Diese Arbeit wurde durch Stipendien des National Institute of Mental Health (R00MH103531 und R01MH116901 to J.A.), ein Predoctoral Training Grant vom National Institute of General Medicine (T32GM007635 to S.R.) und ein Lyda Hill Gilliam Fellowship for Advanced Study (GT11021 to S.R.) unterstützt. Wir danken Dr. Kevin Woolfrey für die Hilfe beim Mikroskop, Dr. K. Ulrich Bayer für den Einsatz seines Epifluoreszenzmikroskops und Thomas Südhof (Stanford University) für das LRRTM2-Plasmid.

1. Zellkultur und Transfektion
<ol><li>Herstellung von HEK-Zellmedien mit DMEM, 1x (Dulbecco es Modification of Eagle es Medium) ergänzt mit 4,5 g/L Glukose, L-Glutamin & Natriumpyruvat und 10% FBS. Steriler Filter.</li>
	<li>Präbestimmen Sie geeignete Liganden und Rezeptoren für den Aggregationstest. HINWEIS: In dieser Studie wurden Neurexin3-SS4+/- und einer seiner bekannten Liganden, LRRTM2, verwendet. Liganden und Rezeptoren von Interesse wurden aus cDNAs in pcDNA3.1 ausgedrückt. Eine Gibson-Baugruppe wurde verwendet, um Neurexin3" in pcDNA3.112einzufügen. Neurexin3- F/R: TTTAAACTTAAGCTTGGTGAGCTCGGATCCGCCACCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCCT GAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTCTTACACATAATACTCCTTGTCCTT.</li>
	<li>Bereiten Sie HEK293T-Zellen vor.<ol>
<li>Wachsen Sie HEK293T-Zellen, um in einem T-75-Kolben zu konfluenz.</li>
		<li>Einmal konfluent, 2 ml Trypsin verwenden und 2 min in 37 °C Inkubator geben. Fügen Sie dem Kolben 6 ml HEK-Medien hinzu, um Zellen wieder auszusetzen, und übertragen Sie alle 8 ml in ein 15 ml konisches Rohr.</li>
		<li>Pellet bei 500 x g für 5 min und resuspendieren in HEK-Zellmedien für insgesamt 8 ml.</li>
		<li>Zählen Sie Zellen und fügen Sie 735.000 Zellen in jeden Brunnen einer 6-Well-Platte hinzu. Passen Sie die Endlautstärke mit HEK-Zellmedien auf 2 ml für jeden Brunnen an.</li>
		<li>In 37 °C-Inkubator geben und Zellen über Nacht oder bis zu 50-60% Konfluenz wachsen lassen.</li>
	</ol></li>
	<li>Transfekte HEK293T-Zellen mit der Calciumphosphatmethode13.<ol>
<li>Transfekte gut-1 mit 3 g des von Interesse und Co-Transfekte mit 1 g fluoreszierendem Protein (3 g pcDNA3.1-Neurexin3-WT SS4- und 1 g mCherry).</li>
		<li>Transfekte gut-2 wie in Schritt 1.4.1. aber mit dem mutierten Protein von Interesse (pcDNA3.1-Neurexin3-A687T SS4-).</li>
		<li>Transfekte gut-3 mit 3 g des Liganden von Interesse und ko-transfekect mit 1 g eines anderen fluoreszierenden Proteins (3 g pcDNA3.1 LRRTM2 und 1 g GFP).</li>
		<li>Transfezieren Sie gut-4 und well-5 als Negativkontrollen: gut-4 mit 1 g GFP und gut-5 mit 1 g mCherry.</li>
		<li>Bereiten Sie eine weitere Platte (wie in Schritt 1.4.1-1.4.4) vor, wenn zusätzliche Bedingungen oder Kontrollen erforderlich sind (Neurexin3-WT/A687T SS4+). HINWEIS: Die Transfektionseffizienz wird 24 h nach der Transfektion unter einem Epifluoreszenzmikroskop analysiert und als Anzahl der Zellen quantifiziert, die das fluoreszierende Protein exzieren, mit dem sie transfiziert wurden. Ein schlankerer Ansatz würde die Transfektion von HEK-Zellen mit einem bikannronischen Vektor, der für ein fluoreszierendes Protein kodiert, und den Liganden von Interesse umfassen und wird oberhalb der Kotransfektion dringend empfohlen. Im Falle dieser Studie sind Alpha-Neurexine 4,3 kb und eine niedrige Fluoreszenzintensität wurde mit einem bicistronischen System beobachtet, das eine Kotransfektion erforderlich macht.</li>
	</ol></li>
	<li>48 Stunden nach der Transfektion Ernten Sie Zellen zur Aggregation.<ol>
<li>Waschen Sie jeden Brunnen zweimal mit PBS.</li>
		<li>Fügen Sie 1 ml 10 mM EDTA in PBS in jeden Brunnen ein, um Zell-zu-Zell-Wechselwirkungen sanft zu dissoziieren und die Platte bei 37 °C für 5 min zu inkubieren. HINWEIS: Trypsin wird für Schritt 1.5.2 aufgrund einer möglichen proteolytischen Spaltung von Adhäsionsmolekülen in der Studie nicht empfohlen. Darüber hinaus kann das Protokoll nach der EDTA-Zugabe möglicherweise erst nach Abschluss angehalten werden, da Zellen nun Umgebungsbedingungen ausgesetzt sind.</li>
		<li>Tippen Sie vorsichtig auf die Platte, um die Zellen zu lösen, und ernten Sie jede gut in separaten 15 ml konischen Rohren.</li>
		<li>Zentrifugenkonrohre bei 500 x g und Raumtemperatur für 5 min.</li>
	</ol></li>
	<li>Während zellenpelletieren, bereiten Sie 6 Inkubationsröhrchen vor, indem Sie die Oberseite jedes Mikrozentrifugenrohres mit jeder Bedingung beschriften. HINWEIS: Jede Permutation der GFP- und mCherry-Bedingungen sollte verwendet werden, um alle experimentellen Bedingungen und ordnungsgemäßen Kontrollen zu umfassen. Zum Beispiel: 1. GFP/mCherry, 2. mCherry/LRRTM2-GFP 3. GFP/Neurexin3-WT SS4-—mCherry, 4. GFP/Neurexin3-A687T SS4- –mCherry, 5. Neurexin3"WT SS4-—mCherry/LRRTM2—GFP, 6. Neurexin3-A687T SS4- –mCherry/LRRTM2—GFP. Stellen Sie zusätzliche Rohre vor, um weitere Bedingungen und Kontrollen zu erfüllen.</li>
	<li>Entfernen Sie den Überstand und setzen Sie die Zellen in 500 l HEK-Medien mit 10 mM CaCl2 und 10 mM MgCl2 auf 37 °C erwärmt. HINWEIS: Die Zugabe von CaCl2 und MgCl2 ermöglicht die Wiederherstellung der Bindung von Haftmolekülen und ist nur erforderlich, wenn die betreffenden transzellulären Interaktionspartner divalente Kationen zur Adhäsion benötigen.</li>
	<li>Zählen Sie die Zellen in jedem 15 ml konischen Rohr mit einem Hämozytometer und aliquot 200.000 Zellen jeder Bedingung in ein geeignetes Rohr von Schritt 1.6.1 für eine 1:1-Mischung in einem Gesamtvolumen von 500 l. HINWEIS: Es sollte nur 5 min pro Bedingung zu zählen und aliquot Beträge.</li>
	<li>Röhren bei Raumtemperatur in einem langsamen Rohrrotator inkubieren.</li>
</ol>2. Bildaufnahme
<ol><li>Optimieren Sie die Aufnahmeparameter für mikroskopische Erfassungsparameter für bestimmte Proben. In diesem Beispiel wurden Bilder auf einem Weitfeldmikroskop aufgenommen. Verwenden Sie ein 5-faches Luftobjektiv (NA: 0,15; WD: 20000 m), um ein ausreichend großes Feld für die Analyse zu erhalten.</li>
	<li>Bewerten Sie die Basisaggregation unmittelbar nach dem Mischen der beiden Bedingungen von HEK-Zellen in Schritt 1.8. Dies sind jetzt die "Time Zero"-Bilder.<ol>
<li>Pipette 40 l jedes Probengemisches auf ein geladenes Mikroskopschlitten und Bild unter Fluoreszenz in den Kanälen 488 und 561.</li>
		<li>Erwerben Sie drei verschiedene Sichtfelder auf einer Fokusebene pro Stichprobenablage.</li>
	</ol>
</li>
	<li>Erfassen Sie die endgültigen Bilder in 60 min als 'zeit 60' Bild.<ol>
<li>Um das "Zeit 60"-Bild des Gemischs nach einer 60 min Inkubation zu erhalten, nehmen Sie eine weitere 40-L-Probe jeder Bedingung aus rotierenden Rohren und Pipette jeder Probe auf einem geladenen Schlitten. Bild wie in Schritt 2.2.2. HINWEIS: Die Zellaggregation sollte alle 15 Min. überprüft werden, bis die Sättigung eintritt. Der Zeitpunkt der Aggregation hängt von den getesteten Proteinen ab.</li>
	</ol>
</li>
</ol>3. ImageJ/Fidschi-Analyse
<ol><li>Um das Ausmaß der Aggregation mit Fiji/ImageJ zu quantifizieren, speichern Sie Analysedateien.<ol>
<li>Speichern Sie die bereitgestellten ergänzungskodierungsdateien Dateien im Ordner imageJ-Makros auf dem Computer.</li>
		<li>Installieren Sie das bereitgestellte Aggregationsmakro (Plugins, Makros, Installieren und wählen Sie die Datei "AggregationAssay.txt".</li>
	</ol>
</li>
	<li>Bestimmen Sie Schwellenwerte.<ol>
<li>Laden Sie eine 'Time Zero' .tif Datei in imageJ und teilen Sie die Kanäle auf (Bild | Farbe | Split-Kanäle). HINWEIS: Das Bild "Zeit Null" wird verwendet, um die Schwellenwerte und die kleinste Punktzeichengröße für das gesamte Experiment zu bestimmen.</li>
		<li>Maskieren Sie jeden Kanal(Plugins | Makros | AggregationAssay_MakeMask). Das Fenster "Maske aus Bild erstellen" wird angezeigt. Aktivieren Sie die Kontrollkästchen neben Schwellenwert für Bild bestimmen und Clusterparams aus Histogramm bestimmen, und klicken Sie auf OK.</li>
		<li>Bestimmen Sie den Schwellenwert des Bildes mithilfe der Folienleiste, notieren Sie die Zahl rechts neben der Folienleiste, und klicken Sie auf OK.</li>
		<li>Es wird ein Histogramm der Clustergröße angezeigt. Wählen Sie eine Clustergröße aus dem Histogramm aus, das zum Experiment passt, geben Sie diese Zahl in das Feld Min ClusterGröße: ein, und klicken Sie auf OK. Cluster unterhalb dieser Größe werden nicht analysiert.</li>
	</ol>
</li>
	<li>Führen Sie die Analyse aus.<ol>
<li>Öffnen Sie das 'time 60'-Bild von Bedingung 1 in imageJ und teilen Sie die Kanäle wie in Schritt 3.2.1 auf.</li>
		<li>Maskieren Sie jeden Kanal (Plugins, Makros, AggregationAssay_MakeMask). Verwenden Sie den gleichen Schwellenwert und dieselbe Größe, die in Schritt 3.2.3 und Schritt 3.2.4 festgelegt wurden. Deaktivieren Sie die Felder neben Schwellenwert für Bild bestimmen und Clusterparams aus Histogramm bestimmen, und geben Sie die Größe und die Schwellenwerte manuell in die entsprechenden Felder ein, und klicken Sie dann auf OK.</li>
		<li>Berechnen sie denAggregationsindex (Plugins | Makros | AggregationAssay_CalculateOverlap). Wählen Sie die maskierten Kanäle aus, in die verglichen werden soll, und das Verzeichnis, in das die resultierenden Dateien gespeichert werden sollen.</li>
		<li>Wiederholen Sie die Schritte 3.3.1–3.3.3 für jedes 'time 60'-Bild in jeder Bedingung. ANMERKUNG: Der Aggregationsindex ist definiert als die Gesamteoüberlappungsfläche geteilt durch die Summe der beiden Kanalbereiche abzüglich des Überlappungsbereichs multipliziert mit 100 (Aggregationsindex = Überlappungsfläche/[Fläche von Kanal 1 + Fläche von Kanal 2 – Überlappungsfläche] x 100). Diese Normalisierung ist ein "OR"-Vorgang zwischen den beiden maskierten Kanälen, die die Gesamtpixel in beiden Masken darstellen.</li>
	</ol>
</li>
</ol>

<ol>
	<li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroligins+and+neurexins+link+synaptic+function+to+cognitive+disease.">Neuroligins and neurexins link synaptic function to cognitive disease.</a> Nature. 455 (7215), 903-911 (2008).</li><li>Lakey, J. H., Raggett, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+protein-protein+interactions.">Measuring protein-protein interactions.</a> Current Opinion in Structural Biology. 8 (1), 119-123 (1998).</li><li>Aoto, J., Martinelli, D. C., Malenka, R. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presynaptic+neurexin-3+alternative+splicing+trans-synaptically+controls+postsynaptic+AMPA+receptor+trafficking.">Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking.</a> Cell. 154 (1), 75-88 (2013).</li><li>Aoto, J., F&#246;ldy, C., Ilcus, S. M. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+circuit-dependent+functions+of+presynaptic+neurexin-3+at+GABAergic+and+glutamatergic+synapses.">Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses.</a> Nature Neuroscience. 18 (7), 997-1007 (2015).</li><li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+Neurexin+Complexes:+A+Molecular+Code+for+the+Logic+of+Neural+Circuits.">Synaptic Neurexin Complexes: A Molecular Code for the Logic of Neural Circuits.</a> Cell. 171 (4), 745-769 (2017).</li><li>Dai, J., Aoto, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+Presynaptic+Neurexins+Differentially+Controls+Postsynaptic+NMDA+and+AMPA+Receptor+Responses.">Alternative Splicing of Presynaptic Neurexins Differentially Controls Postsynaptic NMDA and AMPA Receptor Responses.</a> Neuron. 102 (5), 993-1008 (2019).</li><li>Restrepo, S., Langer, N. J., Nelson, K. A., Aoto, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+a+Neurexin-3&#945;+Human+Mutation+in+Mouse+Neurons+Identifies+a+Novel+Role+in+the+Regulation+of+Transsynaptic+Signaling+and+Neurotransmitter+Release+at+Excitatory+Synapses.">Modeling a Neurexin-3&#945; Human Mutation in Mouse Neurons Identifies a Novel Role in the Regulation of Transsynaptic Signaling and Neurotransmitter Release at Excitatory Synapses.</a> The Journal of Neuroscience. 39 (46), 9065-9082 (2019).</li><li>Ko, J., Fuccillo, M. V., Malenka, R. C., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Functions+as+a+Neurexin+Ligand+in+Promoting+Excitatory+Synapse+Formation.">LRRTM2 Functions as a Neurexin Ligand in Promoting Excitatory Synapse Formation.</a> Neuron. 64 (6), 791-798 (2009).</li><li>de Wit, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Interacts+with+Neurexin1+and+Regulates+Excitatory+Synapse+Formation.">LRRTM2 Interacts with Neurexin1 and Regulates Excitatory Synapse Formation.</a> Neuron. 64 (6), 799-806 (2009).</li><li>Linhoff, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Unbiased+Expression+Screen+for+Synaptogenic+Proteins+Identifies+the+LRRTM+Protein+Family+as+Synaptic+Organizers.">An Unbiased Expression Screen for Synaptogenic Proteins Identifies the LRRTM Protein Family as Synaptic Organizers.</a> Neuron. 61 (5), 734-749 (2009).</li><li>Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTMs+and+Neuroligins+Bind+Neurexins+with+a+Differential+Code+to+Cooperate+in+Glutamate+Synapse+Development.">LRRTMs and Neuroligins Bind Neurexins with a Differential Code to Cooperate in Glutamate Synapse Development.</a> Journal of Neuroscience. 30 (22), 7495-7506 (2010).</li><li>Gibson, D. G., Young, L., Chuang, R. -. Y., Venter, J. C., Hutchison, C. A., Smith, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Bacchetti, S., Graham, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfer+of+the+gene+for+thymidine+kinase+to+thymidine+kinase-deficient+human+cells+by+purified+herpes+simplex+viral+DNA.">Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (4), 1590-1594 (1977).</li><li>Cerchiari, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+strategy+for+tissue+self-organization+that+is+robust+to+cellular+heterogeneity+and+plasticity.">A strategy for tissue self-organization that is robust to cellular heterogeneity and plasticity.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (7), 2287-2292 (2015).</li><li>Burdick, M. M., McCarty, O. J. T., Jadhav, S., Konstantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+inflammation+and+cancer+metastasis.">Cell-cell interactions in inflammation and cancer metastasis.</a> IEEE Engineering in Medicine and Biology Magazine. 20 (3), 86-91 (2001).</li><li>Fox, D. A., Gizinski, A., Morgan, R., Lundy, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+rheumatoid+arthritis+synovium.">Cell-cell interactions in rheumatoid arthritis synovium.</a> Rheumatic Diseases Clinics of North America. 36 (2), 311-323 (2010).</li><li>Yamagata, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+modulation+and+selectivity+of+transsynaptic+neurexin-LRRTM+interaction.">Structural insights into modulation and selectivity of transsynaptic neurexin-LRRTM interaction.</a> Nature Communications. 9 (1), 3964 (2018).</li><li>Nguyen, T., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+properties+of+neuroligin+1+and+neurexin+1beta+reveal+function+as+heterophilic+cell+adhesion+molecules.">Binding properties of neuroligin 1 and neurexin 1beta reveal function as heterophilic cell adhesion molecules.</a> The Journal of Biological Chemistry. 272 (41), 26032-26039 (1997).</li><li>Boucard, A. A., Ko, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Affinity+Neurexin+Binding+to+Cell+Adhesion+G-protein-coupled+Receptor+CIRL1/Latrophilin-1+Produces+an+Intercellular+Adhesion+Complex.">High Affinity Neurexin Binding to Cell Adhesion G-protein-coupled Receptor CIRL1/Latrophilin-1 Produces an Intercellular Adhesion Complex.</a> Journal of Biological Chemistry. 287 (12), 9399-9413 (2012).</li></ol>

Die Autoren haben nichts zu verraten.

Die Sezieren der Protein-Protein-Wechselwirkungen, die während der Zelladhäsion im Trans auftreten, kann zu einem besseren Verständnis der molekularen Mechanismen führen, die grundlegenden zellulären Prozessen zugrunde liegen, einschließlich der Bildung, Funktion und Wartung von Synapsen während der Reifung und des Umbaus. Die Implikationen von Zell-zu-Zell-Interaktionen gehen über die Neurobiologie hinaus und spielen eine breitere Rolle bei der Signaltransduktion, Zellmigration und Gewebeentwicklung<sup class="x...

Synaptische Wechselwirkungen, die durch synaptische Adhäsionsmoleküle erleichtert werden, sind die Grundlage für die Entwicklung, Organisation, Spezifikation, Wartung und Funktion von Synapsen und die Erzeugung von neuronalen Netzwerken. Die Identifizierung dieser transsynaptischen Zelladhäsionsmoleküle nimmt rapide zu; Daher ist es von grundlegender Bedeutung, verbindliche Partner zu identifizieren und zu verstehen, wie diese neuen Adhäsionsmoleküle miteinander interagieren. Zusätzlich hat die Genomsequenzierung Mutationen in vielen dieser Adhäsionsmoleküle identifiziert, die häufig mit einer Vielzahl von neuroentwicklungsbedingten, neuropsychiatrischen und Suchterkrankungen verbunden sind1. Mutationen in Genen, die für synaptische Zelladhäsionsmoleküle kodieren, können Trans-Wechselwirkungen nachteilig verändern und zu pathophysiologischen Veränderungen bei der Synapsenbildung und-Erhaltung beitragen.
Es gibt mehrere Assays zur quantitativen Bewertung von Protein-Protein-Wechselwirkungen wie isotherme Kalorimetrie, kreisförmiger Dichroismus, Oberflächen-Plasmonresonanz2 und obwohl quantitativ, haben sie mehrere Einschränkungen. Erstens benötigen sie rekombinantes Protein, das manchmal langwierige und mühsame Reinigungsschritte erfordert. Zweitens erfordern sie eine ausgeklügelte Spezialausrüstung und technisches Know-how. Drittens können sie das Bindungsgrad überschätzen, da sie sowohl cis- als auch Trans-Wechselwirkungen zwischen Proteinen ermöglichen, die natürlicherweise in vivo an eine Membran gebunden sind. Hier schlagen wir einen einfachen und relativ schnellen Assay vor, der ausschließlich Trans-Interaktionen testet.
Um viele der Komplikationen im Zusammenhang mit gereinigten Protein-Assays zu umgehen, haben wir einen zellbasierten Protein-Interaktionstest optimiert, der Trans-Interaktionen in einem reduzierten heterologen Zellsystem rekapituliert. Dieser Assay wurde zuvor in verschiedenen Formen verwendet, um transzelluläre Wechselwirkungen zu untersuchen. Bei diesem Ansatz werden Kandidatenzelladhäsionsmoleküle in HEK293T-Zellen transfiziert. Unter physiologischen Bedingungen weisen HEK293T-Zellen keine Selbstaggregation auf, so dass sie beispielhafte Modelle für diesen Test aufweisen. Wenn jedoch einzelne Populationen von HEK-Zellen, die Rezeptor und Liganden exexegieren, kombiniert werden, erzwingt die Bindung des Rezeptors und des Liganden die Aggregation von HEK-Zellen. Diese Aggregation wird ausschließlich durch Transinteraktionen vermittelt und ist in der Regel in Dutzenden von Minuten beobachtbar. Bei dieser Methode sind keine Proteinreinigungsschritte erforderlich, und die Effizienz der Methode beruht auf dem Paradigma, dass Populationen von HEK-Zellen, die Cognate-Adhäsionsmoleküle exdrücken, kombiniert und dann nur zig Minuten später abgebildet werden. Darüber hinaus ist diese Methode relativ kostengünstig, da weder Antikörper noch kostspielige Ausrüstung erforderlich sind. Die einzige Ausrüstung, die für die Erfassung von Daten benötigt wird, ist ein Standard-Fluoreszenzmikroskop. Ein weiterer Vorteil dieses zellbasierten Assays ist die Fähigkeit, die Wirkung krankheitsrelevanter Punktmutationen auf Trans-Wechselwirkungen schnell zu untersuchen. Dies kann durch Transfizieren von HEK-Zellen mit cDNAs der mutierten Varianten des Proteins von Interesse durchgeführt werden.
In diesem Protokoll stellen wir ein Beispiel vor, in dem wir untersuchen, ob sich eine Missense-Mutation in Neurexin3 "(Neurexin3"A687T), die bei einem Patienten mit einer tiefen geistigen Behinderung und Epilepsie identifiziert wurde, wechselwirkungen im Trans mit Leucin-reichem Repeat-Transmembranprotein 2 (LRRTM2) verändert. Neurexin3 ist ein Mitglied der evolutionär konservierten Familie von präsynaptischen Zelladhäsionsmolekülen und während neuere Arbeiten mehrere Rollen an der Synapseidentifizierthaben 3,4,5,6,7, bleibt unser synaptisches Verständnis dieses Moleküls und aller Mitglieder der Neurexin-Familie unvollständig. LRRTM2 ist ein exzitatorisches postsynaptisches Zelladhäsionsprotein, das an der Synapsenbildung und-erhaltung8,9,10teilnimmt. Wichtig ist, dass LRRTM2 ausschließlich mit Neurexin-Isoformen interagiert, denen die Spleißstelle 4 alternatives Exon (SS4-) fehlt, aber nicht mit Neurexin-Isoformen, die die Spleißstelle 4 alternatives Exon (SS4+) enthalten. Die menschliche Missense-Mutation (A687T), die in Neurexin3 identifiziert wurde, befindet sich in einer nicht untersuchten extrazellulären Region, die evolutionär konserviert ist und zwischen allen Alpha-Neurexinenkonserviertwird 7 . Da die Wechselwirkung zwischen diesen beiden Molekülen8,9,11festgestellt wurde, stellten wir die Frage: Wird die Bindungsfähigkeit von Neurexin3' SS4- zu LRRTM2 durch eine A687T-Punktmutation verändert? Dieser Test ergab, dass die A687T-Punktmutation unerwartet die Aggregation von Neurexin3zu LRRTM2 verbesserte, was darauf hindeutet, dass die extrazelluläre Region, in der sich die Punktmutation befindet, eine Rolle bei der Vermittlung transsynaptischer Wechselwirkungen spielt.

<table border="0" cellpadding="0" cellspacing="0" style="width:788px;" width="787">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="60">
			<td height="60" style="height:60px;width:339px;">1.5 mL disposable microtubes with snap caps</td>
			<td style="width:121px;">VWR</td>
			<td style="width:161px;">89000-028</td>
			<td style="width:167px;">Incubation of mixed population of HEK cells</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">1000 mL Rapid&#8212;Flow Filter Unit, 0.2 um aPES membrane</td>
			<td style="width:121px;">Thermo Fisher</td>
			<td style="width:161px;">567-0020</td>
			<td style="width:167px;">Sterilization of HEK media</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">15 mL SpectraTube centrifuge tubes</td>
			<td style="width:121px;">Ward&#8217;s Science</td>
			<td style="width:161px;">470224-998</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">6 well sterile tissue culture plates</td>
			<td style="width:121px;">VWR</td>
			<td style="width:161px;">100062-892</td>
			<td style="width:167px;">culturing HEK cells</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:339px;">Calcium Chloride</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">223506-500G</td>
			<td style="width:167px;">Calcium phosphate transfection, HEK cell resuspension</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:45px;width:339px;">Centrifuge- Sorvall Legend RT</td>
			<td style="width:121px;">Kendro Laboratory Products</td>
			<td align="right" style="width:161px;">75004377</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:22px;width:339px;">CO2 cell incubator</td>
			<td style="width:121px;">Thermo Scientific</td>
			<td style="width:161px;">HERACELL 150i</td>
			<td style="width:167px;">Incubation of HEK cells during growth</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:339px;">DMEM, 1x (Dulbecco&#39;s Modification of Eagle&#39;s Medium) with 4.5 g/L glucose, L-glutamine &#38; sodium pyruvate</td>
			<td style="width:121px;">Corning</td>
			<td style="width:161px;">10-013-CV</td>
			<td style="width:167px;">HEK cell maintenance</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Dulbecco&#8217;s Phosphate Buffered Saline PBS (1X)</td>
			<td style="width:121px;">Gibco</td>
			<td style="width:161px;">14190-144</td>
			<td style="width:167px;">Passaging/harvesting HEK cell</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">Ethylenediaminetetraacetic acid</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">ED-500G</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:339px;">Falcon Vented culture flasks, 75cm2 growth area</td>
			<td style="width:121px;">Corning</td>
			<td style="width:161px;">9381M26</td>
			<td style="width:167px;">Culturing HEK cells</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Fetal Bovine Serum</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">17L184</td>
			<td style="width:167px;">HEK cell maintenance</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">HEK293T cells</td>
			<td style="width:121px;">ATCC</td>
			<td style="width:161px;"></td>
			<td style="width:167px;">Model system</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">ImageJ</td>
			<td style="width:121px;">NIH</td>
			<td style="width:161px;">V: 2.0.0-rc-69/1.52p</td>
			<td style="width:167px;">Image analysis</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Magnesium Chloride hexahydrate</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">M9272-500G</td>
			<td style="width:167px;">HEK cell resuspension</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Sodium phosphate dibasic anhydrous</td>
			<td style="width:121px;">Fisher BioReagents</td>
			<td style="width:161px;">BP332-500</td>
			<td style="width:167px;">Calcium phosphate transfection</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Trypsin 0.25% (1X) Solution</td>
			<td style="width:121px;">GE Healthcare Life Sciences</td>
			<td style="width:161px;">SH30042.01</td>
			<td style="width:167px;">Passaging HEK cells</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Tube rotator</td>
			<td style="width:121px;"></td>
			<td style="width:161px;"></td>
			<td style="width:167px;">Incubation of mixed population of HEK cells</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:339px;">UltraClear Microscope slides. White Frosted, Positive Charged</td>
			<td style="width:121px;">Denville Scientific Inc.</td>
			<td style="width:161px;">M1021</td>
			<td style="width:167px;">Image acquisition</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">Wide-field microscope</td>
			<td style="width:121px;">Zeiss</td>
			<td style="width:161px;">Axio Vert 200M</td>
			<td style="width:167px;">Image acquisition</td>
		</tr>
	</tbody>
</table>

measuring transcellular interactions through protein aggregation in a heterologous cell system

Protein-Wechselwirkungen an zellulären Schnittstellen diktieren eine Vielzahl von biologischen Ergebnissen, die von der Gewebeentwicklung und Krebsprogression bis hin zur Synapsenbildung und -erhaltung reichen. Viele dieser grundlegenden Wechselwirkungen treten bei Trans auf und werden typischerweise durch heterophile oder homophile Wechselwirkungen zwischen Zellen induziert, die membranverankerte Bindungspaare exdrücken. Die Aufklärung, wie krankheitsrelevante Mutationen diese grundlegenden Proteinwechselwirkungen stören, kann Einen Einblick in eine Vielzahl von Zellbiologiefeldern geben. Viele Protein-Protein-Interaktions-Assays sind in der Regel nicht uneindeutig zwischen cis und Trans-Wechselwirkungen, was potenziell zu einer Überschätzung des In-vivo-Bindungsumfangs führt und eine arbeitsintensive Reinigung von Protein- und/oder spezialisierten Überwachungsgeräten beinhaltet. Hier präsentieren wir ein optimiertes einfaches Protokoll, das die Beobachtung und Quantifizierung von nur Trans-Wechselwirkungen ohne langwierige Proteinreinigungen oder spezielle Geräte ermöglicht. Der HEK-Zellaggregationstest beinhaltet das Mischen von zwei unabhängigen Populationen von HEK-Zellen, die jeweils membrangebundene Cognateligaden exdrücken. Nach einer kurzen Inkubationszeit werden Proben abgebildet und die resultierenden Aggregate quantifiziert.

Die A687T-Mutation erhöht die Neurexin3-SS4-Bindung an LRRTM27 Um zu untersuchen, wie interzelluläre Wechselwirkungen zweier bekannter synaptischer Proteine durch die Einführung einer Punktmutation bei einem Patienten mit geistiger Behinderung und Epilepsie beeinflusst werden, verwendeten wir den oben genannten HEK-Zellaggregationstest (Abbildung 1). Die Zellen wurden gemäß Abschnitt 1 transfiziert und für die Bildgebung gemäß den Abschnitten 1 und 2 de...

Watch this Scientific Journal Video about Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System at JoVE.com

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Hier präsentieren wir ein optimiertes Protokoll zur schnellen und semiquantitativen Messung von Liganden-Rezeptor-Wechselwirkungen in Trans in einem heterologen Zellsystem mittels Fluoreszenzmikroskopie.

Messung transzellulärer Wechselwirkungen durch Proteinaggregation in einem heterologen Zellsystem

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse ...

measuring-transcellular-interactions-through-protein-aggregation

Research

JoVE Journal

Neuroscience

3.4K Aufrufe.  University of Colorado Denver School of Medicine. Hier präsentieren wir ein optimiertes Protokoll zur schnellen und semiquantitativen Messung von Liganden-Rezeptor-Wechselwirkungen in Trans in einem heterologen Zellsystem mittels Fluoreszenzmikroskopie.

Serie: Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Assaying Surface Expression of Chemosensory Receptors in Heterologous Cells

The vivid world of odors is recognized by the sense of olfaction. Olfaction in mice is mediated by a repertoire of about 1200 G Protein Coupled Receptors (GPCRs) 1 that are postulated to bind volatile odorant molecules and converting the extracellular signal into an intracellular signal by coupling with G protein G&alpha;olf. Binding of the odorants to the receptors is thought to follow a combinatorial rule, that is, one odorant may bind several receptors and one receptor may bind several odorants to varying degrees 2. Biochemical, signaling and ligand binding studies have been conveniently carried out for most GPCRs using heterologous cells. However use of heterologous cells for study of odorant receptors, was precluded for a long time since on transfection they failed to export to the surface. Saito et al have demonstrated single membrane pass Receptor Transporting Protein (RTP) family chaperones show enhanced expression in the olfactory sensory neurons and act as chaperones to traffic odorant receptors to the surface in heterologous cells, when co transfected together 3. To carry out biochemical assays for receptors using heterologous cells, one must first determine if the receptor shows robust surface expression in the cell line. This can be assayed by overexpressing the receptors with the chaperone RTP1S followed by live cell staining to fluorescently label the extracellular domain or a tag in the extracellular domain exclusively. Here we demonstrate a protocol to carry out live cell staining that can be used to detect odorant receptors on the surface of HEK293T cells conveniently. In addition, it may also be used to assay for surface expression of other chemosensory receptors or GPCRs.

Here we demonstrate a protocol to carry out live cell staining that can be used to detect odorant receptors on the surface of HEK293T cells conveniently. In addition, it may also be used to assay for surface expression of other chemosensory receptors or GPCRs.

Assaying Oberfläche Expression von Chemosensoren in heterologen Zellen

The vivid world of odors is recognized by the sense of olfaction. Olfaction in mice is mediated by a repertoire of about 1200 G Protein Coupled Receptors ...

Forschung

Neurowissenschaften

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

Effiziente Ableitung von humanen neuronalen Vorläuferzellen und Neuronen aus pluripotenten humanen embryonalen Stammzellen mit Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Peering into the Dynamics of Social Interactions: Measuring Play Fighting in Rats

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements of one animal are countered by the actions of its partner, play fighting is a complex, dynamic interaction. This dynamic complexity raises methodological problems about what to score for experimental studies. We present a scoring schema that is sensitive to the correlated nature of the actions performed. The frequency of play fighting can be measured by counting the number of playful nape attacks occurring per unit time. However, playful defense, as it can only occur in response to attack, is necessarily a contingent measure that is best measured as a percentage (#attacks defended/total # attacks X 100%). How a particular attack is defended against can involve one of several tactics, and these are contingent on defense having taken place; consequently, the type of defense is also best expressed contingently as a percentage. Two experiments illustrate how these measurements can be used to detect the effect of brain damage on play fighting even when there is no effect on overall playfulness. That is, the schema presented here is designed to detect and evaluate changes in the content of play following an experimental treatment.

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements of one animal are countered by the actions of its partner, play fighting is a complex, dynamic interaction. This dynamic complexity raises methodological problems about what to score for experimental studies. We present a scoring schema that is sensitive to the correlated nature of the actions performed. Two experiments illustrate how these measurements can be used to detect the effect of brain damage on play fighting even when there is no effect on overall playfulness. That is, the schema presented here is designed to detect and evaluate changes in the content of play following an experimental treatment.

Ein Blick in die Dynamik der sozialen Interaktionen: Mess-Play-Kampf in Ratten

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements ...

Dual Electrophysiological Recordings of Synaptically-evoked Astroglial and Neuronal Responses in Acute Hippocampal Slices

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs through activation of their ion channels and neurotransmitter receptors, and process information in part through activity-dependent release of gliotransmitters. Furthermore, astrocytes constitute the main uptake system for glutamate, contribute to potassium spatial buffering, as well as to GABA clearance. These cells therefore constantly monitor synaptic activity, and are thereby sensitive indicators for alterations in synaptically-released glutamate, GABA and extracellular potassium levels. Additionally, alterations in astroglial uptake activity or buffering capacity can have severe effects on neuronal functions, and might be overlooked when characterizing physiopathological situations or knockout mice. Dual recording of neuronal and astroglial activities is therefore an important method to study alterations in synaptic strength associated to concomitant changes in astroglial uptake and buffering capacities. Here we describe how to prepare hippocampal slices, how to identify stratum radiatum astrocytes, and how to record simultaneously neuronal and astroglial electrophysiological responses. Furthermore, we describe how to isolate pharmacologically the synaptically-evoked astroglial currents.

The preparation of acute brain slices from isolated hippocampi, as well as the simultaneous electrophysiological recordings of astrocytes and neurons in stratum radiatum during stimulation of schaffer collaterals is described. The pharmacological isolation of astroglial potassium and glutamate transporter currents is demonstrated.

Dual-Elektrophysiologische Recordings synaptisch-evozierte astrogliale und neuronale Antworten in Acute Hippocampusschnitte

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs ...

A Lightweight, Headphones-based System for Manipulating Auditory Feedback in Songbirds

Experimental manipulations of sensory feedback during complex behavior have provided valuable insights into the computations underlying motor control and sensorimotor plasticity1. Consistent sensory perturbations result in compensatory changes in motor output, reflecting changes in feedforward motor control that reduce the experienced feedback error. By quantifying how different sensory feedback errors affect human behavior, prior studies have explored how visual signals are used to recalibrate arm movements2,3 and auditory feedback is used to modify speech production4-7. The strength of this approach rests on the ability to mimic naturalistic errors in behavior, allowing the experimenter to observe how experienced errors in production are used to recalibrate motor output.
Songbirds provide an excellent animal model for investigating the neural basis of sensorimotor control and plasticity8,9. The songbird brain provides a well-defined circuit in which the areas necessary for song learning are spatially separated from those required for song production, and neural recording and lesion studies have made significant advances in understanding how different brain areas contribute to vocal behavior9-12. However, the lack of a naturalistic error-correction paradigm - in which a known acoustic parameter is perturbed by the experimenter and then corrected by the songbird - has made it difficult to understand the computations underlying vocal learning or how different elements of the neural circuit contribute to the correction of vocal errors13.
The technique described here gives the experimenter precise control over auditory feedback errors in singing birds, allowing the introduction of arbitrary sensory errors that can be used to drive vocal learning. Online sound-processing equipment is used to introduce a known perturbation to the acoustics of song, and a miniaturized headphones apparatus is used to replace a songbird's natural auditory feedback with the perturbed signal in real time. We have used this paradigm to perturb the fundamental frequency (pitch) of auditory feedback in adult songbirds, providing the first demonstration that adult birds maintain vocal performance using error correction14. The present protocol can be used to implement a wide range of sensory feedback perturbations (including but not limited to pitch shifts) to investigate the computational and neurophysiological basis of vocal learning.

We describe the design and assembly of miniaturized headphones suitable for replacing a songbird&#x2019;s natural auditory feedback with a manipulated acoustic signal. Online sound processing hardware is used to manipulate song output, introduce real-time errors in auditory feedback via the headphones, and drive vocal motor learning.

Ein Leichtes, Kopfhörer-basierte System zur Manipulation Auditory Feedback in Songbirds

Experimental manipulations of sensory feedback during complex behavior have provided valuable insights into the computations underlying motor control and ...

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Genetic modification of specific regions of the developing mammalian brain is a very powerful experimental approach. However, generating novel mouse mutants is often frustratingly slow. It has been shown that access to the mouse brain developing in utero with reasonable post-operatory survival is possible. Still, results with this procedure have been reported almost exclusively for the most superficial and easily accessible part of the developing brain, i.e. the cortex. The thalamus, a narrower and more medial region, has proven more difficult to target. Transfection into deeper nuclei, especially those of the hypothalamus, is perhaps the most challenging and therefore very few results have been reported. Here we demonstrate a procedure to target the entire hypothalamic neuroepithelium or part of it (hypothalamic regions) for transfection through electroporation. The keys to our approach are longer narcosis times, injection in the third ventricle, and appropriate kind and positioning of the electrodes. Additionally, we show results of targeting and subsequent histological analysis of the most recessed hypothalamic nucleus, the mammillary body.

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Despite the functional and medical importance of the hypothalamus, in utero genetic manipulation of its development has rarely been attempted. We show a detailed procedure for in utero electroporation into the mouse hypothalamus and show representative results of total and partial (regional) hypothalamic transfection.

Genetische Manipulation der Maus entwickeln Hypothalamus durch<em&gt; In utero</em&gt; Elektroporation

Genetic  modification of specific regions of the developing mammalian brain is a very  powerful experimental approach. However, generating novel mouse ...

A Caenorhabditis elegans Model System for Amylopathy Study

Amylopathy is a term that describes abnormal synthesis and accumulation of amyloid beta (A&beta;) in tissues with time. A&beta; is a hallmark of Alzheimer's disease (AD) and is found in Lewy body dementia, inclusion body myositis and cerebral amyloid angiopathy 1-4. Amylopathies progressively develop with time. For this reason simple organisms with short lifespans may help to elucidate molecular aspects of these conditions. Here, we describe experimental protocols to study A&beta;-mediated neurodegeneration using the worm Caenorhabditis elegans. Thus, we construct transgenic worms by injecting DNA encoding human A&beta;42 into the syncytial gonads of adult hermaphrodites. Transformant lines are stabilized by a mutagenesis-induced integration. Nematodes are age synchronized by collecting and seeding their eggs. The function of neurons expressing A&beta;42 is tested in opportune behavioral assays (chemotaxis assays). Primary neuronal cultures obtained from embryos are used to complement behavioral data and to test the neuroprotective effects of anti-apoptotic compounds.

A Caenorhabditis elegans Model System for Amylopathy Study

We describe methods to study aspects of amylopathies in the worm C. elegans. We show how to construct worms expressing human A&beta;42 in neurons and how to test their function in behavioral assays. We further show how to obtain primary neuronal cultures that can be used for pharmacological testing.

A<em&gt; Caenorhabditis elegans</em&gt; Modell-System für Amylopathy Study

Amylopathy is a term that describes abnormal synthesis and accumulation of amyloid beta (A&beta;) in tissues with time. A&beta; is a hallmark of ...

Use of a Caspase Multiplexing Assay to Determine Apoptosis in a Hypothalamic Cell Model

The ability to multiplex assays in studies of complex cellular mechanisms eliminates the need for repetitive experiments, provides internal controls, and decreases waste in costs and reagents. Here we describe optimization of a multiplex assay to assess apoptosis following a palmitic acid (PA) challenge in an in vitro hypothalamic model, using both fluorescent and luminescent based assays to measure viable cell counts and caspase-3/7 activity in a 96-well microtiter plate format. Following PA challenge, viable cells were determined by a resazurin-based fluorescent assay. Caspase-3/7 activity was then determined using a luminogenic substrate, DEVD, and normalized to cell number. This multiplexing assay is a useful technique for determining change in caspase activity following an apoptotic stimulus, such as saturated fatty acid challenge. The saturated fatty acid PA can increase hypothalamic oxidative stress and apoptosis, indicating the potential importance of assays such as that described here in studying the relationship between saturated fatty acids and neuronal function.

Multiplex assays can provide beneficial information for basic cellular mechanisms&#160;and eliminate waste of reagents and unnecessary repetitive experiments. We describe here a multiplex caspase-3/7 activity assay, using fluorescent- and luminescent-based methods, to determine cell viability in an in vitro hypothalamic model following oxidative challenge with palmitic acid.

Verwendung eines Caspase Multiplexing-Test zur Apoptose in einer Zelle Hypothalamus Modell ermitteln

The ability to multiplex assays in studies of complex cellular mechanisms eliminates the need for repetitive experiments, provides internal controls, and ...

Inducing Plasticity of Astrocytic Receptors by Manipulation of Neuronal Firing Rates

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be stimulated by neuronally-released transmitter. However, the ability of astrocytic receptors to exhibit plasticity in response to changes in neuronal activity has received little attention. Here we describe a model system that can be used to globally scale up or down astrocytic group I metabotropic glutamate receptors (mGluRs) in acute brain slices. Included are methods on how to prepare parasagittal hippocampal slices, construct chambers suitable for long-term slice incubation, bidirectionally manipulate neuronal action potential frequency, load astrocytes and astrocyte processes with fluorescent Ca2+ indicator, and measure changes in astrocytic Gq GPCR activity by recording spontaneous and evoked astrocyte Ca2+ events using confocal microscopy. In essence, a &#8220;calcium roadmap&#8221; is provided for how to measure plasticity of astrocytic Gq GPCRs. Applications of the technique for study of astrocytes are discussed. Having an understanding of how astrocytic receptor signaling is affected by changes in neuronal activity has important implications for both normal synaptic function as well as processes underlying neurological disorders and neurodegenerative disease.

Here we describe an adaptation of protocols used to induce homeostatic plasticity in neurons for the study of plasticity of astrocytic G protein-coupled receptors. Recently used to examine changes in astrocytic group I mGluRs in juvenile mice, the method can be applied to measure scaling of various astrocytic GPCRs, in tissue from adult mice in situ and in vivo, and to gain a better appreciation of the sensitivity of astrocytic receptors to changes in neuronal activity.

Induktion von Plastizität Astrozytäre Rezeptoren durch Manipulation der neuronalen Feuerraten

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be ...

Quantitative Cell Biology of Neurodegeneration in Drosophila Through Unbiased Analysis of Fluorescently Tagged Proteins Using ImageJ

With the rising prevalence of neurodegenerative diseases, it is increasingly important to understand the underlying pathophysiology that leads to neuronal dysfunction and loss. Fluorescence-based imaging tools and technologies enable unprecedented analysis of subcellular neurobiological processes, yet there is still a need for unbiased, reproducible, and accessible approaches for extracting quantifiable data from imaging studies. We have developed a simple and adaptable workflow to extract quantitative data from fluorescence-based imaging studies using Drosophila models of neurodegeneration. Specifically, we describe an easy-to-follow, semi-automated approach using Fiji/ImageJ to analyze two cellular processes: first, we quantify protein aggregate content and profile in the Drosophila optic lobe using fluorescent-tagged mutant huntingtin proteins; and second, we assess autophagy-lysosome flux in the Drosophila visual system with ratiometric-based quantification of a tandem fluorescent reporter of autophagy. Importantly, the protocol outlined here includes a semi-automated segmentation step to ensure all fluorescent structures are analyzed to minimize selection bias and to increase resolution of subtle comparisons. This approach can be extended for the analysis of other cell biological structures and processes implicated in neurodegeneration, such as proteinaceous puncta (stress granules and synaptic complexes), as well as membrane-bound compartments (mitochondria and membrane trafficking vesicles). This method provides a standardized, yet adaptable reference point for image analysis and quantification, and could facilitate reliability and reproducibility across the field, and ultimately enhance mechanistic understanding of neurodegeneration.

Quantitative Cell Biology of Neurodegeneration in Drosophila Through Unbiased Analysis of Fluorescently Tagged Proteins Using ImageJ

We have developed a simple and adaptable workflow to extract quantitative data from fluorescence-imaging-based cell biological studies of protein aggregation and autophagic flux in the central nervous system of Drosophila models of neurodegeneration.

Quantitative Zellbiologie der Neurodegeneration in Drosophila durch unvoreingenommene Analyse der Gewebekulturen Tagged Proteine mit ImageJ

With the rising prevalence of neurodegenerative diseases, it is increasingly important to understand the underlying pathophysiology that leads to neuronal ...