우리가 그들의 3C 프로토콜을 공유하기위한 대단히 아델 무렐와 늑대 Reik 감사합니다. 이 작품은 국방부와 재향 군인의 담당 부서의 연구 서비스의 부서에 의해 지원되었다.

1. 장거리 염색질 상호 작용의 포름 알데히드 고정 <ol><li> 인큐베이터에서 15% FBS 및 80-90%의 합류 1 X 페니실린 / 스트렙토 마이신과 문화 인간의 세포 라인 RPMI1640 매체 HL - 60, 37에서 5 % CO 2와 함께 제공된 ° C. </li><li> 15 분 동안 1,200 rpm으로 50 ML Nunc 튜브, 원심 분리기로 세포를 수집하고 열망하여 미디어를 제거 </li><li> 셀 알약을 resuspend하고 hemocytometer를 사용하여 셀을 카운트하는 문화 매체의 5 ML을 추가합니다. RPMI1640 / 10 % FBS 40 ML의 볼륨에 약 1 X 10 7 세포를 가지고, 다음 희석 염색질를 해결하기 위해 37 % 포름 알데히드의 1.7 ML를 추가합니다. </li><li> 부드러운 잡고 10 분 동안 상온에서 품어, 그리고 2M 글리신의 2.4 ML로 끄다. 4 1,200 rpm으로 15 분 동안 원심 분리기는 ° C, 그리고 표면에 뜨는를 제거합니다. 40 ML 얼음 차가운 PBS로 한번 펠렛을 세척 후 펠렛를 스핀 다운하고 PBS를 제거합니다. </li></ol> 2. 핵을 분리하기 위해 셀 용해 <ol><li> 갓 추가 테아제 억제제 (1:500 희석)와 0.1 MM PMSF 얼음 차가운 용해 완충액 (10 MM 트리스 - HCL, pH8.0, 10 MM NaCl, 0.2 % NP - 40) 40 ML에 Resuspend 세포. 90분, 15 분 동안 2,500 rpm으로 원심 분리기에 대한 회전 추운 방에 부화하고, 표면에 뜨는를 제거합니다. </li></ol> 3. Bgl II와 제한 효소 소화 <ol><li> 1 X 코 버퍼 3 0.5 ML의 핵 Resuspend, 15 μlof 10% SDS를 추가합니다. 잡고 1 시간 동안 37 ° C에서 부화 후, 트리톤은 X - 100 SDS를 격리 20 % 45 μl를 추가합니다. ° C 1 시간 잡고 37 알을 품다. </li><li> 제한 효소 분해 1 X 10 6 핵 (15 μg, 원래 셀은 10 분의 1)의 나누어지는을 사용합니다. 단계 3.1에서 핵 솔루션 55 μl를 꺼내 1 X 코 버퍼 3 Bgl II (50U/ul) 12 μl의 433 μl 500 μl까지합니다. ° C 하루 37 알을 품다. </li></ol> 4. 상호 작용하는 DNA 세그먼트의 결합 <ol><li> 65 가열하여 95 10% SDS의 μl 및 변성을 추가 ° 물을 욕조에 20 분 C.하여 제한 효소를 Inactivate </li><li> 하나의 X 내고 버퍼 (30 MM 트리스 - HCL, pH를 8.0, 10 MM MgCl 2, 10 MM DTT, 1 MM ATP) 20 % 트리톤 X - 100 360 μl 7 ML 추가 1 시간 동안 ° C 37 알을 품다 . </li><li> 16 온도를 낮게 ° C 400 U / μl T4 DNA ligase의 50 μl를 추가합니다. 30 분 실온에서 다음 4 시간 동안 16 ° C에서 샘플을 품어합니다. </li></ol> 5. DNA의 정제 <ol><li> proteinase K 300 μg을 추가하고, ° C 야간 65 알을 품다. </li><li> 37과 부화 ° C 30 분 RNase의 5 μg 추가 </li><li> 이소프로판올에 페놀 / 클로로포름 추출 및 침전의 DNA에 의해 DNA 정화. 멸균 증류수 150 μl의 DNA를 디졸브. </li></ol> 6. MSP I과 소화와 oligonucleotide linkers과 결합 <ol><li> 4-6시간에 대한 37 MSP I 5 단위 ° C를 DNA를 정화의 2μg을 품어. 65 I를 MSP Inactivate ° 10 분 C는 다음 5 MG / ML 글리코겐 1 μl와 에탄올의 DNA를 침전. 멸균 증류수 50 μl의 DNA 펠렛을 디졸브. </li><li> 20 μm의 링커 oligonucleotide의 L 2 μl와 MSP I - 대우 DNA의 50 μl를 혼합 (5&#39; - gctgaccctgaattcgcacgtgcctgtcgttagcggacacagggcgattcac - 3 &#39;), 20 μm의 oligonucleotide S (5&#39; - cggtgaatc - 3 1 μl&#39;), 1 μl 무균 증류수 10 X T4 DNA ligase의 버퍼 6 μl. 액체 왁스와 혼합을 커버. </li><li> 50 변성 oligonucleotides ° C 1 분, 10 점차 진정 수에 대한 ° C 온도 자전거 타는 사람에서 0.5 ° C / 분 그라데이션 인치 </li><li> 400 U / μl T4 DNA ligase의 1 μl를 추가하고 15 ° C 하룻밤에 품어. 링커 - 출혈도 잡았 QIAquick PCR의 정제 키트를 사용하여 DNA와 멸균 증류수 50 μl에 elute 정화. </li></ol> 7. PCR 증폭 및 시퀀스 분석 <ol><li> 당신이 장거리 상호 작용 (즉, &#39;미끼&#39;)에 대한 검토하고자하는 DNA의 특정 지역에 대한 입문서를 선택합니다. 이 예제에서, 우리는 ABL - 1을 사용합니다. </li><li> 20 μm의 1 μl를 사용하여 첫 라운드 PCR ABL -1 특정 프라이머 # 4656 (5&#39; - gttcaagcgattctcctgcctcga - 3 &#39;), 20 μm의 1 μl 링커 특정 프라이머 # 2963을 (수행할 수있는 정화 DNA 1 μl을 가지고 5&#39; - 3 X Klen DNA 형성 촉매의 DNA 중합 효소 나는 칵테일과 멸균 증류수 3 μl의 gctgaccctgaattcgcacgtgcct - 3 &#39;), 3μl. 32 P - dCTP 두 μl는 PCR 증폭하기 전에 세 X Klen DNA 형성 촉매의 DNA 중합 효소 나는 칵테일 100 μl에 추가됩니다. 95 18 사이클 ° 20 초 동안 C, 65 ° 40 초전에 C, 72 ° C 1 분,, 마지막 확장자 핫 시작 PCR에 대한 열 사이클 72 ° 2 분, 95 C ° Cfor 이분입니다 72에서 수행됩니다 ° C5 분. </li><li> 멸균 증류수 30 μl에 QIAquick PCR의 정화 키트 및 elute DNA를 사용하여 첫 라운드 PCR 제품 정화. </li><li> 20 μm의 1 μl ABL - 1 특정 프라이머 # 4626 (5&#39; - ggagaatttttatctgcctctgtga - 3 &#39;) (그림 1A), 1 μl를 추가하여 중첩 primers를 사용하여 PCR의 두 번째 라운드를 수행하는 첫번째 PCR 제품을 희석 100 X 1 μl을 가지고 링커 특정 프라이머 # 2961 (5&#39; - gtcgttagcggacacagggcgattc - 3 &#39;), 멸균 증류수의 μl 3 X Klen DNA 형성 촉매의 DNA 중합 효소 나는 칵테일과 3 개 중 3 μl의 20 μm의 중. 온도 사이클링 일정가 95의 25주기입니다 ° 20 초 동안 C, 67 ° 40 초전에 C, 72 ° C 5 분 72 ° C에서 확장하여 다음 1 분하십시오. </li><li> 5 % 우레아 페이지 젤을 실행하고 PhosphoImager에 노출된 화면 (그림 1B)를 스캔하여 PCR 제품을 시각화. 각 PCR 밴드가 멸균 증류수 60 μl를 포함 Eppendorf 튜브에 겔 스트립을 해소하고, ° C 5 분 95시 잠복기에 의해 겔에서 재활 용할 수 있습니다. 모든 샘플을 수집하기 위해 10 초 10,000 rpm으로 간단히 원심 분리기. 위에서 설명한 것과 같은 조건을 사용하여 뇌관의 페어 4,626분의 2,961로 PCR을 수행하기 위해 DNA를 템플릿으로 사용하여 1 μl를 제거합니다. 시퀀스 분석 QIAquick PCR의 정제 키트를 사용하여 정제 후 수행할 수 있습니다. </li><li> http://genome.ucsc.edu (그림 1C) : DNA 시퀀스는 웹 사이트에서 자신의 염색체 위치를 결정하는 온라인 도구를 사용하여 분석하고 있습니다. DNA 시퀀스를 붙여넣을 수있는 새 창을을 입력하려면 &#39;BLAT&#39;을 클릭, 새로운 윈도우 &#39;제출&#39;을 클릭 후 나타나는, 그리고 &#39;BLAT 검색 결과&#39;를 보여줍니다. DNA 순서의 위치를​​ 보여주기 위해 다음 창문을 입력 100 % 신분으​​로 조회를 클릭한 다음 &#39;브라우저&#39;. </li></ol> 8. 대표 결과 1. 긴 범위의 DNA 상호 작용을 결정 미끼로 ABL - 1 영역을 사용하여 ACT 분석 그림 1A, 두 Bgl II 사이트 하나 BamH I 사이트의 그림은 ACT 분석을 위해 선택되었다. PCR의 두 번째 라운드에서, 뇌관은 2,961분의 4,626이 ABL - M1을 증폭하는 데 사용된 설정 2,961분의 4,630은 ABL - M2 사용되었고, 2,961분의 4,636은 ABL - M3를 위해 사용되었다. 전형적인 겔 패턴은 여러 밴드 (그림 1B) 하나 보여줍니다. ACT의 분석에서 각 조각은 두 결합 DNA 세그먼트로 구성되어 있습니다 : 두 번째 세그먼트가 첫 번째 제한 효소 인식 시퀀스로 미끼 지역 세그먼트에 합류했습니다 관련된 파트너에서 제공하는 동안 한 세그먼트는 미끼의 DNA 지역에서 파생됩니다. 두 번째 효소 인식 시퀀스 관련된 파트너 순서 (그림 1C)의 끝 부분에 표시됩니다. 복제된 ABL - M1 조각 +133,592,306-133,592,399에서 염색체 9q32.4에 위치한 ABL1의 지역에서 DNA를 포함하고, 관련된 파트너는 +71,869,882-71,870,107에서 염색체 3p13에 위치하고 있습니다. 관련된 파트너의 신원은 UCSC 게놈 브라우저 (월 출시 GRCh7/hg19 2009)를 사용하여 자신의 시퀀스를 분사에 의해 발견됩니다. PROK2는 chr3p13 로커스에 관련된 파트너로 확인되었다. 클론 ABL - M3가 ABL - 1 로커스 근처 내부 염색체 연관로 식별하는 동안 마찬가지로, ABL - M2 관련된 파트너는 chr5q21.1로 지역화된되었습니다. 2. ACT의 분석을 사용하여 적은 유행 원거리 상호 작용을 결정 3C에 따라 다른 assays 우리는 그림 1과 Igf2 / H19 로커스 12 보였습니다보다 많은 상호 작용하는 파트너를보고있다. 우리가 설명해야하는 방법론은 가장 널리 원거리 상호 작용을 선택합니다. 그러나, PCR 사이클의 수를 늘림으로써, 그것은 추가로, 덜 자주 연관을 식별할뿐만 아니라 (그림 2) 수 있습니다. 3. 정상 조직에 비해 암세포에 긴 범위 상호 작용의 차이. ACT의 분석도 정상 세포와 암세포 (그림 3) 사이의 핵 구조의 차이와 원거리 상호 작용을 식별하는 데 사용할 수 있습니다. 이러한 차이는 셀 변환하는 동안 발생하는 핵 구조의 변화를 반영 수 있으며, 따라서이 분석은 궁극적으로 진단 목적으로 적용할 수 있습니다. 정상 및 암 조직 모두에서 발생하는 유사한 겔 패턴 ACT 분석은 안정적이고 반복이라고 지적했다. ACT의 분석은 피시 앤 칩의 assays 같은 장거리 DNA 파트너, 자세한 분석, 멀리 loci 간의 식별 협회의 존재를 확인하는 데 필요한을 식별할 수 있지만. 유전, 생리학 및 생화학 연구는 다음이 장거리 DNA 협회의 생물 학적 의미를 명료하게하다을 수행할 수 있습니다. <img src="/files/ftp_upload/2621/2621fig1.jpg" alt="그림 1" /> HL - 60 세포에서 DNA 미끼로 ABL - 1 영역을 사용하여 그림 1 ACT 분석. A. DNA의 구조체ABL - 1 지역에 우레. ACT 분석에 사용되는 첫 번째 제한 효소 Bgl II되었습니다. PCR의 두 번째 라운드에 대한 primers도 화살표와 해당 뇌관 번호로 표시됩니다. B. 5% 요소 페이지에서 ACT 분석의 젤 형태. 프라이머 쌍 2,961분의 4,626이 중첩된 PCR에 ABL - M1 클론을 확장에 사용 되었음 2,961분의 4,630은 클론 ABL - M2 사용되었고, 2,961분의 4,636은 복제 ABL - M3를 위해 사용되었다. C. 클론 ABL - M1의 DNA 시퀀스. ABL - 1 미끼 DNA의 DNA 단편은 빨간색으로 표시하고, 연관된 DNA 파트너는 시안에 표시됩니다. Bgl II 사이트 (AGACTC)은 녹색으로 표시되었습니다이며, MSP I 사이트 (CCGG)은 자주색으로 표시됩니다. <img src="/files/ftp_upload/2621/2621fig2.jpg" alt="그림 2" /> 그림 2 PCR 사이클 행동 분석 결과에 영향을 미칩니다. 마우스 fibroblast 세포에서 미끼의 DNA로 Igf2/H19 로커스에서 각인 제어 영역 (ICR)을 사용하여 다양한 자전거 프로그램은 ACT 분석에서 PCR의 첫 번째와 두 번째 라운드에 적용되었습니다. PCR의 첫 라운드에서 18-20 사이클 시각있을 정도로 신호를 증폭하지 않았다. 분명 밴드의 두 번째 PCR 결과에서 스물 다섯 사이클, PCR의 두 번째 라운드를위한 사이클의 수를 증가하면서 더 밴드 이외에 얼룩 패턴을 유도. <img src="/files/ftp_upload/2621/2621fig3.jpg" alt="그림 3" /> 그림 ACT 분석에서 정상적인 결장 조직 및 결장암 조직 사이의 핵 구조의 차이 3 탐지. A. IGF2/H19 로커스과 IGF2 유전자의 ICR 지역의 DNA 구조를. ACT 분석을위한 Dpn II 사이트가 표시됩니다. 두 번째 라운드에 사용되는 PCR Primers는 그림의 패널 B의 각 차선에 해당하는 다양한 색상의 화살표와 숫자로 표시됩니다. B. 5% 요소 페이지에서 ACT 분석의 젤 형태. 정상 대장 조직 MAD03 - 1423 및 결장암 조직 MAD04 - 149은 협동 조합 인체 조직 네트워크 (CHTN) 서부 본부로부터 얻은 것입니다. 각 결장 조직을 균질 후, ACT 분석은 여기에서 설명하는 절차는 다음과 같은 수행되었다. 레인 1은 프라이머 쌍에게 패널에 분홍색으로 표시 # 2961and # 4161 (5&#39; - tctgcgccatcagggcagtgagac - 3 &#39;)를 사용하여 PCR 결과를 나타내고, 차선 2 프라이머 쌍에게 # 2961과 # 4163 (5&#39; - gccgcgcggccacttccgattcc - 3를 사용하여 PCR 결과를 나타냅니다 &#39;)가 패널에 오렌지색으로 표시, 차선 3 뇌관 쌍을 # 2961과 # 5145 (5&#39; - gccatgcaggtaggatttgagctg - 3를 사용하여 PCR 결과를 나타내는&#39;패널에서 파란색으로 표시)을, 차선 4 뇌관 쌍을 # 2961를 사용하여 PCR 결과를 나타냅니다 와 # 5151 (5&#39; - gtctcaaataggggccagctagcttgg - 3 &#39;) 패널 A에서 녹색으로 표시 정상적인 결장 조직에서만 나타나는 고유 밴드는 노란색 화살표로 표시되며, 결장 암 조직에서만 나타나 그 밴드는 빨간색 화살표가 표시됩니다. ICR, 각인 통제 지역, DMR, 다른 methylated 지역.

<ol>
	<li>Dekker, J., Rippe, K., Dekker, M., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+chromosome+conformation.">Capturing chromosome conformation.</a> Science. 295, 1306-1311 (2002).</li><li>Apostolou, E., Thanos, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus+Infection+Induces+NF-kappaB-dependent+interchromosomal+associations+mediating+monoallelic+IFN-beta+gene+expression.">Virus Infection Induces NF-kappaB-dependent interchromosomal associations mediating monoallelic IFN-beta gene expression.</a> Cell. 134, 85-96 (2008).</li><li>Duan, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+three-dimensional+model+of+the+yeast+genome.">A three-dimensional model of the yeast genome.</a> Nature. 465, 363-367 (2010).</li><li>Lomvardas, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interchromosomal+interactions+and+olfactory+receptor+choice.">Interchromosomal interactions and olfactory receptor choice.</a> Cell. 126, 403-413 (2006).</li><li>Murrell, A., Heeson, S., Reik, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+between+differentially+methylated+regions+partitions+the+imprinted+genes+Igf2+and+H19+into+parent-specific+chromatin+loops.">Interaction between differentially methylated regions partitions the imprinted genes Igf2 and H19 into parent-specific chromatin loops.</a> Nat Genet. 36, 889-893 (2004).</li><li>Schoenfelder, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preferential+associations+between+co-regulated+genes+reveal+a+transcriptional+interactome+in+erythroid+cells.">Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells.</a> Nat Genet. 42, 53-61 (2010).</li><li>Spilianakis, C. G., Lalioti, M. D., Town, T., Lee, G. R., Flavell, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interchromosomal+associations+between+alternatively+expressed+loci.">Interchromosomal associations between alternatively expressed loci.</a> Nature. 435, 637-645 (2005).</li><li>Vakoc, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proximity+among+distant+regulatory+elements+at+the+beta-globin+locus+requires+GATA-1+and+FOG-1.">Proximity among distant regulatory elements at the beta-globin locus requires GATA-1 and FOG-1.</a> Mol Cell. 17, 453-462 (2005).</li><li>Xu, N., Tsai, C. L., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+homologous+chromosome+pairing+marks+the+onset+of+X+inactivation.">Transient homologous chromosome pairing marks the onset of X inactivation.</a> Science. 311, 1149-1152 (2006).</li><li>Lieberman-Aiden, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+mapping+of+long-range+interactions+reveals+folding+principles+of+the+human+genome.">Comprehensive mapping of long-range interactions reveals folding principles of the human genome.</a> Science. 326, 289-293 (2009).</li><li>Berkum, N. L. v. a. n. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hi-C:+a+method+to+study+the+three-dimensional+architecture+of+genomes.">Hi-C: a method to study the three-dimensional architecture of genomes.</a> J Vis Exp. , (2010).</li><li>Ling, J. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+mediates+interchromosomal+colocalization+between+Igf2/H19+and+Wsb1/Nf1.">CTCF mediates interchromosomal colocalization between Igf2/H19 and Wsb1/Nf1.</a> Science. 312, 269-272 (2006).</li><li>Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+three+'C's+of+chromosome+conformation+capture:+controls,+controls,+controls.">The three 'C's of chromosome conformation capture: controls, controls, controls.</a> Nat Methods. 3, 17-21 (2006).</li></ol>

관심 없음 충돌 선언하지 않습니다.

데커 외가. 2 게놈 loci 1 사이의 상호 작용의 빈도를 감지하는 염색체 형태 캡처 (3C) 접근 방법을 개발하고, 3C는 포유 동물 세포이의 두 알려진 DNA 영역간에 내부 염색체 간 염색체 연관 관계를 조사하기 위해 광범위하게 사용되고 있습니다 -9. 새로 개발된 하이 - C 방법론은 게놈 전체 DNA 협회 연구를위한 적용할 수 있지만, ACT 분석은 여전히 로커스 특정 DNA 상호 작용 10-11의 연구를위한 효과적인 기술입니다. 우리는 교양 마우스와 인간의 세포 (그림 1)에서 알려진 DNA 영역과 관련된 알 수없는 DNA 영역을 식별하는 데이 방법을 수정했습니다. 그것이 우리에게 알려진 타겟 DNA 지역 12 연관 소설 알 수없는 DNA 파트너를 식별하는 신뢰성과 재현성 방법을 제공으로 우리는 관련된 염색체 트랩 (ACT) 분석이 방법을 지명했다. 적절한 컨트롤과 함께 성공적인 3C 분석은 ACT 분석 13 소설 측면을 실행하기 전에 수행됩니다. 가능한 많은 관련 DNA 영역으로 tofind 위해서는 첫 번째와 두 번째 제한 효소의 다양한 조합을 사용해야합니다. 그것은 최초의 3C 내고 단계를 수행하는 CPG methylation을 구별 제한 효소를 사용하는 특히 중요합니다. 단백질 결합과 DNA의 methylation은 또한 제한 효소 소화 효율에 영향을 미칠 수 있으며 특정 제한 효소 digestions에 대한 관련 DNA 영역의 결합의 실패로 이어질 수 있습니다. 내부 또는 상호 염색체 결합의 발생은 단백질 DNA 상호 연결과 관련된 DNA 지역 모두의 적절한 물리적지도에 따라 달라집니다. 따라서, 일부 예비 실험 ACT 분석에 사용할 수있는 효과적인 포름 알데히드 농도 및 처리 시간을 설정하는 데 반드시 필요합니다. 포름 알데히드 (from1.5 % 2 %)의 최종 농도의 범위는 분석 7,9의 3C 부분 동안 여러 실험실에서 사용되었습니다. 또는, linkers으로 사용 oligonucleotides는 두 번째 제한 효소로 잘라 응집 끝에 일치하도록 설계할 수 있습니다. 우리가 PCR의 두 번째 라운드에서 PCR과 20-25 사이클의 첫 번째 라운드에서 18-20 순환 분명히 밴드를 제공할 수있는 것을 발견하지만, 각 실험 (그림 2)에 대한 최고의 PCR 조건을 확립하는 것이 필요합니다. 내부 분자 DNA의 가닥이 PCR에서 발생할 수의 5&#39; 엔드 및 3&#39; - 최종 보완 어댑터 시퀀스 사이의 어닐링, 그것은 DNA 분자와 어닐링 어댑터 특정 뇌관을 억제하고, 처음 몇주기에서 훨씬 낮은 증폭 효율의 결과. 대상 DNA가주기에 대한 증폭 이후, 그 금액이 특이 현상이 반응보다 훨씬 클 수 있으며, 프라이머가 대상 DNA 분자로 어닐링의 경쟁을 촉진 수도 있습니다. 우리가 배경 증폭을보고, 왜 첫 라운드 PCR 제품은 PCR의 두 번째 라운드에서 배경을 감소하기 위해 PCR 반응에서 초과 primers를 제거하는 것이 중요합니다 배경 amplification.It을 감소 희석되어야 할 이유가 이것도 있습니다. 모든 PCR 기반의 실험에서와 마찬가지로, 그것은 인간 및 마우스의 DNA의 대부분을 구성하고 반복 시퀀스 지역에 거주하지 primers를 설계하는 것이 매우 중요합니다. 새로 개발된 하이 - C 방법론은 게놈 전체 DNA 협회 연구를위한 적용할 수 있지만, ACT 분석은 여전히​​ 로커스 특정 DNA의 상호 작용 연구를위한 효과적인 기술입니다.

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">	
		
		<div>
		<table border="1">
		<thead>
		<tr>
		<th>Material Name</th>
		<th>Type</th>
		<th>Company</th>
		<th>Catalogue Number</th>
		<th>Comment</th>
		</tr>
		</thead>
		<tbody>
		
<tr>
<td>RPMI1640 medium</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>22400-105</td>
<td>&nbsp;</td>
<tr>
<td>acrylamide</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>15512-023</td>
<td>&nbsp;</td>
<tr>
<td>ATP solution, 10mM</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>AM8110G</td>
<td>&nbsp;</td>
<tr>
<td>fetal bovine serum</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>16000-044</td>
<td>&nbsp;</td>
<tr>
<td>penicillin-streptomycin</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>15140-122</td>
<td>&nbsp;</td>
<tr>
<td>1M Tris pH8.0</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>AM9856</td>
<td>&nbsp;</td>
<tr>
<td>RNase A</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>12091-039</td>
<td>&nbsp;</td>
<tr>
<td>SDS</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>15525-017</td>
<td>&nbsp;</td>
<tr>
<td>urea</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>15505-035</td>
<td>&nbsp;</td>
<tr>
<td>BamH I</td>
<td>&nbsp;</td>
<td>NEB Biolabs</td>
<td>R0136T</td>
<td>&nbsp;</td>
<tr>
<td>Bgl II</td>
<td>&nbsp;</td>
<td>NEB Biolabs</td>
<td>R0144M</td>
<td>&nbsp;</td>
<tr>
<td>Dpn II</td>
<td>&nbsp;</td>
<td>NEB Biolabs</td>
<td>R0543T</td>
<td>&nbsp;</td>
<tr>
<td>Msp I</td>
<td>&nbsp;</td>
<td>NEB Biolabs</td>
<td>R0106S</td>
<td>&nbsp;</td>
<tr>
<td>dNTPs</td>
<td>&nbsp;</td>
<td>NEB Biolabs</td>
<td>N0447L</td>
<td>&nbsp;</td>
<tr>
<td>proteinase K</td>
<td>&nbsp;</td>
<td>NEB Biolabs</td>
<td>P8102S</td>
<td>&nbsp;</td>
<tr>
<td>T4 DNA ligase</td>
<td>&nbsp;</td>
<td>NEB Biolabs</td>
<td>M0202T</td>
<td>&nbsp;</td>
<tr>
<td>37% formaldehyde</td>
<td>&nbsp;</td>
<td>Sigma-Aldrich</td>
<td>F8775</td>
<td>&nbsp;</td>
<tr>
<td>Bis-acrylamide</td>
<td>&nbsp;</td>
<td>Sigma-Aldrich</td>
<td>146072</td>
<td>&nbsp;</td>
<tr>
<td>dithiothreitol</td>
<td>&nbsp;</td>
<td>Sigma-Aldrich</td>
<td>43815</td>
<td>&nbsp;</td>
<tr>
<td>glycine</td>
<td>&nbsp;</td>
<td>Sigma-Aldrich</td>
<td>50046</td>
<td>&nbsp;</td>
<tr>
<td>PMSF</td>
<td>&nbsp;</td>
<td>Sigma-Aldrich</td>
<td>93482</td>
<td>&nbsp;</td>
<tr>
<td>proteinase inhibitor</td>
<td>&nbsp;</td>
<td>Sigma-Aldrich</td>
<td>S8830</td>
<td>&nbsp;</td>
<tr>
<td>Nonidet P-40</td>
<td>&nbsp;</td>
<td>Roche Applied Science</td>
<td>11754599001</td>
<td>&nbsp;</td>
<tr>
<td>KlenTaq1</td>
<td>&nbsp;</td>
<td>Ab peptides</td>
<td>1001</td>
<td>&nbsp;</td>
<tr>
<td>dCTP alpha P32</td>
<td>&nbsp;</td>
<td>PerkinElmer</td>
<td>BLU513H250UC</td>
<td>&nbsp;</td>
<tr>
<td>PTC-100 Thermal Cycler</td>
<td>&nbsp;</td>
<td>MJ Research</td>
<td>mjptc100</td>
<td>&nbsp;</td>
<tr>
<td>Power Supply</td>
<td>&nbsp;</td>
<td>Bio-Rad</td>
<td>164-5056</td>
<td>&nbsp;</td>
<tr>
<td>OmniPAGE Maxi</td>
<td>&nbsp;</td>
<td>Aurogene Life Science</td>
<td>VS20D</td>
<td>&nbsp;</td>
<tr>
<td>Typhoon 9400</td>
<td>&nbsp;</td>
<td>GE Healthcare </td>
<td>63-0055-78</td>
<td>&nbsp;</td>		</tbody>
		</table>
		</div>

associated chromosome trap for identifying long-range dna interactions

DNA로 인코딩된 유전 정보는 복잡하고 고도의 규제 염색질 구조로 구성됩니다. 각각의 염색체는 개발 또는 세포주기의 단계에 따라 변경될 수 있습니다 특정 지역을 차지하고 있습니다. 유전자 발현은 전문 transcriptional 공장에서 발생할 수있는 염색질 세그먼트가 동일한 염색체에 멀리 떨어져 서로 다른 염색체 또는 존재할 수있는 DNA 세그먼트의 공동 현지에 이르는 다양한 염색체 지역에서 루프 밖으로 수 있습니다. 연결된 염색체 트랩 (ACT) 분석은 염색체 형태 캡처 기술을 확장하고 수정하여 편견 방식으로 이러한 장거리 DNA 연결을 확인하는 효과적인 방법을 제공합니다. ACT의 분석은 우리가 트랜스의 transcriptional 규제의 메커니즘을 조사하는 것이 가능하게하고, 정상적인 생리학 및 질병 상태 동안 유전자 발현에 핵 건축의 관계를 설명할 수 있습니다.

Watch this Scientific Journal Video about Associated Chromosome Trap for Identifying Long-range DNA Interactions at JoVE.com

Associated Chromosome Trap for Identifying Long-range DNA Interactions

관련된 염색체 트랩 (ACT) 분석은 장거리 DNA 상호 작용을 확인하는 소설 편견 방법입니다. 장거리 DNA 상호 작용의 특성은 우리가 정상적인 생리 모두와 질병 상태에서 유전자 발현에 핵 건축의 관계를 확인할 수 있습니다.

장거리 DNA의 상호 작용을 확인을위한 관련 염색체 트랩

Genetic information encoded by DNA is organized in a complex and highly regulated chromatin structure.  Each chromosome occupies a specific territory, ...

associated-chromosome-trap-for-identifying-long-range-dna-interactions

Research

JoVE Journal

Biology

14.4K 조회수.  Stanford University School of Medicine. 관련된 염색체 트랩 (ACT) 분석은 장거리 DNA 상호 작용을 확인하는 소설 편견 방법입니다. 장거리 DNA 상호 작용의 특성은 우리가 정상적인 생리 모두와 질병 상태에서 유전자 발현에 핵 건축의 관계를 확인할 수 있습니다.

비디오: Associated Chromosome Trap for Identifying Long-range DNA Interactions

Split-Ubiquitin Based Membrane Yeast Two-Hybrid (MYTH) System: A Powerful Tool For Identifying Protein-Protein Interactions

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput identification of protein-protein interactions (PPI) for full-length transmembrane proteins. To this end, our lab developed the split-ubiquitin based Membrane Yeast Two-Hybrid (MYTH) system. This technology allows for the sensitive detection of transient and stable protein interactions using Saccharomyces cerevisiae as a host organism. MYTH takes advantage of the observation that ubiquitin can be separated into two stable moieties: the C-terminal half of yeast ubiquitin (Cub) and the N-terminal half of the ubiquitin moiety (Nub). In MYTH, this principle is adapted for use as a 'sensor' of protein-protein interactions. Briefly, the integral membrane bait protein is fused to Cub which is linked to an artificial transcription factor. Prey proteins, either in individual or library format, are fused to the Nub moiety. Protein interaction between the bait and prey leads to reconstitution of the ubiquitin moieties, forming a full-length 'pseudo-ubiquitin' molecule. This molecule is in turn recognized by cytosolic deubiquitinating enzymes, resulting in cleavage of the transcription factor, and subsequent induction of reporter gene expression. The system is highly adaptable, and is particularly well-suited to high-throughput screening. It has been successfully employed to investigate interactions using integral membrane proteins from both yeast and other organisms.

Split-Ubiquitin Based Membrane Yeast Two-Hybrid MYTH System: A Powerful Tool For Identifying Protein-Protein Interactions

MYTH allows the sensitive detection of transient and stable interactions between proteins that are expressed in the model organism Saccharomyces cerevisiae. It has been successfully applied to study exogenous and yeast integral membrane proteins in order to identify their interacting partners in a high throughput manner.

분할 Ubiquitin 기반 막 효모 두 하이브리드 (신화) 시스템 : 단백질 단백질 상호 작용을 확인을위한 강력한 도구

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput ...

연구

생물학

Preparation of Drosophila Polytene Chromosome Squashes for Antibody Labeling

Drosophila has long been a favorite model system for studying the relationship between chromatin structure and gene regulation due to the cytological advantages provided by the giant salivary gland polytene chromosomes of third instar larvae.  In this tissue the chromosomes undergo many rounds of replication in the absence of cell division giving rise to approximately 1000 copies.  The DNA remains aligned after each replicative cycle resulting in greatly enlarged chromosomes that provide a unique opportunity to correlate chromatin morphology with the localization of specific proteins.  Consequently, there has been a high level of interest in defining the epigenetic modifications present at different genes and at different stages of the transcription process. An important tool for such studies is the labeling of polytene chromosomes with antibodies to the enzyme, transcription factor, or histone modification of interest. This video protocol illustrates the squash technique used in the Johansen laboratory to prepare Drosophila polytene chromosomes for antibody labeling.

This video protocol illustrates the squash technique used in the Johansen laboratory to prepare Drosophila polytene chromosomes for antibody labeling.

항체 라벨링에 대한 Drosophila Polytene의 염색체 Squashes의 준비

Drosophila has long been a favorite model system for studying the relationship between chromatin structure and gene regulation due to the cytological ...

Measuring the Bending Stiffness of Bacterial Cells Using an Optical Trap

We developed a protocol to measure the bending rigidity of filamentous rod-shaped bacteria. Forces are applied with an optical trap, a microscopic three-dimensional spring made of light that is formed when a high-intensity laser beam is focused to a very small spot by a microscope's objective lens. To bend a cell, we first bind live bacteria to a chemically-treated coverslip. As these cells grow, the middle of the cells remains bound to the coverslip but the growing ends are free of this restraint. By inducing filamentous growth with the drug cephalexin, we are able to identify cells in which one end of the cell was stuck to the surface while the other end remained unattached and susceptible to bending forces. A bending force is then applied with an optical trap by binding a polylysine-coated bead to the tip of a growing cell. Both the force and the displacement of the bead are recorded and the bending stiffness of the cell is the slope of this relationship.

We present a protocol for bending filamentous bacterial cells attached to a cover-slip surface with an optical trap to measure the cellular bending stiffness.

광학 트랩을 사용하여 박테리아 세포의 굽힘 강성을 측정

We developed a protocol to measure the bending rigidity of filamentous rod-shaped bacteria. Forces are applied with an optical trap, a microscopic ...

Chromosome Preparation From Cultured Cells

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as fluorescence in situ hybridization (FISH), this assay has the powerful ability to analyze individual cells for aberrations that involve gains or losses of portions of the genome&#160;and rearrangements involving one or more chromosomes. In humans, chromosome abnormalities occur in approximately 1 per 160 live births1,2, 60-80% of all miscarriages3,4, 10% of stillbirths2,5, 13% of individuals with congenital heart disease6, 3-6% of infertility cases2, and in many patients with developmental delay&#160;and birth defects7. Cytogenetic analysis of malignancy is routinely used by researchers and clinicians, as observations of clonal chromosomal abnormalities have been shown to have both diagnostic and prognostic significance8,9.&#160; Chromosome isolation is invaluable for gene therapy and stem cell research of organisms including nonhuman primates and rodents10-13.
Chromosomes can be isolated from cells of live tissues, including blood lymphocytes, skin fibroblasts, amniocytes, placenta, bone marrow, and tumor specimens. Chromosomes are analyzed at the metaphase stage of mitosis, when they are most condensed and therefore more clearly visible. The first step of the chromosome isolation technique involves the disruption of the spindle fibers by incubation with Colcemid, to prevent the cells from proceeding to the subsequent anaphase stage. The cells are then treated with a hypotonic solution and preserved in their swollen state with Carnoy&#39;s fixative. The cells are then dropped on to slides and can then be utilized for a variety of procedures. G-banding involves trypsin treatment followed by staining with Giemsa to create characteristic light and dark bands. The same procedure to isolate chromosomes can be used for the preparation of cells for procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY)14,15.

Chromosomes can be isolated from live cells such as lymphocytes or skin fibroblasts, and from organisms including humans or mice. These chromosome preparations can be further utilized for routine G-banding and molecular cytogenetic procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY).

배양 세포에서 염색체 준비

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

Here we describe the instrumentation and methods for detecting single fluorescently-labeled protein molecules interacting with a single DNA molecule suspended between two optically trapped microspheres.

단백질-DNA 상호 작용의 연구에 대한 단일 분자 조작 및 이미지를 결합

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

Combined DNA-RNA Fluorescent In situ Hybridization (FISH) to Study X Chromosome Inactivation in Differentiated Female Mouse Embryonic Stem Cells

Fluorescent in situ hybridization (FISH) is a molecular technique which enables the detection of nucleic acids in cells. DNA FISH is often used in cytogenetics and cancer diagnostics, and can detect aberrations of the genome, which often has important clinical implications. RNA FISH can be used to detect RNA molecules in cells and has provided important insights in regulation of gene expression. Combining DNA and RNA FISH within the same cell is technically challenging, as conditions suitable for DNA FISH might be too harsh for fragile, single stranded RNA molecules. We here present an easily applicable protocol which enables the combined, simultaneous detection of Xist RNA and DNA encoded by the X chromosomes. This combined DNA-RNA FISH protocol can likely be applied to other systems where both RNA and DNA need to be detected.

Combined DNA-RNA Fluorescent In situ Hybridization FISH to Study X Chromosome Inactivation in Differentiated Female Mouse Embryonic Stem Cells

Fluorescent in situ hybridization (FISH) allows the detection of nucleic acids in their native environment within cells. We here describe a protocol for the combined, simultaneous detection of RNA and DNA by means of FISH, which can be used to study X chromosome inactivation in mouse embryonic stem cells.

결합 된 DNA-RNA 형광<em&gt; 현장에서</em&gt; 하이브리드 화 (물고기) 차별화 된 여성 마우스 배아 줄기 세포에서 X 염색체의 불 활성화를 연구하는

Fluorescent in situ hybridization (FISH) is a molecular technique which enables the detection of nucleic acids in cells. DNA FISH is often used in ...

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

애기 장대 단백질 DNA 상호 작용의 식별을위한 염색질 면역 침전 분석<em&gt; 생체</em

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID-SEQ : 아데닌 - 메틸화 된 DNA 단편의 높은 처리량 시퀀싱에 의해 단백질 DNA 상호 작용의 게놈 넓은 매핑

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

레트로 바이러스 통합 사이트의 증폭, 차세대 시퀀싱 및 게놈 DNA 매핑

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision

Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5&#39; DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

Here, we present a protocol to achieve near base pair resolution of protein-DNA interactions. This is obtained by exonuclease treatment of DNA fragments selectively enriched by chromatin immunoprecipitation (ChIP-exo) followed by high throughput sequencing.