We thank all the members of the Iwasaki lab for critical reading of the manuscript. This work was supported in part by a Grant-in-Aid for Scientific Research on Innovative Areas (#26113005 to S.N. and JP17H05679 to S.I.); a Grant-in-Aid for Young Scientists (A) (JP17H04998 to S.I.) from the Ministry of Education, Science, Sports, and Culture of Japan (MEXT); and the Pioneering Projects &#34;Cellular Evolution&#34; and all RIKEN project &#34;Disease and Epigenome&#34; from RIKEN (to S.N. and S.I.).

All methods described herein have been approved by the safety division of RIKEN (H27-EP071) and conducted with relevant guidelines and regulations.
1. Tissue dissection
<ol>
	<li>Dissect the tissues of interest into small pieces (approximately &#60;3 mm2) using fine spring scissors. 
	Note: Larger tissue fragments take longer to freeze, and smaller pieces will carry over larger volumes of buffer, both of which may affect the results.</li>
	<li>Add the dissected tissue fragmen...

<ol>
	<li>Mito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+survey+of+epigenetic+modifications+by+tandem+chromatin+immunoprecipitation+sequencing.">Cell type-specific survey of epigenetic modifications by tandem chromatin immunoprecipitation sequencing.</a> Scientific Reports. 8 (1), 1143 (2018).</li><li>Kadota, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+binding+landscape+in+jawless+fish+with+reference+to+Hox+cluster+evolution.">CTCF binding landscape in jawless fish with reference to Hox cluster evolution.</a> Scientific Reports. 7 (1), 4957 (2017).</li><li>Jung, Y. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+sequencing+depth+in+ChIP-seq+experiments.">Impact of sequencing depth in ChIP-seq experiments.</a> Nucleic Acids Research. 42 (9), (2014).</li><li>Becker, P. B., Workman, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleosome+remodeling+and+epigenetics.">Nucleosome remodeling and epigenetics.</a> Cold Spring Harbor Perspectives in Biology. 5 (9), a017905 (2013).</li><li>Kidder, B. L., Zhao, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+library+preparation+for+next-generation+sequencing+analysis+of+genome-wide+epigenetic+and+transcriptional+landscapes+in+embryonic+stem+cells.">Efficient library preparation for next-generation sequencing analysis of genome-wide epigenetic and transcriptional landscapes in embryonic stem cells.</a> Methods in Molecular Biology. , 3-20 (2014).</li><li>Gilfillan, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limitations+and+possibilities+of+low+cell+number+ChIP-seq.">Limitations and possibilities of low cell number ChIP-seq.</a> BMC Genomics. 13, 645 (2012).</li><li>Schmidl, C., Rendeiro, A. F., Sheffield, N. C., Bock, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIPmentation:+fast,+robust,+low-input+ChIP-seq+for+histones+and+transcription+factors.">ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors.</a> Nature Methods. 12 (10), 963-965 (2015).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> Journal of Neuroscience. 34 (36), 11929-11947 (2014).</li><li>Hornstein, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligation-free+ribosome+profiling+of+cell+type-specific+translation+in+the+brain.">Ligation-free ribosome profiling of cell type-specific translation in the brain.</a> Genome Biology. 17 (1), 149 (2016).</li><li>Zhao, Y., Garcia, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+catalog+of+currently+documented+histone+modifications.">Comprehensive catalog of currently documented histone modifications.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), a025064 (2015).</li><li>Hoffman, E. A., Frey, B. L., Smith, L. M., Auble, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formaldehyde+crosslinking:+a+tool+for+the+study+of+chromatin+complexes.">Formaldehyde crosslinking: a tool for the study of chromatin complexes.</a> The Journal of Biological Chemistry. 290 (44), 26404-26411 (2015).</li></ol>

The authors have nothing to disclose.

Our protocol was optimized for the neurons of the mouse brain, in which the expression of FLAG-tagged H2B is induced by tamoxifen injection. Promoters used for H2B expression, starting tissue materials, and the amount of the tissues are pivotal parameters for successful tChIP-Seq. Thus, the optimization of these factors should be considered for each cell type of interest.
A critical step among the procedures used in this protocol is the DNA shearing to achieve a chromatin length of 100-500 bp<...

Tissues of animals consist of diverse cell types. The gene regulation in each cell defines the cell type. Chromatin modifications - DNA methylation and histone modification - underlie the cell-type specificity of gene expression. Thus, the measurement of epigenetic regulation in each cell type has been desired, but it has been a technical challenge.
To investigate the epigenetics in a particular cell type, tandem chromatin immunoprecipitation sequencing (tChIP-Seq) was recently developed (Figure 1)1. In tChIP, epitope-tagged core histone protein H2B is expressed from a cell-type-specific promoter. This feature allows the isolation of chromatins from the cells of interest, although the material starts from a mixture of various cell types. Following ChIP-Seq &#8212; chromatin purification via a modified-histone mark and next-generation deep sequencing of isolated DNA &#8212; we can monitor the epigenetic status of the targeted cell type in a genome-wide manner.
Using this technique, we recently investigated neuron-specific trimethylation of histone H3 protein at lysine 4 (H3K4me3) marks. In that study, we developed a knock-in mouse in which C-terminally FLAG-tagged H2B protein was expressed upon Cre-mediated recombination (Rosa26CAG floxed-pA H2B-FLAG). By crossing with a mouse possessing the Cre-endoplasmic reticulum (ER) gene under the control of the CamK2a promoter, the obtained mouse line induced H2B-FLAG in active neurons upon tamoxifen injection (Camk2aH2B-FLAG)1. Starting from the brain of the established mouse line, we performed tChIP-Seq with anti-H3K4me3 antibody. Since H3K4me3 marks often correspond to promoter regions, we could discover hundreds of mRNAs specifically expressed in neurons1.
Here, we describe a typical tChIP-Seq method that covers the steps from tissue dissection to library construction (Figure 1). The final goal of this protocol is to share our best practices for the performance of tChIP-Seq and the future application of this method to other cell types and histone modifications.

<table>
	<tbody>
		<tr>
			<td>Protein LoBind tube, 2 mL</td>
			<td>Eppendorf</td>
			<td>No.&#160;0030108132</td>
			<td>For cell lysis</td>
		</tr>
		<tr>
			<td>Protein LoBind tube, 1.5 mL</td>
			<td>Eppendorf</td>
			<td>No.&#160;0030108116</td>
			<td>For ChIP and library preparation</td>
		</tr>
		<tr>
			<td>DNA LoBind tube, 1.5 mL</td>
			<td>Eppendorf</td>
			<td>No.&#160;0030108051</td>
			<td>For ChIP and library preparation</td>
		</tr>
		<tr>
			<td>8-strip PCR tube</td>
			<td>BIO-BIK</td>
			<td>3247-00</td>
			<td>For ChIP and library preparation</td>
		</tr>
		<tr>
			<td>SK Mill</td>
			<td>TOKKEN</td>
			<td>SK-200</td>
			<td>Handy cryogenic grinder to make cell powder for fixation</td>
		</tr>
		<tr>
			<td>Metal bullet</td>
			<td>TOKKEN</td>
			<td>SK-100-DLC10</td>
			<td>Accessory of SK Mill</td>
		</tr>
		<tr>
			<td>2 mL stainless steel tube</td>
			<td>TOKKEN</td>
			<td>TK-AM5-SUS</td>
			<td>An option for cell lysis</td>
		</tr>
		<tr>
			<td>2 mL stainless steel tube holder</td>
			<td>TOKKEN</td>
			<td>SK-100-TL</td>
			<td>An option for cell lysis</td>
		</tr>
		<tr>
			<td>16% formaldehyde (w/v), methanol-free</td>
			<td>Pierce</td>
			<td>28906</td>
			<td>To fix cells. Prepare 1% solution before use.</td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Nacalai Tesque</td>
			<td>17109-35</td>
			<td>Prepare 2.5 M stock</td>
		</tr>
		<tr>
			<td>D-PBS (-)(1x)</td>
			<td>Nacalai Tesque</td>
			<td>14249-24</td>
			<td>For washing lysate and purified DNA</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Nacalai Tesque</td>
			<td>02443-05</td>
			<td>For Lysis buffer 1. Prepare 1 M, pH 7.5 stock.</td>
		</tr>
		<tr>
			<td>5 M NaCl, molecular biology grade</td>
			<td>Nacalai Tesque</td>
			<td>06900-14</td>
			<td>For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer</td>
		</tr>
		<tr>
			<td>0.5 M EDTA, molecular biology grade</td>
			<td>Wako Pure Chemical Industries, Ltd.</td>
			<td>311-90075</td>
			<td>For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer</td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Wako Pure Chemical Industries, Ltd.</td>
			<td>072-04945</td>
			<td>For lysis buffer 1</td>
		</tr>
		<tr>
			<td>NP-40</td>
			<td>Nacalai Tesque</td>
			<td>25223-75</td>
			<td>For lysis buffer 1</td>
		</tr>
		<tr>
			<td>Triton X-100, molecular biology grade</td>
			<td>Nacalai Tesque</td>
			<td>12967-32</td>
			<td>For Lysis buffer 1</td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>Nacalai Tesque</td>
			<td>35406-91</td>
			<td>For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock.</td>
		</tr>
		<tr>
			<td>0.1 M EGTA pH neutral</td>
			<td>Nacalai Tesque</td>
			<td>08947-35</td>
			<td>For Lysis Buffer 2</td>
		</tr>
		<tr>
			<td>Protease inhibitor cocktail (100x)</td>
			<td>Nacalai Tesque</td>
			<td>25955-24</td>
			<td>To block degradation of protein</td>
		</tr>
		<tr>
			<td>RIPA buffer</td>
			<td>Thermo Fisher Scientific</td>
			<td>89900</td>
			<td>For cell lysis and washing</td>
		</tr>
		<tr>
			<td>milliTUBE 1 mL AFA Fiber</td>
			<td>Covaris</td>
			<td>520130</td>
			<td>Sonicator tube. Accessory of Focused-ultrasonicator</td>
		</tr>
		<tr>
			<td>Focused-ultrasonicator</td>
			<td>Covaris</td>
			<td>S220 or E220</td>
			<td>To digest DNA into adequate size for ChIP-Seq</td>
		</tr>
		<tr>
			<td>UltraPure 10% SDS</td>
			<td>Thermo Fisher Scientific</td>
			<td>15553-027</td>
			<td>For ChIP Elution Buffer</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>Nacalai Tesque</td>
			<td>30141-14</td>
			<td>To purify DNA from lysate</td>
		</tr>
		<tr>
			<td>Proteinase K, recombinant, PCR Grade</td>
			<td>Sigma-Aldrich</td>
			<td>3115887001</td>
			<td>To purify DNA from lysate</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Wako Pure Chemical Industries, Ltd.</td>
			<td>054-07225</td>
			<td>Make 70% solution</td>
		</tr>
		<tr>
			<td>Monoclonal anti-FLAG M2 antibody produced in mouse</td>
			<td>Sigma-Aldrich</td>
			<td>F1804</td>
			<td>To purify chromatin expressed in cells of interest</td>
		</tr>
		<tr>
			<td>Dynabead M-280 Sheep Anti-Mouse IgG</td>
			<td>Thermo Fisher Scientific</td>
			<td>11201D</td>
			<td>This can be used for anti-FLAG IP and anti-H3K4me3 IP</td>
		</tr>
		<tr>
			<td>Anti-tri-methyl histone H3 (K4), mouse monoclonal antibody</td>
			<td>Wako Pure Chemical Industries, Ltd.</td>
			<td>301-34811</td>
			<td>Any other antibody that works for ChIP analysis will work</td>
		</tr>
		<tr>
			<td>10x Blocking Reagent</td>
			<td>Sigma-Aldrich</td>
			<td>11096176001</td>
			<td>For blocking during affinity purification</td>
		</tr>
		<tr>
			<td>Denhardt&#8217;s solution</td>
			<td>Nacalai Tesque</td>
			<td>10727-74</td>
			<td>For blocking during affinity purification</td>
		</tr>
		<tr>
			<td>Glycogen (5 mg/ml)</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM9510</td>
			<td>To purify DNA from lysate</td>
		</tr>
		<tr>
			<td>Qubit 2.0 Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q32866</td>
			<td>For quantification of isolated DNA</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS Assay Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q32851</td>
			<td>For quantification of isolated DNA</td>
		</tr>
		<tr>
			<td>0.5 mL tube</td>
			<td>Axygen</td>
			<td>10011-830</td>
			<td>For quantification by Qubit</td>
		</tr>
		<tr>
			<td>Phenol/chloroform/isoamyl alcohol (25:24:1)</td>
			<td>Nacalai Tesque</td>
			<td>25970-56</td>
			<td>To purify DNA from lysate</td>
		</tr>
		<tr>
			<td>AMPure XP beads</td>
			<td>Beckman Coulter</td>
			<td>A63881</td>
			<td>SPRI magnetic beads for library preparation</td>
		</tr>
		<tr>
			<td>Metal ice rack</td>
			<td>Funakoshi</td>
			<td>IR-1</td>
			<td>To keep the cell lysate frozen</td>
		</tr>
		<tr>
			<td>Sample Cooler</td>
			<td>New England Biolabs</td>
			<td>T7771S</td>
			<td>Helps fix cells with minimal damage</td>
		</tr>
		<tr>
			<td>2100 Bioanalyzer</td>
			<td>Agilent Technologies</td>
			<td>G2939BA</td>
			<td>To check the quality of isolated DNA fragments. Another fragment analyzer can be used.</td>
		</tr>
		<tr>
			<td>Bioanalyzer 2100 Expert Software</td>
			<td>Agilent Technologies</td>
			<td>G2946CA</td>
			<td>Supplied with the Bioanalyzer</td>
		</tr>
		<tr>
			<td>High Sensitivity DNA Kit</td>
			<td>Agilent Technologies</td>
			<td>5067-4626</td>
			<td>To check the quality of the isolated DNA fragments</td>
		</tr>
		<tr>
			<td>KAPA LTP Library Preparation Kit</td>
			<td>Roche</td>
			<td>07961898001</td>
			<td>Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution</td>
		</tr>
		<tr>
			<td>NEXTflex DNA Barcodes</td>
			<td>BIOO Scientific</td>
			<td>NOVA-514101</td>
			<td>Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix.</td>
		</tr>
		<tr>
			<td>KAPA Real-Time Library Amplification Kit</td>
			<td>Roche</td>
			<td>07959028001</td>
			<td>Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards</td>
		</tr>
		<tr>
			<td>2x KAPA HiFi HotStart ReadyMix</td>
			<td>Roche</td>
			<td>KM2602</td>
			<td>For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit</td>
		</tr>
		<tr>
			<td>Buffer EB</td>
			<td>Qiagen</td>
			<td>19086</td>
			<td>10 mM Tris-Cl, pH 8.5 for elution of DNA</td>
		</tr>
		<tr>
			<td>386-well qPCR plate</td>
			<td>Thermo Fisher Scientific</td>
			<td>4309849</td>
			<td>For real-time PCR</td>
		</tr>
		<tr>
			<td>QuantStudio 7 Flex Real-Time PCR System</td>
			<td>Thermo Fisher Scientific</td>
			<td>4485701</td>
			<td>To quantify DNA</td>
		</tr>
		<tr>
			<td>MicroAmp Optical Adhesive Film</td>
			<td>Thermo Fisher Scientific</td>
			<td>4311971</td>
			<td>For real-time PCR</td>
		</tr>
		<tr>
			<td>MicroAmp Clear Adhesive Film</td>
			<td>Thermo Fisher Scientific</td>
			<td>4306311</td>
			<td>For plate sealing</td>
		</tr>
		<tr>
			<td>End-repair master mix</td>
			<td></td>
			<td></td>
			<td>Combine 1.4 &#181;L of 10x KAPA End Repair Buffer, 1 &#181;L of KAPA End Repair Enzyme Mix, and 1.6 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>A-taling master mix</td>
			<td></td>
			<td></td>
			<td>Combine 1 &#181;L of KAPA A-Tailing Buffer, 0.6 &#181;L of KAPA A-Tailing Enzyme, and 8.4 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>Ligation buffer mix</td>
			<td></td>
			<td></td>
			<td>Combine 2 &#181;L of KAPA ligation buffer and 6 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>Real-time PCR master mix</td>
			<td></td>
			<td></td>
			<td>Combine 5 &#181;L of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 &#181;L of PCR Primer Mix (10 &#181;M each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>PCR master mix</td>
			<td></td>
			<td></td>
			<td>Combine 10 &#181;L of 2x KAPA HiFi Ready Mix, 0.9 &#181;L of PCR Primer Mix, and 0.6 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>Integrative Genomics Viewer</td>
			<td>Broad Institute</td>
			<td>IGV_2.3.88</td>
			<td>Genome browser to visualize sequencing data</td>
		</tr>
		<tr>
			<td>DNA olgionucleotide: 5&#8242;-GCCTACGCAGGTCTTGCTGAC-3&#8242;</td>
			<td>Eurofins Genomics</td>
			<td></td>
			<td>A primer to amplify the promoter region of GAPDH</td>
		</tr>
		<tr>
			<td>DNA olgionucleotide: 5&#8242;-CGAGCGCTGACCTTGAGGTC-3&#8242;</td>
			<td>Eurofins Genomics</td>
			<td></td>
			<td>A primer to amplify the promoter region of GAPDH</td>
		</tr>
		<tr>
			<td>SYBR Premix Ex Taq</td>
			<td>Takara</td>
			<td>RR420L</td>
			<td>To quantify the DNA corresponding to the GADPH promoter region</td>
		</tr>
		<tr>
			<td>Thermal Cycler Dice</td>
			<td>Takara</td>
			<td>TP870</td>
			<td>To quantify the DNA corresponding to the GADPH promoter region</td>
		</tr>
	</tbody>
</table>

tchip-seq: cell-type-specific epigenome profiling

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological functions have been extensively studied. Indeed, the advent of next-generation deep sequencing and chromatin immunoprecipitation (ChIP) via specific histone modification antibodies has revolutionized our view of epigenetic regulation across the genome. Conversely, tissues typically consist of diverse cell types, and their complex mixture poses analytic challenges to investigating the epigenome in a particular cell type. To address the cell type-specific chromatin state in a genome-wide manner, we recently developed tandem chromatin immunoprecipitation sequencing (tChIP-Seq), which is based on the selective purification of chromatin by tagged core histone proteins from cell types of interest, followed by ChIP-Seq. The goal of this protocol is the introduction of best practices of tChIP-Seq. This technique provides a versatile tool for tissue-specific epigenome investigation in diverse histone modifications and model organisms.

Here, we describe the tissue dissection, fixation, cell lysis, tandem purification of chromatin, and DNA library preparation for next-generation sequencers. During the procedures, one can test the quality of the DNA, which is the key to successful sequencing, at multiple steps (Figure 2). Since a single nucleosome is typically surrounded by 147 bp DNA 4, sheared DNA should not be shorter than that size. Immediately after ultrasonicatio...

Watch this Scientific Journal Video about TChIP-Seq: Cell-Type-Specific Epigenome Profiling at JoVE.com

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

This method can help answer key questions in the epigenetics field such as how much chromatic modifications are regulated in a cell type specific manner along with genomes. The main advantage of this technique is that we can isolate chromatin from the targeted cells and then follow typical gypsy downstream. So this method can provide insights into neuron specific trimincil, lysinc 4, opisoncilly.It can also be applied to other histone modification, other cell types, and then other model organisms. Demonstrating the procedure will be Mari Mito, a technician from my laboratory. To begin, use fine spring scissors to dissect the tissue of interest into small pieces.Add the tissue fragments to a clean container filled with liquid nitrogen. Then, transfer the tissue fragments to two milliliter tubes filled with liquid nitrogen. Store the tubes at minus 80 degrees Celsius for five minutes with the cap open to evaporate the liquid nitrogen.Place the tubes containing the tissue samples on a chilled metal ice rack. Then, place a metal bullet in a 1.5 milliliter tube and chill it with liquid nitrogen. Place the chilled metal bullet to one of the sample tubes.Close the cap and set the tube into the tube holder of a cryogenic grinder. Immediately, dip the assembled tube holder in liquid nitrogen for one minute. Insert the frozen tube holder into the outer cassette of the cryogenic grinder.And shake it vigorously for 30 seconds, 60 times. After this, disassemble the cryogenic grinder, remove the metal bullet. And place the tube into a pre-chilled sample cooler.Store the cooler at negative 20 degrees Celsius for 15 minutes. Then, add 900 microliters of 1%formaldehyde to the tube and pipette to mix. Transfer the suspension to a new two milliliter tube with 900 microliters of 1%formaldehyde.Next, fix the suspension for 10 minutes with gentle rotation at 23 degrees Celsius. To stop the fixation reaction, add 100 microliters of 2.5 molar glycine to the tube. And centrifuge at 3, 000 times gravity for five minutes at four degrees Celsius.After this, discard the super supernatant. Add one milliliter of PBS to the tube and vortex to mix. Centrifuge at 3, 000 times gravity for five minutes at four degrees Celsius.Repeat this wash step, two more times. Next, add 500 microliters of lysis buffer one to the pellet and pipette to mix. Centrifuge the tube for five minutes at 3, 000 times gravity at four degrees Celsius and discard the supernatant.Add one milliliter of lysis buffer two to the pellet and vortex to mix. Then, centrifuge the suspension for five minutes at 3, 000 times gravity at four degrees Celsius and discard the supernatant. After this, add 800 microliters of radio immunoprecipitation asssay buffer with protease inhibitor cocktail to the pellet and pipette to mix.Centrifuge the suspension for five minutes at 3, 000 times gravity at four degrees Celsius and discard the supernatant. Next, add 500 microliters of RIPA buffer with protease inhibitor cocktail to the pellet. Then, centrifuge the suspension for five minutes at 3, 000 times gravity at four degrees Celsius and discard the supernatant.Add one milliliter of RIPA buffer with protease inhibitor cocktail. Immediately after adding RIPA buffer with protease inhibitor cocktail, transfer the lysate to a sonicator tube. And place the tube on an ultrasonicator.Using the settings outlined in the text protocol, shear the chromatin. Then, transfer the sample to a 1.5 milliliter protein low binding tube. And centrifuge it for five minutes at 20, 000 times gravity at four degrees Celsius.Collect the supernatant from the sample and transfer it to a new protein low binding tube. In this protocol, tandem chromatin immunoprecipitation sequencing was introduced and demonstrated. During the procedure, the quality of the DNA was tested at multiple steps.Immediately after sonication, the sheared DNA was isolated and tested with microfluidic electrophoresis machine. After using anti-FLAG antibody and anti-H3K3me3 antibody to perform affinity purification the DNA quality was checked again. The specificity of the immune purification of DNA on H2B-FLAG was confirmed with negative control samples.Where negligible amounts of DNA were detected. Further into the protocol, the quality of the sequencing library was verified. The successful ChIP and T-ChIP were evidenced via enrichment analysis using primers targeting the promoter region of the GAPDH gene.Representative redistributions along three neuron genes were obtained. And the enrichment of reads at the five prime ends of the genes by neuron T-ChIP seek over whole brain T-ChIP seek was observed. After a stabiliment, this technique paves the way for researchers in the epigenetic field to explore cell type specific histone modification general widely in neurons in mice.Don't forget that working with formaldehyde can be extremely hazardous and to take precautions such as wearing rubber clothing and glasses should always be taken while performing this procedure.

tchip-seq-cell-type-specific-epigenome-profiling

Research

Education

JoVE Core

JoVE Journal

Cell Biology

Biology

Unit 1

Control of Gene Expression

SCIENTISTS IN ACTION

7.4K 조회수.  RIKEN. 이 방법은 게놈과 더불어 세포 모형 특정 방식으로 얼마나 많은 색채 수정이 통제되는지와 같은 후성 유전학 필드에 있는 중요한 질문에 대답하는 것을 도울 수 있습니다. 이 기술의 주요 장점은 우리가 표적 세포에서 크롬토닌을 분리한 다음 전형적인 집시 다운스트림을 따를 수 있다는 것입니다. 그래서이 방법은 뉴런 특정 트리밍실에 대한 통찰력을 제공 할 수 있습니다, ...