We thank all the members of the Iwasaki lab for critical reading of the manuscript. This work was supported in part by a Grant-in-Aid for Scientific Research on Innovative Areas (#26113005 to S.N. and JP17H05679 to S.I.); a Grant-in-Aid for Young Scientists (A) (JP17H04998 to S.I.) from the Ministry of Education, Science, Sports, and Culture of Japan (MEXT); and the Pioneering Projects &#34;Cellular Evolution&#34; and all RIKEN project &#34;Disease and Epigenome&#34; from RIKEN (to S.N. and S.I.).

All methods described herein have been approved by the safety division of RIKEN (H27-EP071) and conducted with relevant guidelines and regulations.
1. Tissue dissection
<ol>
	<li>Dissect the tissues of interest into small pieces (approximately &#60;3 mm2) using fine spring scissors. 
	Note: Larger tissue fragments take longer to freeze, and smaller pieces will carry over larger volumes of buffer, both of which may affect the results.</li>
	<li>Add the dissected tissue fragments to a clean container filled with liquid nitrogen and collect them into 2 mL tubes (1 piece per tube) filled with liquid nitrogen. 
	Note: Tubes with a hydrophilic surface are recommended for this step.</li>
	<li>Place the tubes at -80 &#176;C for &#62; 5 min with the cap open to evaporate the remaining liquid nitrogen. 
	Note: After closing the cap, tissue fragments can be stored at -80 &#176;C for one month before use.</li>
</ol>
2. Cell fixation
Note: We used a handy cryogenic grinder for this step. An alternative apparatus can be used.
<ol>
	<li>Place the 2 mL-protein low binding tubes containing the tissue samples on a metal ice rack chilled in liquid nitrogen.</li>
	<li>Place a metal bullet in a 1.5 mL-tube and chill with liquid nitrogen. Place it on the metal ice rack.</li>
	<li>Open the 2 mL-tube and place the prechilled metal bullet into the tube. Close the cap, set the 2 mL-tubes into the tube holder of a handy cryogenic grinder, and immediately dip the assembled tube holder in liquid nitrogen for 1 min.</li>
	<li>Insert the frozen tube holder into the outer cassette of the handy cryogenic grinder and shake vigorously 60 times for 30 s.</li>
	<li>Disassemble the tube holder, remove the metal bullet, and place the 2 mL-tube on a sample cooler prechilled at -20 &#176;C.</li>
	<li>Place the sample cooler at -20 &#176;C for 15 min to prevent freezing of the fixative in the next step.</li>
	<li>Bring the sample cooler to the bench, open the lid of the tube, and immediately drip 900 &#181;L of 1% formaldehyde into it. After pipetting several times, transfer the suspension into new 2 mL-tube containing 900 &#181;L of 1% formaldehyde and fix for 10 min with gentle rotation in an incubator set at 23 &#176;C. 
	CAUTION: Formaldehyde is toxic and harmful.</li>
	<li>To stop the fixation reaction, add 100 &#181;L of 2.5 M glycine to each tube and centrifuge for 5 min at 3,000 x g at 4 &#176;C. Discard the supernatant.</li>
	<li>Add 1 mL of ice-cold phosphate-buffered saline (PBS), centrifuge for 5 min at 3,000 x g at 4 &#176;C, and discard the supernatant. Repeat this step twice (3 washes in total). 
	Note: Fixed samples can be flash-frozen by liquid nitrogen and stored at -80 &#176;C.</li>
	<li>Add 500 &#181;L of Lysis Buffer 1 (50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-KOH (pH 7.5), 140 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA) (pH 8.0), 10% w/v glycerol, 0.5% w/v NP-40, 0.25% w/v Triton X-100, and 0.1x protease inhibitor cocktail) to the pellet, pipet several times, and rotate for 10 min at 4 &#176;C. 
	NOTE: Lysis Buffer 1 should be filtered and stored at 4 &#176;C before use.</li>
	<li>Centrifuge for 5 min at 3,000 x g at 4 &#176;C and discard the supernatant.</li>
	<li>Add 1 mL of Lysis Buffer 2 (10 mM Tris-HCl (pH 8.0), 200 mM NaCl, 1 mM EDTA (pH 8.0), 0.5 mM EGTA, and 0.1x protease inhibitor cocktail) to the pellet, vortex, and rotate for 10 min at 4 &#176;C. 
	NOTE: Lysis Buffer 2 should be filtered and stored at 4 &#176;C before use.</li>
	<li>Centrifuge for 5 min at 3,000 x g at 4 &#176;C and discard the supernatant.</li>
	<li>Add 800 &#181;L of radioimmunoprecipitation assay (RIPA) buffer with 1x protease inhibitor cocktail to the pellet and resuspend the pellet by pipetting.</li>
	<li>Centrifuge for 5 min at 3,000 x g at 4 &#176;C and discard the supernatant.</li>
	<li>Add 500 &#181;L of RIPA buffer with 1x protease inhibitor cocktail.</li>
	<li>Centrifuge for 5 min at 3,000 x g at 4 &#176;C and discard the supernatant.</li>
	<li>Add 1 mL of RIPA buffer with 1x protease inhibitor cocktail. Immediately proceed to the next step.</li>
</ol>
3. Chromatin Shearing
<ol>
	<li>Transfer the lysate to a sonicator tube and then place the tube on an ultrasonicator.</li>
	<li>Shear the chromatin with the following settings: temperature: 4 &#176;C; peak incident power: 175 W; duty factor: 10%; cycles/burst: 200; and time: 2,400 s.</li>
	<li>Transfer the sample to a 1.5 mL-protein low binding tube and centrifuge for 5 min at 20,000 x g at 4 &#176;C.</li>
	<li>Collect the supernatant into a new protein low binding tube. 
	Note: The sample can be flash-frozen in liquid nitrogen and stored at -80 &#176;C.</li>
</ol>
4. Quality check of DNA (Reverse Crosslinking)
<ol>
	<li>Mix 20 &#181;L of the lysate and 180 &#181;L of ChIP Elution Buffer (10 mM Tris-HCl (pH 8.0), 300 mM NaCl, 5 mM EDTA (pH 8.0), and 1% w/v sodium dodecyl sulfate (SDS)) in a polymerase chain reaction (PCR) tube. Incubate the sample at 65 &#176;C in a thermal cycler for 6 h with the thermal cycler lid open. Keep the lid of the thermal cycler open to avoid over-denaturation. 
	Note: The ChIP Elution Buffer should be filtered and stored at room temperature before use. This incubation can be extended to overnight.</li>
	<li>Add 1 &#181;L of 10 mg/mL RNase A, vortex, and incubate at 37 &#176;C for 30 min.</li>
	<li>Add 6.5 &#181;L of 15 mg/mL proteinase K, vortex, and incubate at 55 &#176;C for 60 min.</li>
	<li>Transfer the reaction to a DNA low binding tube, add 4 &#181;L of 5 mg/mL glycogen, and vortex. Then, add 200 &#181;L of phenol/chloroform/isoamyl alcohol (25:24:1) and centrifuge for 5 min at 18,000 x g at room temperature.</li>
	<li>Transfer the supernatant to a new DNA low binding tube. Add 200 &#181;L of Tris-EDTA-NaCl buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH 8.0), and 200 mM NaCl) to the remaining phenol/chloroform/isoamyl alcohol solution and centrifuge for 5 min at 18,000 x g at room temperature. Collect the supernatant and mix with the first supernatant.</li>
	<li>Add 900 &#181;L of ice-cold ethanol and incubate for 1 h at -20 &#176;C. 
	Note: This incubation can be extended to 4- 6 h.</li>
	<li>Centrifuge for 30 min at 18,000 x g at 4 &#176;C.</li>
	<li>Discard the supernatant. Add 1 mL of ice-cold 75% ethanol to the pellet and centrifuge for 30 min at 18,000 x g at 4 &#176;C. Repeat this step (two washes in total).</li>
	<li>Discard the supernatant thoroughly and air-dry for 1 min at room temperature.</li>
	<li>Add 50 &#181;L of Tris-EDTA (TE) buffer and dissolve the DNA by incubating it at room temperature for 30 min or at 4 &#176;C overnight. Avoid vortexing or pipetting. Keep this DNA as &#8220;input&#8221; and use it for library preparation if necessary.</li>
	<li>Measure the DNA concentration with a fluorometer according to the manufacturer&#8217;s instruction (see Table of Materials) and check the size distribution with a microfluidic electrophoresis machine (see representative data shown in Figure 2A). Use 10 ng or less DNA for this assay. 
	Note: Fragments of 100&#8211;500 base pairs (bp) should make up 50% or more of the DNA.</li>
</ol>
5. Affinity purification by anti-FLAG antibody
Note: For neuron tChIP-Seq, brain tissues from 8 mice are typically used for one sample of tChIP-Seq to prepare 2 ng of purified DNA by tandem immune-purification (see Step 7.1). In our hands, 0.1 ng of DNA still provided high-quality DNA libraries for ChIP-Seq (Kadota, unpublished). Thus, in theory, a single mouse may be sufficient to perform neuron tChIP-Seq. The required amount should be optimized for the tissue and cell type of interest. For the negative control of the imumuno-purification experiment, brain tissue lysate from mice without any H2B-FLAG expression should be prepared and used.
<ol>
	<li>Pipette 200 &#181;L of the magnetic beads conjugated to sheep anti-mouse immunoglobulin G (IgG) into a protein low binding tube.</li>
	<li>Place the tube onto a magnetic stand and wait for 1 min for the supernatant to become clear. Discard the supernatant, add 1 mL of ice-cold PBS, and vortex. Repeat this step (two washes in total).</li>
	<li>Add 20 &#181;L of 1 mg/mL anti-FLAG antibody and rotate for 5 h at 4 &#176;C. 
	Note: This incubation can be extended to overnight.</li>
	<li>Wash the beads following Step 5.2. Place the beads into a 15-mL tube.</li>
	<li>Resuspend the beads in 1110 &#181;L of RIPA buffer and then add 900 &#181;L of 10x blocking reagent, 180 &#181;L of 50x Denhardt&#8217;s solution, 10 &#181;L of 100x protease inhibitor cocktail, and 6.8 mL of the lysate prepared in Step 3. Split this mixture into 5 protein low binding tubes. Rotate for 6 h at 4 &#176;C. 
	Note: This incubation can be extended to overnight.</li>
	<li>Place the tube onto the magnetic stand and wait for 1 min for the supernatant to become clear. Discard the supernatant, add 1 mL of RIPA buffer, and gently mix. Repeat this step 5 times (6 washes in total). Pool all the beads into a single protein low binding tube.</li>
	<li>Add 200 &#181;L of ChIP Elution Buffer and rotate for 15 min at room temperature. Check the quality of the DNA as described in Step 4.11 (see representative data shown in Figure 2B and C). Immediately proceed to the next step.</li>
</ol>
6. Affinity Purification by Anti-H3K4me3 Antibody and Reverse Crosslinking
Note: The following bead preparation Steps (6.1&#8211;6.4) should be performed before Step 5.7.
<ol>
	<li>Pipette 40 &#181;L of magnetic beads conjugated to sheep anti-mouse IgG into a 2 mL-protein low binding tube.</li>
	<li>Place the tube onto the magnetic stand and wait for 1 min for the supernatant to become clear. Discard the supernatant, add 1 mL of ice-cold PBS, and gently mix. Repeat this step (two washes in total).</li>
	<li>Add 4 &#181;L of 1 mg/mL anti-H3K4me3 antibody and rotate for 6 h at 4 &#176;C.</li>
	<li>Wash the beads following Step 6.2. Place the beads into a 2 mL-protein low binding tube.</li>
	<li>Resuspend the beads in 1558 &#181;L of RIPA buffer and then add 200 &#181;L of 10x blocking reagent, 40 &#181;L of 50x Denhardt&#8217;s solution, 2 &#181;L of 100x protease inhibitor cocktail, and 200 &#181;L of the eluate prepared in Step 5.7. Rotate overnight at 4 &#176;C. 
	Note: The SDS in the ChIP elution buffer was diluted more than 10 times in this incubation.</li>
	<li>Place the tube onto the magnetic stand and wait for 1 min for the supernatant to become clear. Discard the supernatant, add 1 mL of RIPA buffer, and gently mix. Repeat this step 4 times (5 washes in total). After the last wash, transfer the beads into a DNA low binding tube, and discard the supernatant.</li>
	<li>Add 200 &#181;L of ChIP Elution Buffer and rotate for 15 min at room temperature. Transfer the eluate to a new DNA low bindingTube. 
	Note: The eluate can be stored at -80 &#176;C.</li>
	<li>Follow Step 4 for decrosslinking of the DNA. Resuspend the purified DNA in 20 &#181;L of TE buffer.</li>
	<li>Check the quality of the DNA as described in Step 4.11 (see representative data shown in Figure 2D). (optional) Perform enrichment analysis by quantitative PCR as described previously2. Ten-fold or greater enrichment should be observed.</li>
</ol>
7. Library Construction
<ol>
	<li>For each input and ChIP DNA sample, calculate the proportion of DNA in the 100&#8211;500-bp region using the smear analysis function of the software for the microfluidic electrophoresis machine. Estimate the sample volume required to obtain 2 ng of 100&#8211;500 bp DNA. Use 20 ng DNA in the 100&#8211;500-bp range as the &#8220;input&#8221; sample.</li>
	<li>Pipette DNA samples into 8-strip PCR tubes and add H2O to bring the total volume to 10 &#181;L. (optional) If the volume of DNA exceeds 10 &#181;L, proportionally scale-up the following end-repair reaction and the size selection.</li>
	<li>Prepare end-repair master mix (see Table of Materials). Add 4 &#181;L of end-repair master mix to the DNA and incubate for 30 min at 20 &#176;C.</li>
	<li>Add 36 &#181;L of 10 mM Tris-Cl, pH 8.5 and 0.6x volume (30 &#181;L) of solid phase reversible immobilization (SPRI) magnetic beads and incubate for 5 min at room temperature.</li>
	<li>Place the tube on a magnetic stand and wait until the supernatant becomes clear.</li>
	<li>Transfer the supernatant to a new tube, add 1.2x volumes (60 &#181;L) of SPRI magnetic beads, and incubate 5 min at room temperature.</li>
	<li>Place the tube on a magnetic stand and wait until the supernatant becomes clear.</li>
	<li>Wash the beads twice with 200 &#181;L of 80% EtOH, holding the tube still on the magnet.</li>
	<li>Briefly centrifuge the tube to collect the residual EtOH at the bottom and place it back on the magnet. Remove the residual EtOH thoroughly.</li>
	<li>Leave the tube lid open for 1-2 min to allow the EtOH to evaporate.</li>
	<li>Close the lid and keep the tube on ice. 
	Note: Now you have obtained size-selected DNA of 100&#8211;500 bp on the beads. Further details about double size selection can be found on the manufacturer&#8217;s website (www.beckman.com).</li>
	<li>Prepare A-tailing master mix (see Table of Materials).</li>
	<li>Resuspend the beads (from Step 7.10) with 10 &#181;L of A-tailing master mix and incubate for 30 min at 30 &#176;C.</li>
	<li>Add 1.8x volume (18 &#181;L) of polyethylene glycol (PEG)/NaCl solution and incubate for 5 min at room temperature.</li>
	<li>Follow Steps 7.7-7.11 to purify the DNA.</li>
	<li>Prepare ligation buffer mix (see Table of Materials).</li>
	<li>Pipette 8 &#181;L of ligation buffer mix onto the beads (from Step 7.14), add 1 &#181;L of 1 &#181;M adapter, and resuspend the beads. Use 1 &#181;L of 5 &#181;M adapter for the input sample. Consider using different adapters for each sample for multiplexing.</li>
	<li>Add 1 &#181;L of DNA Ligase and incubate for 15 min at 20 &#176;C.</li>
	<li>Add 1.0x volume (10 &#181;L) of PEG/NaCl solution, resuspend the beads, and incubate for 5 min at room temperature.</li>
	<li>Follow Steps 7.7-7.10 to purify the DNA.</li>
	<li>Pipette 25 &#181;L of 10 mM Tris-Cl, pH 8.5 into the tube and resuspend the beads.</li>
	<li>Add 1.0x volume (25 &#181;L) of PEG/NaCl solution and incubate for 5 min at room temperature.</li>
	<li>Follow Steps 7.7-7.10 to purify the DNA.</li>
	<li>Pipette 11 &#181;L of 10 mM Tris-Cl, pH 8.5 into the tube and resuspend the beads.</li>
	<li>Place the tube on a magnetic stand and wait until the supernatant becomes clear.</li>
	<li>Collect the supernatant into a new 8-strip PCR tube.</li>
	<li>Prepare real-time PCR master mix (see Materials for details).</li>
	<li>Pipette 8.5 &#181;L of real-time PCR master mix in a 384-well quantitative PCR (qPCR) plate and add 1.5 &#181;L of the adapter ligated DNA (from Step 7.26).</li>
	<li>Pipette 10 &#181;L of each fluorescent standard in empty wells.</li>
	<li>Perform real-time PCR with the following programm: (98 &#176;C for 45 s) x 1 cycle, (98 &#176;C for 15 s, 60 &#176;C for 30 s, 72 &#176;C for 30 s) x 20 cycles, and (72 &#176;C for 60 s) x 1 cycle.</li>
	<li>Determine the number of PCR cycles needed to reach the fluorescence intensity of the Fluorescent Standard 2.</li>
	<li>Prepare the PCR master mix (see Table of Materials).</li>
	<li>Pipette 11.5 &#181;L of the PCR master mix into the remaining adapter-ligated DNA (from Step 7.26) and perform PCR as indicated in Step 7.30 with the PCR cycles determined in Step 7.31.</li>
	<li>Add 1.0x volume (20 &#181;L) of PEG/NaCl solution and incubate for 5 min at room temperature.</li>
	<li>Follow Steps 7.7-7.10 to purify the DNA.</li>
	<li>Pipette 20 &#181;L of 10 mM Tris-Cl, pH 8.5 into the tube and resuspend the beads.</li>
	<li>Place the tube on a magnetic stand and wait until the supernatant becomes clear.</li>
	<li>Collect the supernatant into a new 1.5 mL-DNA low binding tube.</li>
	<li>Check the quality of the library as described in Step 4.11 (see representative data shown in Figure 2E and F). Use 1 &#181;L of the library DNA sample. (optional) Perform enrichment analysis by qPCR as described previously 2. Ten-fold or greater enrichment should be observed.</li>
</ol>
8. Sequencing
<ol>
	<li>Sequence the libraries in a next-generation sequencer (see representative data shown in Figure 3). 
	Note: The sequence depth sufficient for the data analysis will vary depending on the genome size of the organism3. For human and mouse, we recommend obtaining at least 20-40 million single-end reads. According to the yield of reads, multiplexing might be cost effective.</li>
</ol>

<ol>
	<li>Mito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+survey+of+epigenetic+modifications+by+tandem+chromatin+immunoprecipitation+sequencing.">Cell type-specific survey of epigenetic modifications by tandem chromatin immunoprecipitation sequencing.</a> Scientific Reports. 8 (1), 1143 (2018).</li><li>Kadota, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+binding+landscape+in+jawless+fish+with+reference+to+Hox+cluster+evolution.">CTCF binding landscape in jawless fish with reference to Hox cluster evolution.</a> Scientific Reports. 7 (1), 4957 (2017).</li><li>Jung, Y. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+sequencing+depth+in+ChIP-seq+experiments.">Impact of sequencing depth in ChIP-seq experiments.</a> Nucleic Acids Research. 42 (9), (2014).</li><li>Becker, P. B., Workman, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleosome+remodeling+and+epigenetics.">Nucleosome remodeling and epigenetics.</a> Cold Spring Harbor Perspectives in Biology. 5 (9), a017905 (2013).</li><li>Kidder, B. L., Zhao, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+library+preparation+for+next-generation+sequencing+analysis+of+genome-wide+epigenetic+and+transcriptional+landscapes+in+embryonic+stem+cells.">Efficient library preparation for next-generation sequencing analysis of genome-wide epigenetic and transcriptional landscapes in embryonic stem cells.</a> Methods in Molecular Biology. , 3-20 (2014).</li><li>Gilfillan, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limitations+and+possibilities+of+low+cell+number+ChIP-seq.">Limitations and possibilities of low cell number ChIP-seq.</a> BMC Genomics. 13, 645 (2012).</li><li>Schmidl, C., Rendeiro, A. F., Sheffield, N. C., Bock, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIPmentation:+fast,+robust,+low-input+ChIP-seq+for+histones+and+transcription+factors.">ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors.</a> Nature Methods. 12 (10), 963-965 (2015).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> Journal of Neuroscience. 34 (36), 11929-11947 (2014).</li><li>Hornstein, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligation-free+ribosome+profiling+of+cell+type-specific+translation+in+the+brain.">Ligation-free ribosome profiling of cell type-specific translation in the brain.</a> Genome Biology. 17 (1), 149 (2016).</li><li>Zhao, Y., Garcia, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+catalog+of+currently+documented+histone+modifications.">Comprehensive catalog of currently documented histone modifications.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), a025064 (2015).</li><li>Hoffman, E. A., Frey, B. L., Smith, L. M., Auble, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formaldehyde+crosslinking:+a+tool+for+the+study+of+chromatin+complexes.">Formaldehyde crosslinking: a tool for the study of chromatin complexes.</a> The Journal of Biological Chemistry. 290 (44), 26404-26411 (2015).</li></ol>

The authors have nothing to disclose.

Our protocol was optimized for the neurons of the mouse brain, in which the expression of FLAG-tagged H2B is induced by tamoxifen injection. Promoters used for H2B expression, starting tissue materials, and the amount of the tissues are pivotal parameters for successful tChIP-Seq. Thus, the optimization of these factors should be considered for each cell type of interest.
A critical step among the procedures used in this protocol is the DNA shearing to achieve a chromatin length of 100-500 bp<...

Tissues of animals consist of diverse cell types. The gene regulation in each cell defines the cell type. Chromatin modifications - DNA methylation and histone modification - underlie the cell-type specificity of gene expression. Thus, the measurement of epigenetic regulation in each cell type has been desired, but it has been a technical challenge.
To investigate the epigenetics in a particular cell type, tandem chromatin immunoprecipitation sequencing (tChIP-Seq) was recently developed (Figure 1)1. In tChIP, epitope-tagged core histone protein H2B is expressed from a cell-type-specific promoter. This feature allows the isolation of chromatins from the cells of interest, although the material starts from a mixture of various cell types. Following ChIP-Seq &#8212; chromatin purification via a modified-histone mark and next-generation deep sequencing of isolated DNA &#8212; we can monitor the epigenetic status of the targeted cell type in a genome-wide manner.
Using this technique, we recently investigated neuron-specific trimethylation of histone H3 protein at lysine 4 (H3K4me3) marks. In that study, we developed a knock-in mouse in which C-terminally FLAG-tagged H2B protein was expressed upon Cre-mediated recombination (Rosa26CAG floxed-pA H2B-FLAG). By crossing with a mouse possessing the Cre-endoplasmic reticulum (ER) gene under the control of the CamK2a promoter, the obtained mouse line induced H2B-FLAG in active neurons upon tamoxifen injection (Camk2aH2B-FLAG)1. Starting from the brain of the established mouse line, we performed tChIP-Seq with anti-H3K4me3 antibody. Since H3K4me3 marks often correspond to promoter regions, we could discover hundreds of mRNAs specifically expressed in neurons1.
Here, we describe a typical tChIP-Seq method that covers the steps from tissue dissection to library construction (Figure 1). The final goal of this protocol is to share our best practices for the performance of tChIP-Seq and the future application of this method to other cell types and histone modifications.

<table>
	<tbody>
		<tr>
			<td>Protein LoBind tube, 2 mL</td>
			<td>Eppendorf</td>
			<td>No.&#160;0030108132</td>
			<td>For cell lysis</td>
		</tr>
		<tr>
			<td>Protein LoBind tube, 1.5 mL</td>
			<td>Eppendorf</td>
			<td>No.&#160;0030108116</td>
			<td>For ChIP and library preparation</td>
		</tr>
		<tr>
			<td>DNA LoBind tube, 1.5 mL</td>
			<td>Eppendorf</td>
			<td>No.&#160;0030108051</td>
			<td>For ChIP and library preparation</td>
		</tr>
		<tr>
			<td>8-strip PCR tube</td>
			<td>BIO-BIK</td>
			<td>3247-00</td>
			<td>For ChIP and library preparation</td>
		</tr>
		<tr>
			<td>SK Mill</td>
			<td>TOKKEN</td>
			<td>SK-200</td>
			<td>Handy cryogenic grinder to make cell powder for fixation</td>
		</tr>
		<tr>
			<td>Metal bullet</td>
			<td>TOKKEN</td>
			<td>SK-100-DLC10</td>
			<td>Accessory of SK Mill</td>
		</tr>
		<tr>
			<td>2 mL stainless steel tube</td>
			<td>TOKKEN</td>
			<td>TK-AM5-SUS</td>
			<td>An option for cell lysis</td>
		</tr>
		<tr>
			<td>2 mL stainless steel tube holder</td>
			<td>TOKKEN</td>
			<td>SK-100-TL</td>
			<td>An option for cell lysis</td>
		</tr>
		<tr>
			<td>16% formaldehyde (w/v), methanol-free</td>
			<td>Pierce</td>
			<td>28906</td>
			<td>To fix cells. Prepare 1% solution before use.</td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Nacalai Tesque</td>
			<td>17109-35</td>
			<td>Prepare 2.5 M stock</td>
		</tr>
		<tr>
			<td>D-PBS (-)(1x)</td>
			<td>Nacalai Tesque</td>
			<td>14249-24</td>
			<td>For washing lysate and purified DNA</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Nacalai Tesque</td>
			<td>02443-05</td>
			<td>For Lysis buffer 1. Prepare 1 M, pH 7.5 stock.</td>
		</tr>
		<tr>
			<td>5 M NaCl, molecular biology grade</td>
			<td>Nacalai Tesque</td>
			<td>06900-14</td>
			<td>For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer</td>
		</tr>
		<tr>
			<td>0.5 M EDTA, molecular biology grade</td>
			<td>Wako Pure Chemical Industries, Ltd.</td>
			<td>311-90075</td>
			<td>For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer</td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Wako Pure Chemical Industries, Ltd.</td>
			<td>072-04945</td>
			<td>For lysis buffer 1</td>
		</tr>
		<tr>
			<td>NP-40</td>
			<td>Nacalai Tesque</td>
			<td>25223-75</td>
			<td>For lysis buffer 1</td>
		</tr>
		<tr>
			<td>Triton X-100, molecular biology grade</td>
			<td>Nacalai Tesque</td>
			<td>12967-32</td>
			<td>For Lysis buffer 1</td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>Nacalai Tesque</td>
			<td>35406-91</td>
			<td>For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock.</td>
		</tr>
		<tr>
			<td>0.1 M EGTA pH neutral</td>
			<td>Nacalai Tesque</td>
			<td>08947-35</td>
			<td>For Lysis Buffer 2</td>
		</tr>
		<tr>
			<td>Protease inhibitor cocktail (100x)</td>
			<td>Nacalai Tesque</td>
			<td>25955-24</td>
			<td>To block degradation of protein</td>
		</tr>
		<tr>
			<td>RIPA buffer</td>
			<td>Thermo Fisher Scientific</td>
			<td>89900</td>
			<td>For cell lysis and washing</td>
		</tr>
		<tr>
			<td>milliTUBE 1 mL AFA Fiber</td>
			<td>Covaris</td>
			<td>520130</td>
			<td>Sonicator tube. Accessory of Focused-ultrasonicator</td>
		</tr>
		<tr>
			<td>Focused-ultrasonicator</td>
			<td>Covaris</td>
			<td>S220 or E220</td>
			<td>To digest DNA into adequate size for ChIP-Seq</td>
		</tr>
		<tr>
			<td>UltraPure 10% SDS</td>
			<td>Thermo Fisher Scientific</td>
			<td>15553-027</td>
			<td>For ChIP Elution Buffer</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>Nacalai Tesque</td>
			<td>30141-14</td>
			<td>To purify DNA from lysate</td>
		</tr>
		<tr>
			<td>Proteinase K, recombinant, PCR Grade</td>
			<td>Sigma-Aldrich</td>
			<td>3115887001</td>
			<td>To purify DNA from lysate</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Wako Pure Chemical Industries, Ltd.</td>
			<td>054-07225</td>
			<td>Make 70% solution</td>
		</tr>
		<tr>
			<td>Monoclonal anti-FLAG M2 antibody produced in mouse</td>
			<td>Sigma-Aldrich</td>
			<td>F1804</td>
			<td>To purify chromatin expressed in cells of interest</td>
		</tr>
		<tr>
			<td>Dynabead M-280 Sheep Anti-Mouse IgG</td>
			<td>Thermo Fisher Scientific</td>
			<td>11201D</td>
			<td>This can be used for anti-FLAG IP and anti-H3K4me3 IP</td>
		</tr>
		<tr>
			<td>Anti-tri-methyl histone H3 (K4), mouse monoclonal antibody</td>
			<td>Wako Pure Chemical Industries, Ltd.</td>
			<td>301-34811</td>
			<td>Any other antibody that works for ChIP analysis will work</td>
		</tr>
		<tr>
			<td>10x Blocking Reagent</td>
			<td>Sigma-Aldrich</td>
			<td>11096176001</td>
			<td>For blocking during affinity purification</td>
		</tr>
		<tr>
			<td>Denhardt&#8217;s solution</td>
			<td>Nacalai Tesque</td>
			<td>10727-74</td>
			<td>For blocking during affinity purification</td>
		</tr>
		<tr>
			<td>Glycogen (5 mg/ml)</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM9510</td>
			<td>To purify DNA from lysate</td>
		</tr>
		<tr>
			<td>Qubit 2.0 Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q32866</td>
			<td>For quantification of isolated DNA</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS Assay Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q32851</td>
			<td>For quantification of isolated DNA</td>
		</tr>
		<tr>
			<td>0.5 mL tube</td>
			<td>Axygen</td>
			<td>10011-830</td>
			<td>For quantification by Qubit</td>
		</tr>
		<tr>
			<td>Phenol/chloroform/isoamyl alcohol (25:24:1)</td>
			<td>Nacalai Tesque</td>
			<td>25970-56</td>
			<td>To purify DNA from lysate</td>
		</tr>
		<tr>
			<td>AMPure XP beads</td>
			<td>Beckman Coulter</td>
			<td>A63881</td>
			<td>SPRI magnetic beads for library preparation</td>
		</tr>
		<tr>
			<td>Metal ice rack</td>
			<td>Funakoshi</td>
			<td>IR-1</td>
			<td>To keep the cell lysate frozen</td>
		</tr>
		<tr>
			<td>Sample Cooler</td>
			<td>New England Biolabs</td>
			<td>T7771S</td>
			<td>Helps fix cells with minimal damage</td>
		</tr>
		<tr>
			<td>2100 Bioanalyzer</td>
			<td>Agilent Technologies</td>
			<td>G2939BA</td>
			<td>To check the quality of isolated DNA fragments. Another fragment analyzer can be used.</td>
		</tr>
		<tr>
			<td>Bioanalyzer 2100 Expert Software</td>
			<td>Agilent Technologies</td>
			<td>G2946CA</td>
			<td>Supplied with the Bioanalyzer</td>
		</tr>
		<tr>
			<td>High Sensitivity DNA Kit</td>
			<td>Agilent Technologies</td>
			<td>5067-4626</td>
			<td>To check the quality of the isolated DNA fragments</td>
		</tr>
		<tr>
			<td>KAPA LTP Library Preparation Kit</td>
			<td>Roche</td>
			<td>07961898001</td>
			<td>Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution</td>
		</tr>
		<tr>
			<td>NEXTflex DNA Barcodes</td>
			<td>BIOO Scientific</td>
			<td>NOVA-514101</td>
			<td>Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix.</td>
		</tr>
		<tr>
			<td>KAPA Real-Time Library Amplification Kit</td>
			<td>Roche</td>
			<td>07959028001</td>
			<td>Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards</td>
		</tr>
		<tr>
			<td>2x KAPA HiFi HotStart ReadyMix</td>
			<td>Roche</td>
			<td>KM2602</td>
			<td>For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit</td>
		</tr>
		<tr>
			<td>Buffer EB</td>
			<td>Qiagen</td>
			<td>19086</td>
			<td>10 mM Tris-Cl, pH 8.5 for elution of DNA</td>
		</tr>
		<tr>
			<td>386-well qPCR plate</td>
			<td>Thermo Fisher Scientific</td>
			<td>4309849</td>
			<td>For real-time PCR</td>
		</tr>
		<tr>
			<td>QuantStudio 7 Flex Real-Time PCR System</td>
			<td>Thermo Fisher Scientific</td>
			<td>4485701</td>
			<td>To quantify DNA</td>
		</tr>
		<tr>
			<td>MicroAmp Optical Adhesive Film</td>
			<td>Thermo Fisher Scientific</td>
			<td>4311971</td>
			<td>For real-time PCR</td>
		</tr>
		<tr>
			<td>MicroAmp Clear Adhesive Film</td>
			<td>Thermo Fisher Scientific</td>
			<td>4306311</td>
			<td>For plate sealing</td>
		</tr>
		<tr>
			<td>End-repair master mix</td>
			<td></td>
			<td></td>
			<td>Combine 1.4 &#181;L of 10x KAPA End Repair Buffer, 1 &#181;L of KAPA End Repair Enzyme Mix, and 1.6 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>A-taling master mix</td>
			<td></td>
			<td></td>
			<td>Combine 1 &#181;L of KAPA A-Tailing Buffer, 0.6 &#181;L of KAPA A-Tailing Enzyme, and 8.4 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>Ligation buffer mix</td>
			<td></td>
			<td></td>
			<td>Combine 2 &#181;L of KAPA ligation buffer and 6 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>Real-time PCR master mix</td>
			<td></td>
			<td></td>
			<td>Combine 5 &#181;L of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 &#181;L of PCR Primer Mix (10 &#181;M each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>PCR master mix</td>
			<td></td>
			<td></td>
			<td>Combine 10 &#181;L of 2x KAPA HiFi Ready Mix, 0.9 &#181;L of PCR Primer Mix, and 0.6 &#181;L of H2O</td>
		</tr>
		<tr>
			<td>Integrative Genomics Viewer</td>
			<td>Broad Institute</td>
			<td>IGV_2.3.88</td>
			<td>Genome browser to visualize sequencing data</td>
		</tr>
		<tr>
			<td>DNA olgionucleotide: 5&#8242;-GCCTACGCAGGTCTTGCTGAC-3&#8242;</td>
			<td>Eurofins Genomics</td>
			<td></td>
			<td>A primer to amplify the promoter region of GAPDH</td>
		</tr>
		<tr>
			<td>DNA olgionucleotide: 5&#8242;-CGAGCGCTGACCTTGAGGTC-3&#8242;</td>
			<td>Eurofins Genomics</td>
			<td></td>
			<td>A primer to amplify the promoter region of GAPDH</td>
		</tr>
		<tr>
			<td>SYBR Premix Ex Taq</td>
			<td>Takara</td>
			<td>RR420L</td>
			<td>To quantify the DNA corresponding to the GADPH promoter region</td>
		</tr>
		<tr>
			<td>Thermal Cycler Dice</td>
			<td>Takara</td>
			<td>TP870</td>
			<td>To quantify the DNA corresponding to the GADPH promoter region</td>
		</tr>
	</tbody>
</table>

tchip-seq: cell-type-specific epigenome profiling

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological functions have been extensively studied. Indeed, the advent of next-generation deep sequencing and chromatin immunoprecipitation (ChIP) via specific histone modification antibodies has revolutionized our view of epigenetic regulation across the genome. Conversely, tissues typically consist of diverse cell types, and their complex mixture poses analytic challenges to investigating the epigenome in a particular cell type. To address the cell type-specific chromatin state in a genome-wide manner, we recently developed tandem chromatin immunoprecipitation sequencing (tChIP-Seq), which is based on the selective purification of chromatin by tagged core histone proteins from cell types of interest, followed by ChIP-Seq. The goal of this protocol is the introduction of best practices of tChIP-Seq. This technique provides a versatile tool for tissue-specific epigenome investigation in diverse histone modifications and model organisms.

Here, we describe the tissue dissection, fixation, cell lysis, tandem purification of chromatin, and DNA library preparation for next-generation sequencers. During the procedures, one can test the quality of the DNA, which is the key to successful sequencing, at multiple steps (Figure 2). Since a single nucleosome is typically surrounded by 147 bp DNA 4, sheared DNA should not be shorter than that size. Immediately after ultrasonicatio...

Watch this Scientific Journal Video about TChIP-Seq: Cell-Type-Specific Epigenome Profiling at JoVE.com

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

tchip-seq-cell-type-specific-epigenome-profiling

Research

Education

JoVE Core

JoVE Journal

Cell Biology

Biology

Unit 1

Control of Gene Expression

SCIENTISTS IN ACTION

7.6K Views.  RIKEN. We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Video: TChIP-Seq: Cell-Type-Specific Epigenome Profiling

Antibody Profiling by Luciferase Immunoprecipitation Systems (LIPS)

Technologies for comprehensively understanding and quantifying antibody profiles to autoantigens and infectious agents may yield new insights into disease mechanisms and may elucidate new markers to substratify disease with different clinical features and better understand pathogenesis. We have developed a highly quantitative method called Luciferase Immunoprecipitation Systems (LIPS) for profiling patient sera antibody responses to autoantigens and pathogen antigens associated with infection. Unlike ELISAs, the highly sensitive LIPS is easily implemented to survey humoral serological response profiles to different antigens in a universal format and produces dynamic antibody titer ranges up to 6 log10 for some antigens. In these studies, quantitative profiling by LIPS of patient humoral responses against panels of antigens or even the entire proteome of some pathogens (i.e. HIV), is typically more informative than testing a single antigen by ELISA. In addition, LIPS also eliminates time and effort needed to produce highly purified antigens as well as the labor-intensive assay optimization steps needed for standard ELISAs. Here we provide a detailed protocol describing the technical aspects of performing LIPS assays for readily profiling antibody responses to single or multiple antigens.

Antibody Profiling by Luciferase Immunoprecipitation Systems LIPS

The technical aspects of performing LIPS (Luciferase Immunoprecipitation Systems) are described. The overall approach involves expressing chimeric genes encoding antigens fused to Renilla luciferase (Ruc) in mammalian cells. Crude Ruc-antigen extracts are then prepared and, without purification, employed in immunoprecipitation assays to quantify antibodies.

Technologies for comprehensively understanding and quantifying antibody profiles to autoantigens and infectious agents may yield new insights into disease ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

OLIgo Mass Profiling (OLIMP) of Extracellular Polysaccharides

The direct contact of cells to the environment is mediated in many organisms by an extracellular matrix. One common aspect of extracellular matrices is that they contain complex sugar moieties in form of glycoproteins, proteoglycans, and/or polysaccharides. Examples include the extracellular matrix of humans and animal cells consisting mainly of fibrillar proteins and proteoglycans or the polysaccharide based cell walls of plants and fungi, and the proteoglycan/glycolipid based cell walls of bacteria. All these glycostructures play vital roles in cell-to-cell and cell-to-environment communication and signalling.
An extraordinary complex example of an extracellular matrix is present in the walls of higher plant cells. Their wall is made almost entirely of sugars, up to 75% dry weight, and consists of the most abundant biopolymers present on this planet. Therefore, research is conducted how to utilize these materials best as a carbon-neutral renewable resource to replace petrochemicals derived from fossil fuel. The main challenge for fuel conversion remains the recalcitrance of walls to enzymatic or chemical degradation due to the unique glycostructures present in this unique biocomposite.
Here, we present a method for the rapid and sensitive analysis of plant cell wall glycostructures. This method OLIgo Mass Profiling (OLIMP) is based the enzymatic release of oligosaccharides from wall materials facilitating specific glycosylhydrolases and subsequent analysis of the solubilized oligosaccharide mixtures using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/MS)1 (Figure 1). OLIMP requires walls of only 5000 cells for a complete analysis, can be performed on the tissue itself2, and is amenable to high-throughput analyses3. While the absolute amount of the solubilized oligosaccharides cannot be determined by OLIMP the relative abundance of the various oligosaccharide ions can be delineated from the mass spectra giving insights about the substitution-pattern of the native polysaccharide present in the wall.
OLIMP can be used to analyze a wide variety of wall polymers, limited only by the availability of specific enzymes4. For example, for the analysis of polymers present in the plant cell wall enzymes are available to analyse the hemicelluloses xyloglucan using a xyloglucanase5, 11, 12, 13, xylan using an endo-&beta;-(1-4)-xylanase 6,7, or for pectic polysaccharides using a combination of a polygalacturonase and a methylesterase 8. Furthermore, using the same principles of OLIMP glycosylhydrolase and even glycosyltransferase activities can be monitored and determined 9.

OLIgo Mass Profiling OLIMP of Extracellular Polysaccharides

A rapid way is described to gain insights into the structure of polysaccharides in an extracellular matrix. The method takes advantage of the specificity of glycosylhydrolases and the sensitivity of mass spectrometry allowing minute amounts of materials to be analyzed. This technique is adaptable to be used directly on tissue itself.

The direct contact of cells to the environment is mediated in many organisms by an extracellular matrix. One common aspect of extracellular matrices is ...

Heterokaryon Technique for Analysis of Cell Type-specific Localization

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling. These proteins display a diverse array of cellular functions including nuclear import/export of RNA and protein, transcriptional regulation, and apoptosis. Interestingly, major cellular reorganizations including cell division, differentiation and transformation, often involve such activities3,4,8,10. The detailed study of these proteins and their respective regulatory mechanisms can be challenging as the stimulation for these localization changes can be elusive, and the movements themselves can be quite dynamic and difficult to track. Studies involving cellular oncogenesis, for example, continue to benefit from understanding pathways and protein activities that differ between normal primary cells and transformed cells6,7,11,12. As many proteins show altered localization during transformation or as a result of transformation, methods to efficiently characterize these proteins and the pathways in which they participate stand to improve the understanding of oncogenesis and open new areas for drug targeting.
Here we present a method for the analysis of protein trafficking and shuttling activity between primary and transformed mammalian cells. This method combines the generation of heterokaryon fusions with fluorescence microscopy to provide a flexible protocol that can be used to detect steady-state or dynamic protein localizations. As shown in Figure 1, two separate cell types are transiently transfected with plasmid constructs bearing a fluoroprotein gene attached to the gene of interest. After expression, the cells are fused using polyethylene glycol, and protein localizations may then be imaged using a variety of methods. The protocol presented here is a fundamental approach to which specialized techniques may be added.

A flexible and efficient method for the characterization of cell type-specific protein localization and nucleocytoplasmic shuttling is described. This heterokaryon approach uses fluorescently-labeled fusion proteins to image protein localizations after cell fusion. The protocol is amenable to steady-state localizations or more dynamic determinations based on live cell imaging.

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling.  These proteins display a diverse array of ...

Single Cell Transcriptional Profiling of Adult Mouse Cardiomyocytes

While numerous studies have examined gene expression changes from homogenates of heart tissue, this prevents studying the inherent stochastic variation between cells within a tissue. Isolation of pure cardiomyocyte populations through a collagenase perfusion of mouse hearts facilitates the generation of single cell microarrays for whole transcriptome gene expression, or qPCR of specific targets using nanofluidic arrays. We describe here a procedure to examine single cell gene expression profiles of cardiomyocytes isolated from the heart. This paradigm allows for the evaluation of metrics of interest which are not reliant on the mean (for example variance between cells within a tissue) which is not possible when using conventional whole tissue workflows for the evaluation of gene expression (Figure 1). We have achieved robust amplification of the single cell transcriptome yielding micrograms of double stranded cDNA that facilitates the use of microarrays on individual cells. In the procedure we describe the use of NimbleGen arrays which were selected for their ease of use and ability to customize their design. Alternatively, a reverse transcriptase - specific target amplification (RT-STA) reaction, allows for qPCR of hundreds of targets by nanofluidic PCR. Using either of these approaches, it is possible to examine the variability of expression between cells, as well as examining expression profiles of rare cell types from within a tissue. Overall, the single cell gene expression approach allows for the generation of data that can potentially identify idiosyncratic expression profiles that are typically averaged out when examining expression of millions of cells from typical homogenates generated from whole tissues.

Single cell expression profiling allows the detailed gene expression analysis of individual cells. We describe methods for the isolation of cardiomyocytes, and preparing the resulting lysates for either whole transcriptome microarray or qPCR of specific targets.

While numerous studies have examined gene expression changes from homogenates of heart tissue, this prevents studying the inherent stochastic variation ...

Profiling Thiol Redox Proteome Using Isotope Tagging Mass Spectrometry

Pseudomonas syringae pv. tomato strain DC3000 not only causes bacterial speck disease in Solanum lycopersicum but also on Brassica species, as well as on Arabidopsis thaliana, a genetically tractable host plant1,2. The accumulation of reactive oxygen species (ROS) in cotyledons inoculated with DC3000 indicates a role of ROS in modulating necrotic cell death during bacterial speck disease of tomato3. Hydrogen peroxide, a component of ROS, is produced after inoculation of tomato plants with Pseudomonas3. Hydrogen peroxide can be detected using a histochemical stain 3'-3' diaminobenzidine (DAB)4. DAB staining reacts with hydrogen peroxide to produce a brown stain on the leaf tissue4. ROS has a regulatory role of the cellular redox environment, which can change the redox status of certain proteins5. Cysteine is an important amino acid sensitive to redox changes. Under mild oxidation, reversible oxidation of cysteine sulfhydryl groups serves as redox sensors and signal transducers that regulate a variety of physiological processes6,7. Tandem mass tag (TMT) reagents enable concurrent identification and multiplexed quantitation of proteins in different samples using tandem mass spectrometry8,9. The cysteine-reactive TMT (cysTMT) reagents enable selective labeling and relative quantitation of cysteine-containing peptides from up to six biological samples. Each isobaric cysTMT tag has the same nominal parent mass and is composed of a sulfhydryl-reactive group, a MS-neutral spacer arm and an MS/MS reporter10. After labeling, the samples were subject to protease digestion. The cysteine-labeled peptides were enriched using a resin containing anti-TMT antibody. During MS/MS analysis, a series of reporter ions (i.e., 126-131 Da) emerge in the low mass region, providing information on relative quantitation. The workflow is effective for reducing sample complexity, improving dynamic range and studying cysteine modifications. Here we present redox proteomic analysis of the Pst DC3000 treated tomato (Rio Grande) leaves using cysTMT technology. This high-throughput method has the potential to be applied to studying other redox-regulated physiological processes.

Reactive oxygen species level is elevated when cells encounter stress conditions. Here we show the example of 3'-3' diaminobenzidine staining as well as cysTMT labeling and mass spectrometry to profile the redox proteome in Pseudomonas syringae treated tomato leaves.

Pseudomonas syringae pv. tomato strain DC3000 not only causes bacterial speck disease in Solanum lycopersicum but also on Brassica species, as well as on ...

Glycan Profiling of Plant Cell Wall Polymers using Microarrays

Plant cell walls are complex matrixes of heterogeneous glycans which play an important role in the physiology and development of plants and provide the raw materials for human societies (e.g. wood, paper, textile and biofuel industries)1,2. However, understanding the biosynthesis and function of these components remains challenging.
Cell wall glycans are chemically and conformationally diverse due to the complexity of their building blocks, the glycosyl residues. These form linkages at multiple positions and differ in ring structure, isomeric or anomeric configuration, and in addition, are substituted with an array of non-sugar residues. Glycan composition varies in different cell and/or tissue types or even sub-domains of a single cell wall3. Furthermore, their composition is also modified during development1, or in response to environmental cues4.
In excess of 2,000 genes have Plant cell walls are complex matrixes of heterogeneous glycans been predicted to be involved in cell wall glycan biosynthesis and modification in Arabidopsis5. However, relatively few of the biosynthetic genes have been functionally characterized 4,5. Reverse genetics approaches are difficult because the genes are often differentially expressed, often at low levels, between cell types6. Also, mutant studies are often hindered by gene redundancy or compensatory mechanisms to ensure appropriate cell wall function is maintained7. Thus novel approaches are needed to rapidly characterise the diverse range of glycan structures and to facilitate functional genomics approaches to understanding cell wall biosynthesis and modification.
Monoclonal antibodies (mAbs)8,9 have emerged as an important tool for determining glycan structure and distribution in plants. These recognise distinct epitopes present within major classes of plant cell wall glycans, including pectins, xyloglucans, xylans, mannans, glucans and arabinogalactans. Recently their use has been extended to large-scale screening experiments to determine the relative abundance of glycans in a broad range of plant and tissue types simultaneously9,10,11.
Here we present a microarray-based glycan screening method called Comprehensive Microarray Polymer Profiling (CoMPP) (Figures 1 &amp; 2)10,11 that enables multiple samples (100 sec) to be screened using a miniaturised microarray platform with reduced reagent and sample volumes. The spot signals on the microarray can be formally quantified to give semi-quantitative data about glycan epitope occurrence. This approach is well suited to tracking glycan changes in complex biological systems12 and providing a global overview of cell wall composition particularly when prior knowledge of this is unavailable.

A technique called Comprehensive Microarray Polymer Profiling (CoMPP) for the characterisation of plant cell wall glycans is described. This method combines the specificity of monoclonal antibodies directed to defined glycan-epitopes with a miniature microarray analytical platform allowing screening of glycan occurrence in a broad range of biological contexts.

Plant cell walls are complex matrixes of heterogeneous glycans which play an important role in the physiology and development of plants and provide the ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

An Easy Method for Plant Polysome Profiling

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the analysis of translational regulation. The method described here is an easy and economical way for fractionating polysomes from various plant tissues. A sucrose gradient is made without the need for a gradient maker by sequentially freezing each layer. Cytosolic extracts are then prepared in a buffer containing cycloheximide and chloramphenicol to immobilize the cytosolic and chloroplastic ribosomes to mRNA and are loaded onto the sucrose gradient. After centrifugation, six fractions are directly collected from the bottom to the top of the gradient, without piercing the ultracentrifugation tube. During collection, the absorbance at 260 nm is read continuously to generate a polysome profile that gives a snapshot of global translational activity. Fractions are then pooled to prepare three different mRNA populations: the polysomes, mRNAs bound to several ribosomes; the monosomes, mRNAs bound to one ribosome; and mRNAs that are not bound to ribosomes. mRNAs are then extracted. This protocol has been validated for different plants and tissues including Arabidopsis thaliana seedlings and adult plants, Nicotiana benthamiana, Solanum lycopersicum, and Oryza sativa leaves.

This protocol describes an easy method to extract and fractionate transcripts from plant tissues on the basis of the number of bound ribosomes. It allows a global estimate of translation activity and the determination of the translational status of specific mRNAs.

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the ...

Cellular Redox Profiling Using High-content Microscopy

Reactive oxygen species (ROS) regulate essential cellular processes including gene expression, migration, differentiation and proliferation. However, excessive ROS levels induce a state of oxidative stress, which is accompanied by irreversible oxidative damage to DNA, lipids and proteins. Thus, quantification of ROS provides a direct proxy for cellular health condition. Since mitochondria are among the major cellular sources and targets of ROS, joint analysis of mitochondrial function and ROS production in the same cells is crucial for better understanding the interconnection in pathophysiological conditions. Therefore, a high-content microscopy-based strategy was developed for simultaneous quantification of intracellular ROS levels, mitochondrial membrane potential (&#916;&#936;m) and mitochondrial morphology. It is based on automated widefield fluorescence microscopy and image analysis of living adherent cells, grown in multi-well plates, and stained with the cell-permeable fluorescent reporter molecules CM-H2DCFDA (ROS) and TMRM (&#916;&#936;m and mitochondrial morphology). In contrast with fluorimetry or flow-cytometry, this strategy allows quantification of subcellular parameters at the level of the individual cell with high spatiotemporal resolution, both before and after experimental stimulation. Importantly, the image-based nature of the method allows extracting morphological parameters in addition to signal intensities. The combined feature set is used for explorative and statistical multivariate data analysis to detect differences between subpopulations, cell types and/or treatments. Here, a detailed description of the assay is provided, along with an example experiment that proves its potential for unambiguous discrimination between cellular states after chemical perturbation.

This paper presents a high-content microscopy workflow for simultaneous quantification of intracellular ROS levels, as well as mitochondrial membrane potential and morphology &#8211; jointly referred to as mitochondrial morphofunction &#8211; in living adherent cells using the cell-permeant fluorescent reporter molecules 5-(and-6)-chloromethyl-2&#39;,7&#39;-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H2DCFDA) and tetramethylrhodamine methylester (TMRM).

Reactive oxygen species (ROS) regulate essential cellular processes including gene expression, migration, differentiation and proliferation. However, ...