>
	<li>When lifting the blade, ensure that the same line is maintained, and that the tip of the blade remains in same place, then gently lift the tip from the plate.</li>
	<li>Repeat bisection steps for all oocytes within the first bisection drop. If oocytes are present in additional drops, orient and bisect the remaining oocytes.</li>
	<li>Using a mouth pipette, collect mitochondria-reduced ooplasts from the first bisection drop. Place them in the left-hand T20 drop located in the bottom row of the plate. Repeat for all remaining bisection drops. 
	NOTE: Mitochondria-reduced ooplasts will contain lipids, that are darker in color than the rest of the oocyte.</li>
	<li>Using a mouth pipette, collect mitochondria-dense ooplasts from the first bisection drop. Place them in the right-hand T20 drop located in the bottom row of the plate. Repeat for all remaining bisection drops. 
	NOTE: Mitochondria-dense regions will have a visible conglomeration of organelles that will be light gray in appearance.</li>
	<li>Retrieve the T10 four-well dish from the incubator. Using a mouth pipette, move all mitochondria-reduced ooplasts to the well labeled &#34;MR,&#34; and move the mitochondria-dense ooplasts to the well labeled &#34;M.&#34;</li>
	<li>Place the four-well plate back into the CO2-controlled incubator. Allow ooplasts to rest for at least 30 min prior to quantification of mtDNA.</li>
</ol>
6. Quantification of mtDNA
<ol>
	<li>Use a DNA extraction kit designed to extract material from a small sample to extract DNA from individual samples (single oocytes, single mitochondria-dense ooplasts, single mitochondria-depleted ooplasts).</li>
	<li>Use a DNA quantification method of the choice to ensure that DNA was successfully extracted from each sample. If quantitative polymerase chain reaction (qPCR) will not be completed at that time, freeze the extracted DNA in a labeled tube in a -80 &#176;C freezer.</li>
	<li>Perform qPCR
	<ol>
		<li>Refer to Table 2 to determine the volume of each reagent to add to each qPCR tube, along with the primer sequences. These primers are designed to amplify the 12S region of bovine mtDNA.</li>
		<li>Set the initial denaturation time for 10 min, followed by 35 cycles of: 30 s of denaturation at 94 &#176;C, 15 s of annealing at 60 &#176;C, and 15 s of extension at 72 &#176;C. When the reaction is complete, record the cycle threshold (Ct) values. 
		NOTE: In order to obtain relative mtDNA copy number values, a standard curve must be produced using samples with known quantities of mtDNA copy numbers, that increase exponentially. The cycle threshold values then need to be manipulated using the following formulas to determine relative mtDNA copy numbers.</li>
		<li>Obtain the concentration of the DNA using the equation below: 
		Concentration of DNA = (10(Ct-intercept/slope)) x tested volume</li>
		<li>Obtain the copy number using the equation below: 
		Copy number = <img alt="Equation 1" src="/files/ftp_upload/64060/64060eq01.jpg" style="margin: auto;" /></li>
		<li>Obtain the copy number using the equation below: 
		Copy number per cell = 2 x <img alt="Equation 2" src="/files/ftp_upload/64060/64060eq02.jpg" style="margin: auto;" /></li>
	</ol>
	</li>
</ol>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/64060/64060fig05.jpg" /> 
Figure 5: Somatic cell mtDNA standard curve. This standard curve was created through the mtDNA quantification of logarithmic concentrations of bovine somatic cells using the qPCR reagents and program as described in protocol step 6.3. <a href="https://www.jove.com/files/ftp_upload/64060/64060fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

<ol>
	<li>Loi, P., Modlinski, J. A., Ptak, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecies+somatic+cell+nuclear+transfer:+A+salvage+tool+seeking+first+aid.">Interspecies somatic cell nuclear transfer: A salvage tool seeking first aid.</a> Theriogenology. 76 (2), 217-228 (2011).</li><li>Wani, N. A., Vettical, B. S., Hong, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+cloned+Bactrian+camel+(camelus+bactrianus)+calf+produced+by+interspecies+somatic+cell+nuclear+transfer:+A+step+towards+preserving+the+critically+endangered+wild+Bactrian+camels.">First cloned Bactrian camel (camelus bactrianus) calf produced by interspecies somatic cell nuclear transfer: A step towards preserving the critically endangered wild Bactrian camels.</a> PLOS ONE. 12 (5), 0177800 (2017).</li><li>Oh, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+endangered+gray+wolves+(canis+lupus)+from+somatic+cells+collected+postmortem.">Cloning endangered gray wolves (canis lupus) from somatic cells collected postmortem.</a> Theriogenology. 70 (4), 638-647 (2008).</li><li>Srirattana, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-term+development+of+gaur-bovine+interspecies+somatic+cell+nuclear+transfer+embryos:+Effect+of+trichostatin+a+treatment.">Full-term development of gaur-bovine interspecies somatic cell nuclear transfer embryos: Effect of trichostatin a treatment.</a> Cellular Reprogramming. 14 (3), 248-257 (2012).</li><li>Kwon, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blastocysts+derived+from+adult+fibroblasts+of+a+rhesus+monkey+(macaca+mulatta)+using+interspecies+somatic+cell+nuclear+transfer.">Blastocysts derived from adult fibroblasts of a rhesus monkey (macaca mulatta) using interspecies somatic cell nuclear transfer.</a> Zygote. 19 (3), 199-204 (2011).</li><li>Lee, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+cloned+sei+whale+(Balaenoptera+borealis)+embryos+by+interspecies+somatic+cell+nuclear+transfer+using+enucleated+pig+oocytes.">Production of cloned sei whale (Balaenoptera borealis) embryos by interspecies somatic cell nuclear transfer using enucleated pig oocytes.</a> Journal of Veterinary Science. 10 (4), 285 (2009).</li><li>Lorthongpanich, C., Laowtammathron, C., Chan, A. W., Kedutat-Cairns, M., Parnpai, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+interspecies+cloned+monkey+embryos+reconstructed+with+bovine+enucleated+oocytes.">Development of interspecies cloned monkey embryos reconstructed with bovine enucleated oocytes.</a> Journal of Reproduction and Development. 54 (5), 306-313 (2008).</li><li>Hong, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+transgenic+canine+embryos+using+interspecies+somatic+cell+nuclear+transfer.">Production of transgenic canine embryos using interspecies somatic cell nuclear transfer.</a> Zygote. 20 (1), 67-72 (2011).</li><li>Stewart, J. B., Chinnery, P. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dynamics+of+mitochondrial+DNA+heteroplasmy:+Implications+for+human+health+and+disease.">The dynamics of mitochondrial DNA heteroplasmy: Implications for human health and disease.</a> Nature Reviews Genetics. 16 (9), 530-542 (2015).</li><li>Takeda, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+transmission+and+confounding+mitochondrial+influences+in+cloned+cattle+and+pigs.">Mitochondrial DNA transmission and confounding mitochondrial influences in cloned cattle and pigs.</a> Reproductive Medicine and Biology. 12 (2), 47-55 (2013).</li><li>Lanza, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+of+an+endangered+species+(Bos+Gaurus)+using+interspecies+nuclear+transfer.">Cloning of an endangered species (Bos Gaurus) using interspecies nuclear transfer.</a> Cloning. 2 (2), 79-90 (2000).</li><li>Evans, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+genotypes+in+nuclear+transfer-derived+cloned+sheep.">Mitochondrial DNA genotypes in nuclear transfer-derived cloned sheep.</a> Nature Genetics. 23 (1), 90-93 (1999).</li><li>Meirelles, F. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+replacement+of+the+mitochondrial+genotype+in+a+Bos+indicus+calf+reconstructed+by+nuclear+transfer+to+a+Bos+taurus+oocyte.">Complete replacement of the mitochondrial genotype in a Bos indicus calf reconstructed by nuclear transfer to a Bos taurus oocyte.</a> Genetics. 158 (1), 351-356 (2001).</li><li>Beyhan, Z., Iager, A. E., Cibelli, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecies+nuclear+transfer:+Implications+for+embryonic+stem+cell+biology.">Interspecies nuclear transfer: Implications for embryonic stem cell biology.</a> Cell Stem Cell. 1 (5), 502-512 (2007).</li><li>Lagutina, I., Fulka, H., Lazzari, G., Galli, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecies+somatic+cell+nuclear+transfer:+advancements+and+problems.">Interspecies somatic cell nuclear transfer: advancements and problems.</a> Cellular Reprogramming. 15 (5), 374-384 (2013).</li><li>Jiang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecies+somatic+cell+nuclear+transfer+is+dependent+on+compatible+mitochondrial+DNA+and+reprogramming+factors.">Interspecies somatic cell nuclear transfer is dependent on compatible mitochondrial DNA and reprogramming factors.</a> PLoS ONE. 6 (4), 14805 (2011).</li><li>Chiaratti, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryo+mitochondrial+DNA+depletion+is+reversed+during+early+embryogenesis+in+cattle.">Embryo mitochondrial DNA depletion is reversed during early embryogenesis in cattle.</a> Biology of Reproduction. 82 (1), 76-85 (2010).</li><li>Spikings, E. C., Alderson, J., John, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+mitochondrial+DNA+replication+during+oocyte+maturation+is+essential+for+successful+porcine+embryonic+development.">Regulated mitochondrial DNA replication during oocyte maturation is essential for successful porcine embryonic development.</a> Biology of Reproduction. 76 (2), 327-335 (2007).</li><li>Cagnone, G. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoration+of+normal+embryogenesis+by+mitochondrial+supplementation+in+pig+oocytes+exhibiting+mitochondrial+DNA+deficiency.">Restoration of normal embryogenesis by mitochondrial supplementation in pig oocytes exhibiting mitochondrial DNA deficiency.</a> Scientific Reports. 6 (1), 1-15 (2016).</li><li>Spikings, E. C., Alderson, J., John, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+mitochondrial+DNA+replication+during+oocyte+maturation+is+essential+for+successful+porcine+embryonic+development.">Regulated mitochondrial DNA replication during oocyte maturation is essential for successful porcine embryonic development.</a> Biology of Reproduction. 76 (2), 327-335 (2007).</li><li>Ferreira, A. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Does+supplementation+with+mitochondria+improve+oocyte+competence?+A+systematic+review.">Does supplementation with mitochondria improve oocyte competence? A systematic review.</a> Reproduction. 161 (3), 269-287 (2021).</li><li>Bhat, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+birth+of+a+pashmina+goat+kid+after+transfer+of+handmade+cloned+embryos.">Live birth of a pashmina goat kid after transfer of handmade cloned embryos.</a> Journal of Reproduction and Development. , (2019).</li><li>Tecirlioglu, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Birth+of+a+cloned+calf+derived+from+a+vitrified+hand-made+cloned+embryo.">Birth of a cloned calf derived from a vitrified hand-made cloned embryo.</a> Reproduction, Fertility and Development. 15 (7), 361 (2003).</li><li>Zhang, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Handmade+cloned+transgenic+piglets+expressing+the+nematode+fat-1+gene.">Handmade cloned transgenic piglets expressing the nematode fat-1 gene.</a> Cellular Reprogramming. 14 (3), 258-266 (2012).</li><li>Zhang, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Handmade+cloned+transgenic+sheep+rich+in+omega-3+fatty+acids.">Handmade cloned transgenic sheep rich in omega-3 fatty acids.</a> PLOS ONE. 8 (2), 55941 (2013).</li><li>Lagutina, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+cell+nuclear+transfer+in+horses:+Effect+of+oocyte+morphology,+embryo+reconstruction+method+and+donor+cell+type.">Somatic cell nuclear transfer in horses: Effect of oocyte morphology, embryo reconstruction method and donor cell type.</a> Reproduction. 130 (4), 559-567 (2005).</li><li>Chiaratti, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryo+mitochondrial+DNA+depletion+is+reversed+during+early+embryogenesis+in+cattle.">Embryo mitochondrial DNA depletion is reversed during early embryogenesis in cattle.</a> Biology of Reproduction. 82 (1), 76-85 (2010).</li><li>Hosseini, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+efficient+method+of+manual+oocyte+enucleation+using+a+pulled+pasteur+pipette.">and efficient method of manual oocyte enucleation using a pulled pasteur pipette.</a> In Vitro Cellular and Developmental Biology - Animal. 49 (8), 569-575 (2013).</li><li>Zampolla, T., Spikings, E., Rawson, D., Zhang, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoskeleton+proteins+F-actin+and+tubulin+distribution+and+interaction+with+mitochondria+in+the+granulosa+cells+surrounding+stage+III+zebrafish+(danio+rerio)+oocytes.">Cytoskeleton proteins F-actin and tubulin distribution and interaction with mitochondria in the granulosa cells surrounding stage III zebrafish (danio rerio) oocytes.</a> Theriogenology. 76 (6), 1110-1119 (2011).</li><li>International Union for Conservation of Nature. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+IUCN+Red+List+of+Threatened+Species.">The IUCN Red List of Threatened Species.</a> International Union for Conservation of Nature. , (2021).</li><li>Berg, D. K., Li, C., Asher, G., Wells, D. N., Oback, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Red+deer+cloned+from+antler+stem+cells+and+their+differentiated+progeny.">Red deer cloned from antler stem cells and their differentiated progeny.</a> Biology of Reproduction. 77 (3), 384-394 (2007).</li><li>G&#243;mez, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Birth+of+African+wildcat+cloned+kittens+born+from+domestic+cats.">Birth of African wildcat cloned kittens born from domestic cats.</a> Cloning and Stem Cells. 6 (3), 247-258 (2004).</li><li>Lanza, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+of+an+endangered+species+(Bos+gaurus)+using+interspecies+nuclear+transfer.">Cloning of an endangered species (Bos gaurus) using interspecies nuclear transfer.</a> Cloning. 2 (2), 79-90 (2000).</li></ol>

The authors have nothing to disclose.

Methods previously used to decrease mtDNA copy numbers in oocytes have their respective disadvantages. Micromanipulation-based removal of mitochondria from oocytes decrease mtDNA copy numbers by an average of 64%27. A unique method, previously used for enucleation, involves the use of small diameter Pasteur pipettes and the splitting of a zona pellucida-free oocyte at the border between a microdrop of media and the surrounding mineral oil. Along with the utilization of oocyte centrifugation, this ...

Somatic cell nuclear transfer (SCNT) includes the fusion of an enucleated oocyte from one animal and a somatic cell from an animal of the same species. In most cases, the oocyte and somatic cell originate from the same species, and live birth rates are below 6%1. Some research involves the use of interspecies SCNT (iSCNT), which includes the fusion of a somatic cell and oocyte that originate from two different species. In these studies, live birth rates are even lower than in SCNT-typically less than 1%1. However, iSCNT has the capacity to be used as a method of rescuing endangered species, since somatic cells from these animals are more accessible than their germ cells1. Recipient oocytes used in iSCNT are often domestic or common laboratory species, such as cows, pigs, and mice. Some attempts made thus far have successfully produced live young, though the offspring produced have been intrageneric animals (the recipient oocyte species and donor cell species were members of the same genus)2,3,4. Intergeneric models (which utilize an oocyte and somatic cell from animals in different genera) have not yet produced live animals, and the majority of reconstructed embryos arrest at the 8-16 cell stage of in vitro development5,6,7,8. One possible explanation of this embryonic developmental arrest is the occurrence of mitochondrial heteroplasmy in the embryos-the presence of more than one mitochondria DNA (mtDNA) type in a single cell. Heteroplasmy can lead to issues such as developmental inefficiency or failure in the embryo or in the live animal1. Pathogenesis can also occur later in the animal&#39;s lifetime9. Though this issue is also present in SCNT offspring, the interspecific component within iSCNT embryos exacerbates the issue.
When the embryonic mtDNA comes from two different species, the recipient oocyte mitochondria, which represent the majority, do not work efficiently or effectively with the donor cell&#39;s nucleus1,10. Larger taxonomic gaps between the two species used in iSCNT likely intensifies this problem; intrageneric live offspring produced (Bos gaurus and Bos indicus offspring using Bos taurus oocytes), as well as offspring produced via traditional SCNT (e.g. Ovis aries offspring using Ovis aries oocytes) were shown to be chimeras (mtDNA from two individuals was present in these animals11,12,13). Yet, they developed much further than the intergeneric SCNT embryos14,15. The exchange of information between the oocyte mitochondria and the donor cell&#39;s nucleus could be more successful in the intrageneric embryo than in the intergeneric embryo16.
The amount of mtDNA in a mature bovine oocyte is approximately 100 times greater than the amount found in one somatic cell12. Reducing this ratio could encourage the somatic cell mitochondria to proliferate within the reconstructed embryo, allowing for a greater population of productive mitochondria to be present16. This could in turn provide more energy to meet the requirements of the developing embryo15. Previous attempts made to reduce the mtDNA copy number of the oocyte or embryo include chemical application, micromanipulation, and supplementing the oocyte or embryo with additional mitochondria from the donor cell species16,17,18,19,20. However, chemical application (such as 2&#39;,3&#39;-dideoxycytidine) is not ideal for embryonic development, and has reduced oocyte mtDNA copy numbers by approximately half18. Prior oocyte mtDNA reduction by micromanipulation have only removed an average of 64% of the oocyte&#39;s mtDNA17. Though the supplementation of donor cell mitochondria could be a viable option, its use has not yet produced a live intergeneric animal within iSCNT studies21.
The use of bisection to reduce oocyte mtDNA copy number has not yet been used in published studies. Bisecting oocytes with the intention of fusing the ooplasts with a somatic cell is the premise of handmade cloning (HMC), which typically utilizes bisection as method of removing the polar body and metaphase plate from the metaphase II (MII) oocyte. HMC has successfully produced offspring in several species, including goats, cattle, pigs, sheep, and horses22,23,24,25,26, but does not typically include a centrifugation step prior to bisection. Integrating high-speed centrifugation of the oocyte allows for the isolation of mitochondria (and therefore mtDNA) at one pole of the oocyte, which can then be bisected using a microblade to remove those mitochondria-dense fractions. Two mitochondria-depleted ooplasts can then be fused with a somatic cell, as is the case in HMC, to form a reconstructed embryo which contains considerably less mtDNA from the oocyte species.
The question we attempt to answer with this protocol is how to reduce mtDNA in the bovine oocyte in order to produce a viable reconstructed embryo that contains less heteroplasmic mtDNA. In this protocol, oocytes were centrifuged and bisected. Ooplast and intact oocyte mtDNA copy numbers were calculated to determine the effectiveness of this technique in reducing the bovine oocyte&#39;s mtDNA copy number.

<table><tbody><tr><td>1.5 mL centrifuge tubes</td><td>Fisher Scientific</td><td>5408129</td><td></td></tr><tr><td>60 mm dish</td><td>Sigma-Aldrich</td><td>D8054</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5424</td><td></td></tr><tr><td>Cytochalasin B</td><td>Sigma-Aldrich</td><td>C6762</td><td></td></tr><tr><td>Fetal Bovine Serum</td><td>Sigma-Aldrich</td><td>F2442</td><td></td></tr><tr><td>M199 Media</td><td>Sigma-Aldrich</td><td>M4530</td><td></td></tr><tr><td>Mineral Oil</td><td>Sigma-Aldrich</td><td>M8410</td><td></td></tr><tr><td>Mini Centrifuge</td><td>SCILOGEX</td><td>D1008</td><td></td></tr><tr><td>mtDNA Primer: Forward (12S)</td><td></td><td></td><td>GGGCTACATTCTCTACACCAAG</td></tr><tr><td>mtDNA Primer: Reverse (12S)</td><td></td><td></td><td>GTGCTTCATGGCCTAATTCAAC</td></tr><tr><td>NanoDrop Spectrophotometer</td><td>Thermo Scientific</td><td>ND2000</td><td></td></tr><tr><td>Opthalmic Scalpel with Aluminum Handle</td><td>PFM Medical</td><td>207300633</td><td>Microblade for bisection</td></tr><tr><td>Protease/pronase</td><td>Sigma-Aldrich</td><td>P5147</td><td></td></tr><tr><td>QIAamp DNA Micro Kit</td><td>Qiagen</td><td>56304</td><td></td></tr><tr><td>QuantStudio&amp;trade; 3 - 96-Well 0.2-mL</td><td>ThermoFisher</td><td>A28567</td><td></td></tr><tr><td>Search plate</td><td>Fisher Scientific</td><td>FB0875711A</td><td></td></tr><tr><td>SYBR Green qPCR Master Mix</td><td>ThermoFisher</td><td>K0221</td><td>qPCR master mix</td></tr><tr><td>Synthetic Oviductal Fluid with HEPES (HSOF)</td><td></td><td></td><td></td></tr><tr><td>ThermoPlate</td><td>Tokai Hit</td><td>TPi-SMZSSX</td><td>Heating stage</td></tr></tbody></table>

use of bisection to reduce mitochondrial dna in the bovine oocyte

Interspecies somatic cell nuclear transfer (iSCNT) may be used to rescue endangered species, but two distinct populations of mitochondrial DNA (mtDNA) exist within the reconstructed embryo: one within the recipient ooplasm and one within the donor somatic cell. This mitochondrial heteroplasmy can lead to developmental issues in the embryo and the fetus. Handmade cloning protocols include oocyte bisection, which can be used to decrease the mtDNA copy number, reducing the degree of mitochondrial heteroplasmy in a reconstructed embryo. Centrifugation of denuded, mature bovine oocytes produced a visible mitochondria-dense fraction at one pole of the oocyte. Oocytes&#39; zonae pellucidae were removed by exposure to a pronase solution. Bisection was performed using a microblade to remove the visible mitochondria fraction. qPCR was used to quantify the mtDNA present in DNA samples extracted from whole oocytes and bisected ooplasts, providing a comparison of mtDNA copy numbers before and after bisection. Copy numbers were calculated using cycle threshold values, a standard curve&#39;s regression line formula, and a ratio that included the respective sizes of mtDNA PCR products and genomic PCR products. One bovine oocyte had an average mtDNA copy number (&#177; standard deviation) of 137,904 &#177; 94,768 (n = 38). One mitochondria-depleted ooplast had an average mtDNA copy number of 8,442 &#177; 13,806 (n = 33). Average mtDNA copies present in a mitochondria-rich ooplast were 79,390 &#177; 58,526 mtDNA copies (n = 28). The differences between these calculated averages indicate that the centrifugation and subsequent bisection can significantly decrease the mtDNA copy numbers present in the mitochondria-depleted ooplast when compared to the original oocyte (P &#60; 0.0001, determined by one-way ANOVA). The reduction in mtDNA should decrease the degree of mitochondrial heteroplasmy in a reconstructed embryo, possibly fostering standard embryonic and fetal development. Supplementation with mitochondrial extract from the somatic donor cell may also be essential to achieve successful embryonic development.

Quantitative PCR (qPCR) results are used to determine the relative quantities of mtDNA present in each ooplast. The described reaction is designed to amplify the 12S region of bovine mtDNA.
If the bisection was successful, the samples from whole oocytes and mitochondria-dense ooplasts will have similar Ct values. The samples from mitochondria-reduced ooplasts will have higher Ct values when compared to the samples from the other two groups. A Ct graph showing s...

Watch this Scientific Journal Video about Use of Bisection to Reduce Mitochondrial DNA in the Bovine Oocyte at JoVE.com

Use of Bisection to Reduce Mitochondrial DNA in the Bovine Oocyte

Here, we present a protocol to significantly reduce the mitochondrial DNA copy numbers in a bovine oocyte (P &lt; 0.0001). This method utilizes centrifugation and bisection to substantially reduce oocyte mitochondria and may allow for an increased chance of development in the reconstructed interspecies somatic cell nuclear transfer embryos.

Interspecies somatic cell nuclear transfer (iSCNT) may be used to rescue endangered species, but two distinct populations of mitochondrial DNA (mtDNA) ...

use-of-bisection-to-reduce-mitochondrial-dna-in-the-bovine-oocyte

Research

JoVE Journal

Developmental Biology

2.0K Views. Utah State University. Here, we present a protocol to significantly reduce the mitochondrial DNA copy numbers in a bovine oocyte (P < 0.0001). This method utilizes centrifugation and bisection to substantially reduce oocyte mitochondria and may allow for an increased chance of development in the reconstructed interspecies somatic cell nuclear transfer embryos.

Video: Use of Bisection to Reduce Mitochondrial DNA in the Bovine Oocyte

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

Amphibian eggs have been widely used to study embryonic development. Early embryonic development is driven by maternally stored factors accumulated during oogenesis. In order to study roles of such maternal factors in early embryonic development, it is desirable to manipulate their functions from the very beginning of embryonic development. Conventional ways of gene interference are achieved by injection of antisense oligonucleotides (oligos) or mRNA into fertilized eggs, enabling under- or over-expression of specific proteins, respectively. However, these methods normally require more than several hours until protein expression is affected, and, hence, the interference of gene functions is not effective during early embryonic stages. Here, we introduce an experimental system in which expression levels of maternal proteins can be altered before fertilization. Xenopus laevis oocytes obtained from ovaries are defolliculated by incubating with enzymes. Antisense oligos or mRNAs are injected into defolliculated oocytes at the germinal vesicle (GV) stage. These oocytes are in vitro matured to eggs at the metaphase II (MII) stage, followed by intracytoplasmic sperm injection (ICSI). By this way, up to 10% of ICSI embryos can reach the swimming tadpole stage, thus allowing functional tests of specific gene knockdown or overexpression. This approach can be a useful way to study roles of maternally stored factors in early embryonic development.

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

We describe methods of manipulating Xenopus laevis immature oocytes, in vitro maturation of oocytes to eggs, and intracytoplasmic sperm injection. This protocol allows degradation of some maternal proteins and overexpression of genes of interest at fertilization, and hence is valuable to study roles of specific factors in early embryonic development.

Amphibian eggs have been widely used to study embryonic development. Early embryonic development is driven by maternally stored factors accumulated during ...

Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes

The field of assisted reproduction has been developed to treat infertility in women, companion animals, and endangered species. In the horse, assisted reproduction also allows for the production of embryos from high performers without interrupting their sports career and contributes to an increase in the number of foals from mares of high genetic value. The present manuscript describes the procedures used for collecting immature and mature oocytes from horse ovaries using ovum pick-up (OPU). These oocytes were then used to investigate the incidence of aneuploidy by adapting a protocol previously developed in mice. Specifically, the chromosomes and the centromeres of metaphase II (MII) oocytes were fluorescently labeled and counted on sequential focal plans after confocal laser microscope scanning. This analysis revealed a higher incidence in the aneuploidy rate when immature oocytes were collected from the follicles and matured in vitro compared to in vivo. Immunostaining for tubulin and the acetylated form of histone four at specific lysine residues also revealed differences in the morphology of the meiotic spindle and in the global pattern of histone acetylation. Finally, the expression of mRNAs coding for histone deacetylases (HDACs) and acetyl-transferases (HATs) was investigated by reverse transcription and quantitative-PCR (q-PCR). No differences in the relative expression of transcripts were observed between in vitro and in vivo matured oocytes. In agreement with a general silencing of the transcriptional activity during oocyte maturation, the analysis of the total transcript amount can only reveal mRNA stability or degradation. Therefore, these findings indicate that other translational and post-translational regulations might be affected.
Overall, the present study describes an experimental approach to morphologically and biochemically characterize the horse oocyte, a cell type that is extremely challenging to study due to low sample availability. However, it can expand our knowledge on the reproductive biology and infertility in monovulatory species.

This manuscript describes an experimental approach to morphologically and biochemically characterize horse oocytes. Specifically, the present work illustrates how to collect immature and mature horse oocytes by ultrasound-guided ovum pick-up (OPU) and how to investigate chromosome segregation, spindle morphology, global histone acetylation, and mRNA expression.

The field of assisted reproduction has been developed to treat infertility in women, companion animals, and endangered species. In the horse, assisted ...

Combinational Treatment of Trichostatin A and Vitamin C Improves the Efficiency of Cloning Mice by Somatic Cell Nuclear Transfer

Somatic cell nuclear transfer (SCNT) provides a unique opportunity to directly produce a cloned animal from a donor cell, and it requires the use of skillful techniques. Additionally, the efficiencies of cloning have remained low since the successful production of cloned animals, especially mice. There have been many attempts to improve the cloning efficiency, and trichostatin A (TSA), a histone deacetylase inhibitor, has been widely used to enhance the efficiency of cloning. Here, we report a dramatically improved cloning method in mice. This somatic cell nuclear transfer method involves usage of Hemagglutinating virus of Japan Envelope (HVJ-E), which enables easy manipulation. Moreover, the treatment using two small molecules, TSA and vitamin C (VC), with deionized bovine serum albumin (dBSA), is highly effective for embryonic development. This approach requires neither additional injection nor genetic manipulation, and thus presents a simple, suitable method for practical use. This method could become a technically feasible approach for researchers to produce genetically modified animals from cultured cells. Furthermore, it might be a useful way for the rescue of endangered animals via cloning.

We describe a dramatically improved method for mouse cloning using trichostatin A, vitamin C, and deionized bovine serum albumin. We show a simplified, reproducible protocol that supports efficient development of cloned embryos. Hence, this method could become a standardized procedure for mouse cloning.

Somatic cell nuclear transfer (SCNT) provides a unique opportunity to directly produce a cloned animal from a donor cell, and it requires the use of ...

Microdissection and Dissociation of the Murine Oviduct: Individual Segment Identification and Single Cell Isolation

Mouse model systems are unmatched for the analysis of disease processes because of their genetic manipulability and the low cost of experimental treatments. However, because of their small body size, some structures, such as the oviduct with a diameter of 200-400 &#956;m, have proven to be relatively difficult to study except by immunohistochemistry. Recently, immunohistochemical studies have uncovered more complex differences in oviduct segments than were previously recognized; thus, the oviduct is divided into four functional segments with different ratios of seven distinct epithelial cell types. The different embryological origins and ratios of the epithelial cell types likely make the four functional regions differentially susceptible to disease. For example, precursor lesions to serous intraepithelial carcinomas arise from the infundibulum in mouse models and from the corresponding fimbrial region in the human fallopian tube. The protocol described here details a method for microdissection to subdivide the oviduct in such a way to yield a sufficient amount and purity of RNA necessary for downstream analysis such as reverse transcription-quantitative PCR (RT-qPCR) and RNA sequencing (RNAseq). Also described is a mostly non-enzymatic tissue dissociation method appropriate for flow cytometry or single cell RNAseq analysis of fully differentiated oviductal cells. The methods described will facilitate further research utilizing the murine oviduct in the field of reproduction, fertility, cancer, and immunology.

A method for microdissection of the mouse oviduct that allows collection of the individual segments while maintaining RNA integrity is presented. In addition, non-enzymatic oviductal cell dissociation procedure is described. The methods are appropriate for subsequent gene and protein analysis of the functionally different oviductal segments and dissociated oviductal cells.

Mouse model systems are unmatched for the analysis of disease processes because of their genetic manipulability and the low cost of experimental ...

Isolation of Mitochondrial Contact Sites

An Improved Method to Isolate Mitochondrial Contact Sites

Mitochondria are present in virtually all eukaryotic cells and perform essential functions that go far beyond energy production, for instance, the synthesis of iron-sulfur clusters, lipids, or proteins, Ca2+ buffering, and the induction of apoptosis. Likewise, mitochondrial dysfunction results in severe human diseases such as cancer, diabetes, and neurodegeneration. In order to perform these functions, mitochondria have to communicate with the rest of the cell across their envelope, which consists of two membranes. Therefore, these two membranes have to interact constantly. Proteinaceous contact sites between the mitochondrial inner and outer membranes are essential in this respect. So far, several contact sites have been identified. In the method described here, Saccharomyces cerevisiae mitochondria are used to isolate contact sites and, thus, identify candidates that qualify for contact site proteins. We used this method to identify the mitochondrial contact site and cristae organizing system (MICOS) complex, one of the major contact site-forming complexes in the mitochondrial inner membrane, which is conserved from yeast to humans. Recently, we further improved this method to identify a novel contact site consisting of Cqd1 and the Por1-Om14 complex.

Author Spotlight: Unveiling Mitochondrial Contact Sites and Architectural Insights 

Mitochondrial contact sites are protein complexes that interact with mitochondrial inner and outer membrane proteins. These sites are essential for the communication between the mitochondrial membranes and, thus, between the cytosol and the mitochondrial matrix. Here, we describe a method to identify candidates qualifying for this specific class of proteins.

Mitochondria are present in virtually all eukaryotic cells and perform essential functions that go far beyond energy production, for instance, the ...

Biochemistry

Multi-Photon Laser Ablation of Cytoplasmic Microtubule Organizing Centers in Mouse Oocytes

The fidelity of oocyte meiosis is critical for generating developmentally competent euploid eggs. In mammals, the oocyte undergoes a lengthy arrest at prophase I of the first meiotic division. After puberty and upon meiotic resumption, the nuclear membrane disassembles (nuclear envelope breakdown), and the spindle is assembled mainly at the oocyte center. Initial central spindle positioning is essential to protect against abnormal kinetochore-microtubule (MT) attachments and aneuploidy. The centrally positioned spindle migrates in a time-sensitive manner toward the cortex, and this is a necessary process to extrude a tiny polar body. In mitotic cells, spindle positioning relies on the interaction between centrosome-mediated astral MTs and the cell cortex. On the contrary, mouse oocytes lack classic centrosomes and, instead, contain numerous acentriolar MT organizing centers (MTOCs). At the metaphase I stage, mouse oocytes have two different sets of MTOCs: (1) MTOCs that are clustered and sorted to assemble spindle poles (polar MTOCs), and (2) metaphase cytoplasmic MTOCs (mcMTOCs) that remain in the cytoplasm and do not contribute directly to spindle formation but play a crucial role in regulating spindle positioning and timely spindle migration. Here, a multi-photon laser ablation method is described to selectively deplete endogenously labeled mcMTOCs in oocytes collected from Cep192-eGfp reporter mice. This method contributes to the understanding of the molecular mechanisms underlying spindle positioning and migration in mammalian oocytes.

An optimized protocol is presented that enables the depletion of cytoplasmic microtubule organizing centers in mouse oocytes during metaphase I using a near-infrared femtosecond laser.

The fidelity of oocyte meiosis is critical for generating developmentally competent euploid eggs. In mammals, the oocyte undergoes a lengthy arrest at ...

Mitochondrial Transfer from Mouse Adipose-Derived Mesenchymal Stem Cells into Aged Mouse Oocytes

Due to the decline in the quantity and quality of oocytes related to age, the fertility of women over 35 years of age has declined sharply. The molecular mechanisms that maintain oocyte quality remain unclear, thus it is difficult to increase the birth rate of women over 35 years old at present. Oocytes contain more mitochondria than any type of cell in the body, and any mitochondrial dysfunction can lead to reduced oocyte quality. In the 1990s, oocyte cytoplasmic transfer resulted in great success in human reproduction but was accompanied by ethical controversies. Autologous mitochondrial transplantation is expected to be a useful technique to increase the quality of oocytes that have decreased due to age. In the present study, we used adipose-derived stem cells from aged mice as a mitochondria donor to increase the quality of oocytes of aged mice. Further development of autologous mitochondrial transfer technology will provide a new and effective treatment for infertility in aged women.

Here, we describe the isolation of mitochondria from mouse adipose-derived mesenchymal stem cells, and then transfer the mitochondria into aged mouse oocytes to improve the quality of the oocytes.

Due to the decline in the quantity and quality of oocytes related to age, the fertility of women over 35 years of age has declined sharply. The molecular ...

Identifying DNA Damage in Prophase-Arrested Oocytes of Mice

Detection of DNA Double-Stranded Breaks in Mouse Oocytes

Oocytes are amongst the biggest and most long-lived cells in the female body. They are formed in the ovaries during embryonic development and remain arrested at the prophase of meiosis I. The quiescent state may last for years until the oocytes receive a stimulus to grow and obtain the competency to resume meiosis. This protracted state of arrest makes them extremely susceptible to accumulating DNA-damaging insults, which affect the genetic integrity of the female gametes and, therefore, the genetic integrity of the future embryo. 
Consequently, the development of an accurate method to detect DNA damage, which is the first step for the establishment of DNA damage response mechanisms, is of vital importance. This paper describes a common protocol to test the presence and progress of DNA damage in prophase-arrested oocytes during a period of 20 h. Specifically, we dissect mouse ovaries, retrieve the cumulus-oocyte complexes (COCs), remove the cumulus cells from the COCs, and culture the oocytes in &#924;2 medium containing 3-isobutyl-1-methylxanthine to maintain the state of arrest. Thereafter, the oocytes are treated with the cytotoxic, antineoplasmic drug, etoposide, to engender double-strand breaks (DSBs). 
By using immunofluorescence and confocal microscopy, we detect and quantify the levels of the core protein &#947;H2AX, which is the phosphorylated form of the histone H2AX. H2AX becomes phosphorylated at the sites of DSBs after DNA damage. The inability to restore DNA integrity following DNA damage in oocytes can lead to infertility, birth defects, and increased rates of spontaneous abortions. Therefore, the understanding of DNA damage response mechanisms and, at the same time, the establishment of an intact method for studying these mechanisms are essential for reproductive biology research.

Author Spotlight: Understanding DNA Damage Response in Mammalian Oocytes and Preimplantation Embryos 

Maintaining oocyte genome integrity is necessary to ensure the genetic fidelity in the resulting embryo. Here, we present an accurate protocol for detecting DNA double-strand breaks in mammalian female germ cells.

Oocytes are amongst the biggest and most long-lived cells in the female body. They are formed in the ovaries during embryonic development and remain ...

Single Oocyte Bisulfite Mutagenesis

Epigenetics encompasses all heritable and reversible modifications to chromatin that alter gene accessibility, and thus are the primary mechanisms for regulating gene transcription1. DNA methylation is an epigenetic modification that acts predominantly as a repressive mark. Through the covalent addition of a methyl group onto cytosines in CpG dinucleotides, it can recruit additional repressive proteins and histone modifications to initiate processes involved in condensing chromatin and silencing genes2. DNA methylation is essential for normal development as it plays a critical role in developmental programming, cell differentiation, repression of retroviral elements, X-chromosome inactivation and genomic imprinting.
One of the most powerful methods for DNA methylation analysis is bisulfite mutagenesis. Sodium bisulfite is a DNA mutagen that deaminates cytosines into uracils. Following PCR amplification and sequencing, these conversion events are detected as thymines. Methylated cytosines are protected from deamination and thus remain as cytosines, enabling identification of DNA methylation at the individual nucleotide level3. Development of the bisulfite mutagenesis assay has advanced from those originally reported4-6 towards ones that are more sensitive and reproducible7. One key advancement was embedding smaller amounts of DNA in an agarose bead, thereby protecting DNA from the harsh bisulfite treatment8. This enabled methylation analysis to be performed on pools of oocytes and blastocyst-stage embryos9. The most sophisticated bisulfite mutagenesis protocol to date is for individual blastocyst-stage embryos10. However, since blastocysts have on average 64 cells (containing 120-720 pg of genomic DNA), this method is not efficacious for methylation studies on individual oocytes or cleavage-stage embryos.
Taking clues from agarose embedding of minute DNA amounts including oocytes11, here we present a method whereby oocytes are directly embedded in an agarose and lysis solution bead immediately following retrieval and removal of the zona pellucida from the oocyte. This enables us to bypass the two main challenges of single oocyte bisulfite mutagenesis: protecting a minute amount of DNA from degradation, and subsequent loss during the numerous protocol steps. Importantly, as data are obtained from single oocytes, the issue of PCR bias within pools is eliminated. Furthermore, inadvertent cumulus cell contamination is detectable by this method since any sample with more than one methylation pattern may be excluded from analysis12. This protocol provides an improved method for successful and reproducible analyses of DNA methylation at the single-cell level and is ideally suited for individual oocytes as well as cleavage-stage embryos.

Bisulfite mutagenesis is the gold standard for analyzing DNA methylation. Our modified protocol allows for DNA methylation analysis at the single-cell level and was specifically designed for individual oocytes. It can also be used for cleavage-stage embryos.

Epigenetics encompasses all heritable and reversible modifications to chromatin that alter gene accessibility, and thus are the primary mechanisms for ...

Biology

Isolation of Small Preantral Follicles from the Bovine Ovary Using a Combination of Fragmentation, Homogenization, and Serial Filtration

Understanding the full process of mammalian folliculogenesis is crucial for improving assisted reproductive technologies in livestock, humans, and endangered species. Research has been mostly limited to antral and large preantral follicles due to difficulty in the isolation of smaller preantral follicles, especially in large mammals such as bovine species. This work presents an efficient approach to retrieve large numbers of small preantral follicles from a single bovine ovary. The cortex of individual bovine ovaries was sliced into 500 &#181;m cubes using a tissue chopper and homogenized for 6 min at 9,000-11,000 rpm using a 10 mm probe. Large debris was separated from the homogenate using a cheese cloth, followed by serial filtration through 300 &#181;m and 40 &#181;m cell strainers. The contents retained in the 40 &#181;m strainer were rinsed into a search dish, where follicles were identified and collected into a drop of medium. The viability of the collected follicles was tested via trypan blue staining. This method enables the isolation of a large number of viable small preantral follicles from a single bovine ovary in approximately 90 min. Importantly, this method is entirely mechanical and avoids the use of enzymes to dissociate the tissue, which may damage the follicles. The follicles obtained using this protocol can be used for downstream applications such as isolation of RNA for RT-qPCR, immunolocalization of specific proteins, and in vitro culture.

Advancing the study of preantral folliculogenesis requires efficient methods of follicle isolation from single ovaries. Presented here is a streamlined, mechanical protocol for follicle isolation from bovine ovaries using a tissue chopper and homogenizer. This method allows collection of a large number of viable preantral follicles from a single ovary.

Use of Bisection to Reduce Mitochondrial DNA in the Bovine Oocyte

Summary

Explore More Videos

Chapters in this video

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes

Combinational Treatment of Trichostatin A and Vitamin C Improves the Efficiency of Cloning Mice by Somatic Cell Nuclear Transfer

Microdissection and Dissociation of the Murine Oviduct: Individual Segment Identification and Single Cell Isolation

An Improved Method to Isolate Mitochondrial Contact Sites

Multi-Photon Laser Ablation of Cytoplasmic Microtubule Organizing Centers in Mouse Oocytes

Mitochondrial Transfer from Mouse Adipose-Derived Mesenchymal Stem Cells into Aged Mouse Oocytes

Detection of DNA Double-Stranded Breaks in Mouse Oocytes

Single Oocyte Bisulfite Mutagenesis

Isolation of Small Preantral Follicles from the Bovine Ovary Using a Combination of Fragmentation, Homogenization, and Serial Filtration