We thank all the members of the Iwasaki lab for critical reading of the manuscript. This work was supported in part by a Grant-in-Aid for Scientific Research on Innovative Areas (#26113005 to S.N. and JP17H05679 to S.I.); a Grant-in-Aid for Young Scientists (A) (JP17H04998 to S.I.) from the Ministry of Education, Science, Sports, and Culture of Japan (MEXT); and the Pioneering Projects &#34;Cellular Evolution&#34; and all RIKEN project &#34;Disease and Epigenome&#34; from RIKEN (to S.N. and S.I.).

All methods described herein have been approved by the safety division of RIKEN (H27-EP071) and conducted with relevant guidelines and regulations.
1. Tissue dissection
<ol>
	<li>Dissect the tissues of interest into small pieces (approximately &#60;3 mm2) using fine spring scissors. 
	Note: Larger tissue fragments take longer to freeze, and smaller pieces will carry over larger volumes of buffer, both of which may affect the results.</li>
	<li>Add the dissected tissue fragmen...

<ol>
	<li>Mito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+survey+of+epigenetic+modifications+by+tandem+chromatin+immunoprecipitation+sequencing.">Cell type-specific survey of epigenetic modifications by tandem chromatin immunoprecipitation sequencing.</a> Scientific Reports. 8 (1), 1143 (2018).</li><li>Kadota, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+binding+landscape+in+jawless+fish+with+reference+to+Hox+cluster+evolution.">CTCF binding landscape in jawless fish with reference to Hox cluster evolution.</a> Scientific Reports. 7 (1), 4957 (2017).</li><li>Jung, Y. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+sequencing+depth+in+ChIP-seq+experiments.">Impact of sequencing depth in ChIP-seq experiments.</a> Nucleic Acids Research. 42 (9), (2014).</li><li>Becker, P. B., Workman, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleosome+remodeling+and+epigenetics.">Nucleosome remodeling and epigenetics.</a> Cold Spring Harbor Perspectives in Biology. 5 (9), a017905 (2013).</li><li>Kidder, B. L., Zhao, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+library+preparation+for+next-generation+sequencing+analysis+of+genome-wide+epigenetic+and+transcriptional+landscapes+in+embryonic+stem+cells.">Efficient library preparation for next-generation sequencing analysis of genome-wide epigenetic and transcriptional landscapes in embryonic stem cells.</a> Methods in Molecular Biology. , 3-20 (2014).</li><li>Gilfillan, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limitations+and+possibilities+of+low+cell+number+ChIP-seq.">Limitations and possibilities of low cell number ChIP-seq.</a> BMC Genomics. 13, 645 (2012).</li><li>Schmidl, C., Rendeiro, A. F., Sheffield, N. C., Bock, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIPmentation:+fast,+robust,+low-input+ChIP-seq+for+histones+and+transcription+factors.">ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors.</a> Nature Methods. 12 (10), 963-965 (2015).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> Journal of Neuroscience. 34 (36), 11929-11947 (2014).</li><li>Hornstein, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligation-free+ribosome+profiling+of+cell+type-specific+translation+in+the+brain.">Ligation-free ribosome profiling of cell type-specific translation in the brain.</a> Genome Biology. 17 (1), 149 (2016).</li><li>Zhao, Y., Garcia, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+catalog+of+currently+documented+histone+modifications.">Comprehensive catalog of currently documented histone modifications.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), a025064 (2015).</li><li>Hoffman, E. A., Frey, B. L., Smith, L. M., Auble, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formaldehyde+crosslinking:+a+tool+for+the+study+of+chromatin+complexes.">Formaldehyde crosslinking: a tool for the study of chromatin complexes.</a> The Journal of Biological Chemistry. 290 (44), 26404-26411 (2015).</li></ol>

Our protocol was optimized for the neurons of the mouse brain, in which the expression of FLAG-tagged H2B is induced by tamoxifen injection. Promoters used for H2B expression, starting tissue materials, and the amount of the tissues are pivotal parameters for successful tChIP-Seq. Thus, the optimization of these factors should be considered for each cell type of interest.
A critical step among the procedures used in this protocol is the DNA shearing to achieve a chromatin length of 100-500 bp<...

Tissues of animals consist of diverse cell types. The gene regulation in each cell defines the cell type. Chromatin modifications - DNA methylation and histone modification - underlie the cell-type specificity of gene expression. Thus, the measurement of epigenetic regulation in each cell type has been desired, but it has been a technical challenge.
To investigate the epigenetics in a particular cell type, tandem chromatin immunoprecipitation sequencing (tChIP-Seq) was recently developed (Figure 1)1. In tChIP, epitope-tagged core histone protein H2B is expressed from a cell-type-specific promoter. This feature allows the isolation of chromatins from the cells of interest, although the material starts from a mixture of various cell types. Following ChIP-Seq &#8212; chromatin purification via a modified-histone mark and next-generation deep sequencing of isolated DNA &#8212; we can monitor the epigenetic status of the targeted cell type in a genome-wide manner.
Using this technique, we recently investigated neuron-specific trimethylation of histone H3 protein at lysine 4 (H3K4me3) marks. In that study, we developed a knock-in mouse in which C-terminally FLAG-tagged H2B protein was expressed upon Cre-mediated recombination (Rosa26CAG floxed-pA H2B-FLAG). By crossing with a mouse possessing the Cre-endoplasmic reticulum (ER) gene under the control of the CamK2a promoter, the obtained mouse line induced H2B-FLAG in active neurons upon tamoxifen injection (Camk2aH2B-FLAG)1. Starting from the brain of the established mouse line, we performed tChIP-Seq with anti-H3K4me3 antibody. Since H3K4me3 marks often correspond to promoter regions, we could discover hundreds of mRNAs specifically expressed in neurons1.
Here, we describe a typical tChIP-Seq method that covers the steps from tissue dissection to library construction (Figure 1). The final goal of this protocol is to share our best practices for the performance of tChIP-Seq and the future application of this method to other cell types and histone modifications.

<table>
	<tbody>
		<tr>
			<td>Protein LoBind tube, 2 mL</td>
			<td>Eppendorf</td>
			<td>No.&#160;0030108132</td>
			<td>For cell lysis</td>
		</tr>
		<tr>
			<td>Protein LoBind tube, 1.5 mL</td>
			<td>Eppendorf</td>
			<td>No.&#160;0030108116</td>
			<td>For ChIP and library preparation</td>
		</tr>
		<tr>
			<td>DNA LoBind tube, 1.5 mL</td>
			<td>Eppendorf</td>
			<td>No.&#160;0030108051</td>
			<td>For ChIP and library preparation</td>
		</tr>
		<tr>
			<td>8-strip PCR tube</td>
			<td>BIO-BIK</td>
			<td>3247-00</td>
			<td>For ChIP and library preparation</td>
		</tr>
		<tr>
			<td>SK Mill</td>
			<td>TOKKEN</td>
			<td>SK-200</td>
			<td>Handy cryogenic grinder to make cell powder for fixation</td>
		</tr>
		<tr>
			<td>Metal bullet</td>
			<td>TOKKEN</td>
			<td>SK-100-DLC10</td>
			<td>Accessory of SK Mill</td>
		</tr>
		<tr>
			<td>2 mL stainless steel tube</td>
			<td>TOKKEN</td>
			<td>TK-AM5-SUS</td>
			<td>An option for cell lysis</td>
		</tr>
		<tr>
			<td>2 mL stainless steel tube holder</td>
			<td>TOKKEN</td>
			<td>SK-100-TL</td>
			<td>An option for cell lysis</td>
		</tr>
		<tr>
			<td>16% formaldehyde (w/v), methanol-free</td>
			<td>Pierce</td>
			<td>28906</td>
			<td>To fix cells. Prepare 1% solution before use.</td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Nacalai Tesque</td>
			<td>17109-35</td>
			<td>Prepare 2.5 M stock</td>
		</tr>
		<tr>
			<td>D-PBS (-)(1x)</td>
			<td>Nacalai Tesque</td>
			<td>14249-24</td>
			<td>For washing lysate and purified DNA</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Nacalai Tesque</td>
			<td>02443-05</td>
			<td>For Lysis buffer 1. Prepare 1 M, pH 7.5 stock.</td>
		</tr>
		<tr>
			<td>5 M NaCl, molecular biology grade</td>
			<td>Nacalai Tesque</td>
			<td>06900-14</td>
			<td>For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer</td>
		</tr>
		<tr>
			<td>0.5 M EDTA, molecular biology grade</td>
			<td>Wako Pure Chemical Industries, Ltd.</td>
			<td>311-90075</td>
			<td>For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer</td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Wako Pure Chemical Industries, Ltd.</td>
			<td>072-04945</td>
			<td>For lysis buffer 1</td>
		</tr>
		<tr>
			<td>NP-40</td>
			<td>Nacalai Tesque</td>
			<td>25223-75</td>
			<td>For lysis buffer 1</td>
		</tr>
		<tr>
			<td>Triton X-100, molecular biology grade</td>
			<td>Nacalai Tesque</td>
			<td>12967-32</td>
			<td>For Lysis buffer 1</td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>Nacalai Tesque</td>
			<td>35406-91</td>
			<td>For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock.</td>
		</tr>
		<tr>
			<td>0.1 M EGTA pH neutral</td>
			<td>Nacalai Tesque</td>
			<td>08947-35</td>
			<td>For Lysis Buffer 2</td>
		</tr>
		<tr>
			<td>Protease inhibitor cocktail (100x)</td>
			<td>Nacalai Tesque</td>
			<td>25955-24</td>
			<td>To block degradation of protein</td>
		</tr>
		<tr>
			<td>RIPA buffer</td>
			<td>Thermo Fisher Scientific</td>
			<td>89900</td>
			<td>For cell lysis and washing</td>
		</tr>
		<tr>
			<td>milliTUBE 1 mL AFA Fiber</td>
			<td>Covaris</td>
			<td>520130</td>
			<td>Sonicator tube. Accessory of Focused-ultrasonicator</td>
		</tr>
		<tr>
			<td>Focused-ultrasonicator</td>
			<td>Covaris</td>
			<td>S220 or E220</td>
			<td>To digest DNA into adequate size for ChIP-Seq</td>
		</tr>
		<tr>
			<td>UltraPure 10% SDS</td>
			<td>Thermo Fisher Scientific</td>
			<td>15553-027</td>
			<td>For ChIP Elution Buffer</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>Nacalai Tesque</td>
			<td>30141-14</td>
			<td>To purify DNA from lysate</td>
		</tr>
		<tr>
			<td>Proteinase K, recombinant, PCR Grade</td>
			<td>Sigma-Aldrich</td>
			<td>3115887001</td>
			<td>To purify DNA from lysate</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Wako Pure Chemical Industries, Ltd.</td>
			<td>054-07225</td>
			<td>Make 70% solution</td>
		</tr>
		<tr>
			<td>Monoclonal anti-FLAG M2 antibody produced in mouse</td>
			<td>Sigma-Aldrich</td>
			<td>F1804</td>
			<td>To purify chromatin expressed in cells of interest</td>
		</tr>
		<tr>
			<td>Dynabead M-280 Sheep Anti-Mouse IgG</td>
			<td>Thermo Fisher Scientific</td>
			<td>11201D</td>
			<td>This can be used for anti-FLAG IP and anti-H3K4me3 IP</td>
		</tr>
		<tr>
			<td>Anti-tri-methyl histone H3 (K4), mouse monoclonal antibody</td>
			<td>Wako Pure Chemical Industries, Ltd.</td>
			<td>301-34811</td>
			<td>Any other antibody that works for ChIP analysis will work</td>
		</tr>
		<tr>
			<td>10x Blocking Reagent</td>
			<td>Sigma-Aldrich</td>
			<td>11096176001</td>
			<td>For blocking during affinity purification</td>
		</tr>
		<tr>
			<td>Denhardt&#8217;s solution</td>
			<td>Nacalai Tesque</td>
			<td>10727-74</td>
			<td>For blocking during affinity purification</td>
		</tr>
		<tr>
			<td>Glycogen (5 mg/ml)</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM9510</td>
			<td>To purify DNA from lysate</td>
		</tr>
		<tr>
			<td>Qubit 2.0 Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q32866</td>
			<td>For quantification of isolated DNA</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS Assay Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q32851</td>
			<td>For quantification of isolated DNA</td>
		</tr>
		<tr>
			<td>0.5 mL tube</td>
			<td>Axygen</td>
			<td>10011-830</td>
			<td>For quantification by Qubit</td>
		</tr>
		<tr>
			<td>Phenol/chloroform/isoamyl alcohol (25:24:1)</td>
			<td>Nacalai Tesque</td>
			<td>25970-56</td>
			<td>To purify DNA from lysate</td>
		</tr>
		<tr>
			<td>AMPure XP beads</td>
			<td>Beckman Coulter</td>
			<td>A63881</td>
			<td>SPRI magnetic beads for library preparation</td>
		</tr>
		<tr>
			<td>Metal ice rack</td>
			<td>Funakoshi</td>
			<td>IR-1</td>
			<td>To keep the cell lysate frozen</td>
		</tr>
		<tr>
			<td>Sample Cooler</td>
			<td>New England Biolabs</td>
			<td>T7771S</td>
			<td>Helps fix cells with minimal damage</td>
		</tr>
		<tr>
			<td>2100 Bioanalyzer</td>
			<td>Agilent Technologies</td>
			<td>G2939BA</td>
			<td>To check the quality of isolated DNA fragments. Another fragment analyzer can be used.</td>
		</tr>
		<tr>
			<td>Bioanalyzer 2100 Expert Software</td>
			<td>Agilent Technologies</td>
			<td>G2946CA</td>
			<td>Supplied with the Bioanalyzer</td>
		</tr>
		<tr>
			<td>High Sensitivity DNA Kit</td>
			<td>Agilent Technologies</td>
			<td>5067-4626</td>
			<td>To check the quality of the isolated DNA fragments</td>
		</tr>
		<tr>
			<td>KAPA LTP Library Preparation Kit</td>
			<td>Roche</td>
			<td>07961898001</td>
			<td>Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution</td>
		</tr>
		<tr>
			<td>NEXTflex DNA Barcodes</td>
			<td>BIOO Scientific</td>
			<td>NOVA-514101</td>
			<td>Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix.</td>
		</tr>
		<tr>
			<td>KAPA Real-Time Library Amplification Kit</td>
			<td>Roche</td>
			<td>07959028001</td>
			<td>Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards</td>
		</tr>
		<tr>
			<td>2x KAPA HiFi HotStart ReadyMix</td>
			<td>Roche</td>
			<td>KM2602</td>
			<td>For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit</td>
		</tr>
		<tr>
			<td>Buffer EB</td>
			<td>Qiagen</td>
			<td>19086</td>
			<td>10 mM Tris-Cl, pH 8.5 for elution of DNA</td>
		</tr>
		<tr>
			<td>386-well qPCR plate</td>
			<td>Thermo Fisher Scientific</td>
			<td>4309849</td>
			<td>For real-time PCR</td>
		</tr>
		<tr>
			<td>QuantStudio 7 Flex Real-Time PCR System</td>
			<td>Thermo Fisher Scientific</td>
			<td>4485701</td>
			<td>To quantify DNA</td>
		</tr>
		<tr>
			<td>MicroAmp Optical Adhesive Film</td>
			<td>Thermo Fisher Scientific</td>
			<td>4311971</td>
			<td>For real-time PCR</td>
		</tr>
		<tr>
			<td>MicroAmp Clear Adhesive Film</td>
			<td>Thermo Fisher Scientific</td>
			<td>4306311</td>
			<td>For plate sealing</td>
		</tr>
		<tr>
			<td>End-repair master mix</td>
			<td></td>
			<td></td>
			<td>Combine 1.4 &#181;L of 10x KAPA End Repair Buffer, 1 &#181;L of KAPA End Repair Enzyme Mix, and 1.6 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>A-taling master mix</td>
			<td></td>
			<td></td>
			<td>Combine 1 &#181;L of KAPA A-Tailing Buffer, 0.6 &#181;L of KAPA A-Tailing Enzyme, and 8.4 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>Ligation buffer mix</td>
			<td></td>
			<td></td>
			<td>Combine 2 &#181;L of KAPA ligation buffer and 6 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>Real-time PCR master mix</td>
			<td></td>
			<td></td>
			<td>Combine 5 &#181;L of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 &#181;L of PCR Primer Mix (10 &#181;M each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>PCR master mix</td>
			<td></td>
			<td></td>
			<td>Combine 10 &#181;L of 2x KAPA HiFi Ready Mix, 0.9 &#181;L of PCR Primer Mix, and 0.6 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>Integrative Genomics Viewer</td>
			<td>Broad Institute</td>
			<td>IGV_2.3.88</td>
			<td>Genome browser to visualize sequencing data</td>
		</tr>
		<tr>
			<td>DNA olgionucleotide: 5&#8242;-GCCTACGCAGGTCTTGCTGAC-3&#8242;</td>
			<td>Eurofins Genomics</td>
			<td></td>
			<td>A primer to amplify the promoter region of GAPDH</td>
		</tr>
		<tr>
			<td>DNA olgionucleotide: 5&#8242;-CGAGCGCTGACCTTGAGGTC-3&#8242;</td>
			<td>Eurofins Genomics</td>
			<td></td>
			<td>A primer to amplify the promoter region of GAPDH</td>
		</tr>
		<tr>
			<td>SYBR Premix Ex Taq</td>
			<td>Takara</td>
			<td>RR420L</td>
			<td>To quantify the DNA corresponding to the GADPH promoter region</td>
		</tr>
		<tr>
			<td>Thermal Cycler Dice</td>
			<td>Takara</td>
			<td>TP870</td>
			<td>To quantify the DNA corresponding to the GADPH promoter region</td>
		</tr>
	</tbody>
</table>

tchip-seq: cell-type-specific epigenome profiling

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological functions have been extensively studied. Indeed, the advent of next-generation deep sequencing and chromatin immunoprecipitation (ChIP) via specific histone modification antibodies has revolutionized our view of epigenetic regulation across the genome. Conversely, tissues typically consist of diverse cell types, and their complex mixture poses analytic challenges to investigating the epigenome in a particular cell type. To address the cell type-specific chromatin state in a genome-wide manner, we recently developed tandem chromatin immunoprecipitation sequencing (tChIP-Seq), which is based on the selective purification of chromatin by tagged core histone proteins from cell types of interest, followed by ChIP-Seq. The goal of this protocol is the introduction of best practices of tChIP-Seq. This technique provides a versatile tool for tissue-specific epigenome investigation in diverse histone modifications and model organisms.

Here, we describe the tissue dissection, fixation, cell lysis, tandem purification of chromatin, and DNA library preparation for next-generation sequencers. During the procedures, one can test the quality of the DNA, which is the key to successful sequencing, at multiple steps (Figure 2). Since a single nucleosome is typically surrounded by 147 bp DNA 4, sheared DNA should not be shorter than that size. Immediately after ultrasonicatio...

Watch this Scientific Journal Video about TChIP-Seq: Cell-Type-Specific Epigenome Profiling at JoVE.com

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

This method can help answer key questions in the epigenetics field such as how much chromatic modifications are regulated in a cell type specific manner along with genomes. The main advantage of this technique is that we can isolate chromatin from the targeted cells and then follow typical gypsy downstream. So this method can provide insights into neuron specific trimincil, lysinc 4, opisoncilly.It can also be applied to other histone modification, other cell types, and then other model organisms. Demonstrating the procedure will be Mari Mito, a technician from my laboratory. To begin, use fine spring scissors to dissect the tissue of interest into small pieces.Add the tissue fragments to a clean container filled with liquid nitrogen. Then, transfer the tissue fragments to two milliliter tubes filled with liquid nitrogen. Store the tubes at minus 80 degrees Celsius for five minutes with the cap open to evaporate the liquid nitrogen.Place the tubes containing the tissue samples on a chilled metal ice rack. Then, place a metal bullet in a 1.5 milliliter tube and chill it with liquid nitrogen. Place the chilled metal bullet to one of the sample tubes.Close the cap and set the tube into the tube holder of a cryogenic grinder. Immediately, dip the assembled tube holder in liquid nitrogen for one minute. Insert the frozen tube holder into the outer cassette of the cryogenic grinder.And shake it vigorously for 30 seconds, 60 times. After this, disassemble the cryogenic grinder, remove the metal bullet. And place the tube into a pre-chilled sample cooler.Store the cooler at negative 20 degrees Celsius for 15 minutes. Then, add 900 microliters of 1%formaldehyde to the tube and pipette to mix. Transfer the suspension to a new two milliliter tube with 900 microliters of 1%formaldehyde.Next, fix the suspension for 10 minutes with gentle rotation at 23 degrees Celsius. To stop the fixation reaction, add 100 microliters of 2.5 molar glycine to the tube. And centrifuge at 3, 000 times gravity for five minutes at four degrees Celsius.After this, discard the super supernatant. Add one milliliter of PBS to the tube and vortex to mix. Centrifuge at 3, 000 times gravity for five minutes at four degrees Celsius.Repeat this wash step, two more times. Next, add 500 microliters of lysis buffer one to the pellet and pipette to mix. Centrifuge the tube for five minutes at 3, 000 times gravity at four degrees Celsius and discard the supernatant.Add one milliliter of lysis buffer two to the pellet and vortex to mix. Then, centrifuge the suspension for five minutes at 3, 000 times gravity at four degrees Celsius and discard the supernatant. After this, add 800 microliters of radio immunoprecipitation asssay buffer with protease inhibitor cocktail to the pellet and pipette to mix.Centrifuge the suspension for five minutes at 3, 000 times gravity at four degrees Celsius and discard the supernatant. Next, add 500 microliters of RIPA buffer with protease inhibitor cocktail to the pellet. Then, centrifuge the suspension for five minutes at 3, 000 times gravity at four degrees Celsius and discard the supernatant.Add one milliliter of RIPA buffer with protease inhibitor cocktail. Immediately after adding RIPA buffer with protease inhibitor cocktail, transfer the lysate to a sonicator tube. And place the tube on an ultrasonicator.Using the settings outlined in the text protocol, shear the chromatin. Then, transfer the sample to a 1.5 milliliter protein low binding tube. And centrifuge it for five minutes at 20, 000 times gravity at four degrees Celsius.Collect the supernatant from the sample and transfer it to a new protein low binding tube. In this protocol, tandem chromatin immunoprecipitation sequencing was introduced and demonstrated. During the procedure, the quality of the DNA was tested at multiple steps.Immediately after sonication, the sheared DNA was isolated and tested with microfluidic electrophoresis machine. After using anti-FLAG antibody and anti-H3K3me3 antibody to perform affinity purification the DNA quality was checked again. The specificity of the immune purification of DNA on H2B-FLAG was confirmed with negative control samples.Where negligible amounts of DNA were detected. Further into the protocol, the quality of the sequencing library was verified. The successful ChIP and T-ChIP were evidenced via enrichment analysis using primers targeting the promoter region of the GAPDH gene.Representative redistributions along three neuron genes were obtained. And the enrichment of reads at the five prime ends of the genes by neuron T-ChIP seek over whole brain T-ChIP seek was observed. After a stabiliment, this technique paves the way for researchers in the epigenetic field to explore cell type specific histone modification general widely in neurons in mice.Don't forget that working with formaldehyde can be extremely hazardous and to take precautions such as wearing rubber clothing and glasses should always be taken while performing this procedure.

tchip-seq-cell-type-specific-epigenome-profiling

Research

Education

JoVE Core

JoVE Journal

Cell Biology

Biology

Unit 1

Control of Gene Expression

SCIENTISTS IN ACTION

7.4K ビュー.  RIKEN. この方法は、ゲノムと共に細胞型特異的な方法でどの程度の色度修飾が調節されているかなど、エピジェネティクス分野の重要な質問に答えるのに役立ちます。この技術の主な利点は、標的細胞からクロマチンを分離し、典型的なジプシー下流に従うことができるということです。したがって、この方法は、ニューロン特異的なトリミンシル、lysinc 4、opisoncillyに関する?...

ビデオ: TChIP-Seq: Cell-Type-Specific Epigenome Profiling

Antibody Profiling by Luciferase Immunoprecipitation Systems (LIPS)

Technologies for comprehensively understanding and quantifying antibody profiles to autoantigens and infectious agents may yield new insights into disease mechanisms and may elucidate new markers to substratify disease with different clinical features and better understand pathogenesis. We have developed a highly quantitative method called Luciferase Immunoprecipitation Systems (LIPS) for profiling patient sera antibody responses to autoantigens and pathogen antigens associated with infection. Unlike ELISAs, the highly sensitive LIPS is easily implemented to survey humoral serological response profiles to different antigens in a universal format and produces dynamic antibody titer ranges up to 6 log10 for some antigens. In these studies, quantitative profiling by LIPS of patient humoral responses against panels of antigens or even the entire proteome of some pathogens (i.e. HIV), is typically more informative than testing a single antigen by ELISA. In addition, LIPS also eliminates time and effort needed to produce highly purified antigens as well as the labor-intensive assay optimization steps needed for standard ELISAs. Here we provide a detailed protocol describing the technical aspects of performing LIPS assays for readily profiling antibody responses to single or multiple antigens.

Antibody Profiling by Luciferase Immunoprecipitation Systems LIPS

The technical aspects of performing LIPS (Luciferase Immunoprecipitation Systems) are described. The overall approach involves expressing chimeric genes encoding antigens fused to Renilla luciferase (Ruc) in mammalian cells. Crude Ruc-antigen extracts are then prepared and, without purification, employed in immunoprecipitation assays to quantify antibodies.

Technologies for comprehensively understanding and quantifying antibody profiles to autoantigens and infectious agents may yield new insights into disease ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

OLIgo Mass Profiling (OLIMP) of Extracellular Polysaccharides

The direct contact of cells to the environment is mediated in many organisms by an extracellular matrix. One common aspect of extracellular matrices is that they contain complex sugar moieties in form of glycoproteins, proteoglycans, and/or polysaccharides. Examples include the extracellular matrix of humans and animal cells consisting mainly of fibrillar proteins and proteoglycans or the polysaccharide based cell walls of plants and fungi, and the proteoglycan/glycolipid based cell walls of bacteria. All these glycostructures play vital roles in cell-to-cell and cell-to-environment communication and signalling.
An extraordinary complex example of an extracellular matrix is present in the walls of higher plant cells. Their wall is made almost entirely of sugars, up to 75% dry weight, and consists of the most abundant biopolymers present on this planet. Therefore, research is conducted how to utilize these materials best as a carbon-neutral renewable resource to replace petrochemicals derived from fossil fuel. The main challenge for fuel conversion remains the recalcitrance of walls to enzymatic or chemical degradation due to the unique glycostructures present in this unique biocomposite.
Here, we present a method for the rapid and sensitive analysis of plant cell wall glycostructures. This method OLIgo Mass Profiling (OLIMP) is based the enzymatic release of oligosaccharides from wall materials facilitating specific glycosylhydrolases and subsequent analysis of the solubilized oligosaccharide mixtures using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/MS)1 (Figure 1). OLIMP requires walls of only 5000 cells for a complete analysis, can be performed on the tissue itself2, and is amenable to high-throughput analyses3. While the absolute amount of the solubilized oligosaccharides cannot be determined by OLIMP the relative abundance of the various oligosaccharide ions can be delineated from the mass spectra giving insights about the substitution-pattern of the native polysaccharide present in the wall.
OLIMP can be used to analyze a wide variety of wall polymers, limited only by the availability of specific enzymes4. For example, for the analysis of polymers present in the plant cell wall enzymes are available to analyse the hemicelluloses xyloglucan using a xyloglucanase5, 11, 12, 13, xylan using an endo-&beta;-(1-4)-xylanase 6,7, or for pectic polysaccharides using a combination of a polygalacturonase and a methylesterase 8. Furthermore, using the same principles of OLIMP glycosylhydrolase and even glycosyltransferase activities can be monitored and determined 9.

OLIgo Mass Profiling OLIMP of Extracellular Polysaccharides

A rapid way is described to gain insights into the structure of polysaccharides in an extracellular matrix. The method takes advantage of the specificity of glycosylhydrolases and the sensitivity of mass spectrometry allowing minute amounts of materials to be analyzed. This technique is adaptable to be used directly on tissue itself.

The direct contact of cells to the environment is mediated in many organisms by an extracellular matrix. One common aspect of extracellular matrices is ...

Heterokaryon Technique for Analysis of Cell Type-specific Localization

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling. These proteins display a diverse array of cellular functions including nuclear import/export of RNA and protein, transcriptional regulation, and apoptosis. Interestingly, major cellular reorganizations including cell division, differentiation and transformation, often involve such activities3,4,8,10. The detailed study of these proteins and their respective regulatory mechanisms can be challenging as the stimulation for these localization changes can be elusive, and the movements themselves can be quite dynamic and difficult to track. Studies involving cellular oncogenesis, for example, continue to benefit from understanding pathways and protein activities that differ between normal primary cells and transformed cells6,7,11,12. As many proteins show altered localization during transformation or as a result of transformation, methods to efficiently characterize these proteins and the pathways in which they participate stand to improve the understanding of oncogenesis and open new areas for drug targeting.
Here we present a method for the analysis of protein trafficking and shuttling activity between primary and transformed mammalian cells. This method combines the generation of heterokaryon fusions with fluorescence microscopy to provide a flexible protocol that can be used to detect steady-state or dynamic protein localizations. As shown in Figure 1, two separate cell types are transiently transfected with plasmid constructs bearing a fluoroprotein gene attached to the gene of interest. After expression, the cells are fused using polyethylene glycol, and protein localizations may then be imaged using a variety of methods. The protocol presented here is a fundamental approach to which specialized techniques may be added.

A flexible and efficient method for the characterization of cell type-specific protein localization and nucleocytoplasmic shuttling is described. This heterokaryon approach uses fluorescently-labeled fusion proteins to image protein localizations after cell fusion. The protocol is amenable to steady-state localizations or more dynamic determinations based on live cell imaging.

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling.  These proteins display a diverse array of ...

Single Cell Transcriptional Profiling of Adult Mouse Cardiomyocytes

While numerous studies have examined gene expression changes from homogenates of heart tissue, this prevents studying the inherent stochastic variation between cells within a tissue. Isolation of pure cardiomyocyte populations through a collagenase perfusion of mouse hearts facilitates the generation of single cell microarrays for whole transcriptome gene expression, or qPCR of specific targets using nanofluidic arrays. We describe here a procedure to examine single cell gene expression profiles of cardiomyocytes isolated from the heart. This paradigm allows for the evaluation of metrics of interest which are not reliant on the mean (for example variance between cells within a tissue) which is not possible when using conventional whole tissue workflows for the evaluation of gene expression (Figure 1). We have achieved robust amplification of the single cell transcriptome yielding micrograms of double stranded cDNA that facilitates the use of microarrays on individual cells. In the procedure we describe the use of NimbleGen arrays which were selected for their ease of use and ability to customize their design. Alternatively, a reverse transcriptase - specific target amplification (RT-STA) reaction, allows for qPCR of hundreds of targets by nanofluidic PCR. Using either of these approaches, it is possible to examine the variability of expression between cells, as well as examining expression profiles of rare cell types from within a tissue. Overall, the single cell gene expression approach allows for the generation of data that can potentially identify idiosyncratic expression profiles that are typically averaged out when examining expression of millions of cells from typical homogenates generated from whole tissues.

Single cell expression profiling allows the detailed gene expression analysis of individual cells. We describe methods for the isolation of cardiomyocytes, and preparing the resulting lysates for either whole transcriptome microarray or qPCR of specific targets.

While numerous studies have examined gene expression changes from homogenates of heart tissue, this prevents studying the inherent stochastic variation ...

Glycan Profiling of Plant Cell Wall Polymers using Microarrays

Plant cell walls are complex matrixes of heterogeneous glycans which play an important role in the physiology and development of plants and provide the raw materials for human societies (e.g. wood, paper, textile and biofuel industries)1,2. However, understanding the biosynthesis and function of these components remains challenging.
Cell wall glycans are chemically and conformationally diverse due to the complexity of their building blocks, the glycosyl residues. These form linkages at multiple positions and differ in ring structure, isomeric or anomeric configuration, and in addition, are substituted with an array of non-sugar residues. Glycan composition varies in different cell and/or tissue types or even sub-domains of a single cell wall3. Furthermore, their composition is also modified during development1, or in response to environmental cues4.
In excess of 2,000 genes have Plant cell walls are complex matrixes of heterogeneous glycans been predicted to be involved in cell wall glycan biosynthesis and modification in Arabidopsis5. However, relatively few of the biosynthetic genes have been functionally characterized 4,5. Reverse genetics approaches are difficult because the genes are often differentially expressed, often at low levels, between cell types6. Also, mutant studies are often hindered by gene redundancy or compensatory mechanisms to ensure appropriate cell wall function is maintained7. Thus novel approaches are needed to rapidly characterise the diverse range of glycan structures and to facilitate functional genomics approaches to understanding cell wall biosynthesis and modification.
Monoclonal antibodies (mAbs)8,9 have emerged as an important tool for determining glycan structure and distribution in plants. These recognise distinct epitopes present within major classes of plant cell wall glycans, including pectins, xyloglucans, xylans, mannans, glucans and arabinogalactans. Recently their use has been extended to large-scale screening experiments to determine the relative abundance of glycans in a broad range of plant and tissue types simultaneously9,10,11.
Here we present a microarray-based glycan screening method called Comprehensive Microarray Polymer Profiling (CoMPP) (Figures 1 &amp; 2)10,11 that enables multiple samples (100 sec) to be screened using a miniaturised microarray platform with reduced reagent and sample volumes. The spot signals on the microarray can be formally quantified to give semi-quantitative data about glycan epitope occurrence. This approach is well suited to tracking glycan changes in complex biological systems12 and providing a global overview of cell wall composition particularly when prior knowledge of this is unavailable.

A technique called Comprehensive Microarray Polymer Profiling (CoMPP) for the characterisation of plant cell wall glycans is described. This method combines the specificity of monoclonal antibodies directed to defined glycan-epitopes with a miniature microarray analytical platform allowing screening of glycan occurrence in a broad range of biological contexts.

Plant cell walls are complex matrixes of heterogeneous glycans which play an important role in the physiology and development of plants and provide the ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

An Easy Method for Plant Polysome Profiling

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the analysis of translational regulation. The method described here is an easy and economical way for fractionating polysomes from various plant tissues. A sucrose gradient is made without the need for a gradient maker by sequentially freezing each layer. Cytosolic extracts are then prepared in a buffer containing cycloheximide and chloramphenicol to immobilize the cytosolic and chloroplastic ribosomes to mRNA and are loaded onto the sucrose gradient. After centrifugation, six fractions are directly collected from the bottom to the top of the gradient, without piercing the ultracentrifugation tube. During collection, the absorbance at 260 nm is read continuously to generate a polysome profile that gives a snapshot of global translational activity. Fractions are then pooled to prepare three different mRNA populations: the polysomes, mRNAs bound to several ribosomes; the monosomes, mRNAs bound to one ribosome; and mRNAs that are not bound to ribosomes. mRNAs are then extracted. This protocol has been validated for different plants and tissues including Arabidopsis thaliana seedlings and adult plants, Nicotiana benthamiana, Solanum lycopersicum, and Oryza sativa leaves.

This protocol describes an easy method to extract and fractionate transcripts from plant tissues on the basis of the number of bound ribosomes. It allows a global estimate of translation activity and the determination of the translational status of specific mRNAs.

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the ...

Cellular Redox Profiling Using High-content Microscopy

Reactive oxygen species (ROS) regulate essential cellular processes including gene expression, migration, differentiation and proliferation. However, excessive ROS levels induce a state of oxidative stress, which is accompanied by irreversible oxidative damage to DNA, lipids and proteins. Thus, quantification of ROS provides a direct proxy for cellular health condition. Since mitochondria are among the major cellular sources and targets of ROS, joint analysis of mitochondrial function and ROS production in the same cells is crucial for better understanding the interconnection in pathophysiological conditions. Therefore, a high-content microscopy-based strategy was developed for simultaneous quantification of intracellular ROS levels, mitochondrial membrane potential (&#916;&#936;m) and mitochondrial morphology. It is based on automated widefield fluorescence microscopy and image analysis of living adherent cells, grown in multi-well plates, and stained with the cell-permeable fluorescent reporter molecules CM-H2DCFDA (ROS) and TMRM (&#916;&#936;m and mitochondrial morphology). In contrast with fluorimetry or flow-cytometry, this strategy allows quantification of subcellular parameters at the level of the individual cell with high spatiotemporal resolution, both before and after experimental stimulation. Importantly, the image-based nature of the method allows extracting morphological parameters in addition to signal intensities. The combined feature set is used for explorative and statistical multivariate data analysis to detect differences between subpopulations, cell types and/or treatments. Here, a detailed description of the assay is provided, along with an example experiment that proves its potential for unambiguous discrimination between cellular states after chemical perturbation.

This paper presents a high-content microscopy workflow for simultaneous quantification of intracellular ROS levels, as well as mitochondrial membrane potential and morphology &#8211; jointly referred to as mitochondrial morphofunction &#8211; in living adherent cells using the cell-permeant fluorescent reporter molecules 5-(and-6)-chloromethyl-2&#39;,7&#39;-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H2DCFDA) and tetramethylrhodamine methylester (TMRM).

Reactive oxygen species (ROS) regulate essential cellular processes including gene expression, migration, differentiation and proliferation. However, ...

Cell Type-specific Gene Expression Profiling in the Mouse Liver

Liver repopulation after injury is a crucial feature of mammals which prevents immediate organ failure and death after exposure of environmental toxins. A deeper understanding of the changes in gene expression that occur during repopulation could help identify therapeutic targets to promote the restoration of liver function in the setting of injuries. Nonetheless, methods to isolate specifically the repopulating hepatocytes are inhibited by a lack of cell markers, limited cell numbers, and the fragility of these cells. The development of translating ribosome affinity purification (TRAP) technology in conjunction with the Fah-/- mouse model to recapitulate repopulation in the setting of liver injury allows gene expression profiling of the repopulating hepatocytes. With TRAP, cell type-specific translating mRNA is rapidly and efficiently isolated. We developed a method that utilizes TRAP with affinity-based isolation of translating mRNA from hepatocytes that selectively express the green fluorescent protein (GFP)-tagged ribosomal protein (RP), GFP:RPL10A. TRAP circumvents the long time period required for fluorescence-activated cell sorting that could change the gene expression profile. Furthermore, since only the repopulating hepatocytes express the GFP:RPL10A fusion protein, the isolated mRNA is devoid of contamination from the surrounding injured hepatocytes and other cell types in the liver. The affinity-purified mRNA is of high quality and allows downstream PCR- or high-throughput sequencing-based analysis of gene expression.

Translating ribosome affinity purification (TRAP) enables rapid and efficient isolation of cell type-specific translating mRNA. Here, we demonstrate a method that combines hydrodynamic tail-vein injection in a mouse model of liver repopulation and TRAP to examine the expression profile of repopulating hepatocytes.

Liver repopulation after injury is a crucial feature of mammals which prevents immediate organ failure and death after exposure of environmental toxins. A ...