Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.

1 셀 난소 암 세포주의 문화와 형광 표지 <ol><li> SKOV3 매체를 준비 : 10 % 소 태아 혈청 (FBS)으로 보충 된 맥코이 매체는 0.1mm의 L-글루타민, 50 U / ㎖ 페니실린, 50 μg / ml의 스트렙토 마이신. 10 % FBS, 1 mM 피루브산 나트륨, 0.1 mM의의 L-글루타민, 50 U / ㎖의 페니실린으로 보충 된 최소 필수 매체 (MEM)에 OVCA429 세포 및 50 μg / ml의 스트렙토 마이신을 유지한다. </li><li> 5 % CO 2와 37 ° C에서 가습 배양기에서 293 및 OVCA429 세포주를 전파. 40-50%의 포화 상태로 세포를 성장. </li><li> 시험 관내 및 생체 내에서 생존 능력을 모니터하기 위해 적색 형광 단백질 (RFP)를 발현하는 세포를 생성한다. <ol><li> , RFP를 발현하는 293 세포를 생성하는 72 시간 동안 페니실린과 스트렙토 마이신의 부재에서 293 미디어에 RFP 및 10 μg / ㎖의 폴리 브렌을 표현 렌티 바이러스 입자를 추가합니다. </li><li> 72 시간 후, RFP에 대한 형광 활성화 된 셀 Sorti에 의해 양성 세포를 선택NG (FACS)를 다음과 같이 RFP를 Trypsinize의 비 RFP 발현 세포, 5 분 동안 125 XG에 원심 분리기, 0.1 % BSA를 함유하는 PBS에 107 세포 / ml로 재현 탁 세포. 셀 소터에 정렬 파라미터를 결정하는 비 - RFP 셀을 사용한다. 그런 다음 561 nm의 레이저를 사용하여 높은 R​​FP를 발현하는 세포를 수집합니다. </li><li> 렌티 바이러스 플라스미드는 항생제 내성 카세트를 발현하는 경우 또는, 적절한 항생제에서 배양함으로써 RFP 발현 세포에 대해 선택 (예 : 10 ㎎ / ㎖ 블라스트). 참고 : 일괄 처리 및 세포 유형에 따라 다를 수 있습니다 사용될 필요가 렌티 바이러스 입자의 양. 적정 렌티 바이러스 역가 각 세포 유형에 대해 결정되어야한다. </li></ol></li></ol> 암 줄기 세포의 2 심화 <ol><li> 72 시간 동안 시스플라틴의 20 μM과 293, 293-RFP 또는 OVCA429 세포 라인을 취급합니다. 주의 : 시스플라틴 독성이다. 보호 복 / 장갑을 사용하여 피부와 점막과의 접촉을 피하십시오. 시스플라틴 내가 처리하지 마십시오n 개의 폐수. </li><li> CSC 매체를 준비 : 무 혈청 DMEM / F12 매체 5㎍을 / ㎖ 인슐린, 10 ng의 / ml의 인간 재조합 표피 성장 인자 (EGF), 10 ng의 / ㎖ 염기성 섬유 아세포 성장 인자 (bFGF), 12 ng의 / ㎖ 백혈병 억제 인자로 보충 및 0.4 % 소 혈청 알부민 (BSA). </li><li> 를 Trypsinize 세포. 문화 CSC 미디어에서 세포 생존. 참고 : 문화 비 부착 회전 타원체에서 이일이 형성됩니다 후. </li><li> 미디어 세포를 포함하고 5 분 동안 125 XG에서 원심 분리 수집하여 모든 이일 미디어를 변경합니다. 그리고 신선한 CSC 미디어에서 펠렛을 재현 탁. 세포를 계산 및 트리 판 블루 배제를 수행하여 모든 이일 생존을 위해 세포를 확인합니다. </li><li> (: 137 밀리미터의 NaCl, 2.7 mM의 KCl을, 11.9 mM의 인산염 완충액 pH 7.4의 PBS)와 그 다음 5 분 동안 129 XG를 원심 분리 및 페놀 함유 아니 디늄 thiocynate (RNA), 인산염 완충 생리 식염수에 펠렛을 재현 탁하여 추가 실험을위한 암줄 기세포를 수집 (유동 세포 계측법에 대한) 0.1 % BSA, 또는 CSC 매체는 계속세포를 배양. </li><li> 20 배와 40 배 배율 광학 현미경을 사용하여 CSC의 세포 형태를 모니터링합니다. </li></ol> 줄기 세포 마커에 대한 유전자 발현 분석을 통해 3 CSC의 특성 <ol><li> 매체는 5 분 동안 129 XG에서 원심 분리, 세포를 포함하는 수집, 및 페놀 함유 아니 디늄 thiocynate의 용액에 펠릿을 재현 탁하여 CSC 추가의 3 제제를 수집 (RNA 추출을위한 다른 방법이 사용될 수있다). </li><li> 제조 업체의 프로토콜에 따라 트리 졸 사용하여 총 RNA를 준비합니다. 시판 cDNA를 역전사 키트를 사용하여 RNA 0.1 μg으로부터의 상보 적 DNA (cDNA를)를 합성한다. </li><li> 정량 역전사 중합 효소 연쇄 반응 (QRT-PCR)을 수행한다. <ol><li> 샘플 당 8 μl를 총 QRT-PCR 믹스, 프라이머, 및 물을 포함하는 프라이머의 각 세트에 대한 마스터 믹스를 확인합니다 (다른 형광체와 프라이머는 같은 잘에서 증폭 할 수 있습니다.) 예를 들어, 생성인 Oct4-FAM, Nanog를 16 진수 및 GAPDH-CY5에 대한 하나의 마스터 믹스. 네 스틴 및 Prom1에 대해 별도의 마스터 믹스를 생성합니다. 샘플 당 cDNA를 템플릿의 2 μl를 추가합니다. NOTE : 본 연구를 위해 QRT-PCR은 표 1에 프라이머를 사용하여 수행 하였다. </li><li> 다중 형광을 검출 할 수있는 실시간 PCR 용 열 순환기를 사용하여 각 샘플에 대해 중복 모든 QRT-PCR을 수행한다. 어떤 템플릿 컨트롤을 포함하지 않습니다. </li><li> ΔΔC T 방법을 사용하여 각 샘플에 대해 GAPDH 발현에 줄기 세포의 유전자 발현을 정규화한다. </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0" width="746"><colgroup><col /><col /></colgroup><tbody><tr height="21"><td height="63" rowspan="3" style="height:62px;width:111px;"> 월 4-FAM </td><td style="width:636px;"> 프라이머 1 : 5&#39;-CCCAAGGAATAGTCTGTAGAAGTG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-TGCATGAGTCAGTGAACAGG-3 &#39;</td></tr><tr height="21"><td height="21" style="height:21px;"> FAM 프로브 : 5&#39;-CTTCCAAGC / ZEN / TG​​CCCACCTAACTTCT / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> NANOG-HEX </td><td> 프라이머 1 : 5&#39;-CCTTCTGCGTCACACCATT-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-AACTCTCCAACATCCTGAACC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> HEX 프로브 : 5&#39;-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> GAPDH-CY5 </td><td> 프라이머 1 : 5&#39;-TGTAGTTGAGGTCAATGAAGGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-ACATCGCTCAGACACCATG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> CY5 프로브 : 5&#39;-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 &#39; </td><html></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> 네 스틴-FAM </td><td> 프라이머 1 : 5&#39;-AGGACCTGAGCGATCTGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-CGTTGGAACAGAGGTTGGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> FAM 프로브 : 5&#39;-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> CD133-HEX </td><td> 프라이머 1 : 5&#39;-ACTCTCTCCAACAATCCATTCC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> 프라이머 2 : 5&#39;-AAACAATTCACCAGCAACGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> HEX 프로브 : 5&#39;-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 </td></tr></tbody></table> QRT-PCR에 의한 CSC 특성에 사용되는 표 1 프라이머. e_title &quot;&gt; 4. 세포 표면 마커 CD117 및 CD133에 대한 분석 암줄 기세포 <ol><li> 미디어 세포를 포함하고 5 분 동안 125 XG에서 원심 분리에 의해 수확 된 CSC 수집. 해체하는 세포를 비 단백질 분해 세포 분리 용액 500 μl를 추가합니다. 5 분 동안 125 XG에 원심 세포 세포 분리 용액을 제거한다. 그런 다음 차가운 PBS로 두 번 세포를 씻으십시오. </li><li> 종래 라벨링 셀 1 시간 동안 정상적인 성장 배지에서 배양한다. 129의 X g에서 5 분 동안 세포를 스핀 다운. 항-CD133-PE 및 항-CD117-FITC와 함께 0.1 % BSA와 함께 PBS에 세포를 재현 탁. </li><li> 1 % 파라 포름 알데히드 하룻밤 세포를 수정. 주의 : 파라 포름 알데히드는 독성 (발암 물질로 의심)입니다. 흄 후드에서 확인하고 주일 이내에 사용한다. </li><li> (PE에 접합 된 항-CD133)와 CD133 및 플로우 사이토 미터에 세포 표면 발현 (FITC에 접합 된 항-CD117)와 CD117를 분석하기 위해 유세포 분석기를 수행한다. 채널 (PE 용) (FITC에 대한) FL1과 FL3 세포에서 데이터를 수집 할 수 있습니다. 모두 발현하는 세포에 대한 게이트를 생성FITC와 PE. 4 사분면 (FITC- 및 PE-, FITC + PE-, FITC- PE + 및 FITC + 및 PE +)와 도트 플롯을 생성하고 각 사분면에 세포의 수를 결정합니다. </li></ol> (5) 치료 반응에 대한 암줄 기세포 분석 <ol><li> 플레이트 하룻밤 96 웰 플레이트에 5,000 셀 아니라 당 (293, 293-RFP, 293 CSC와 293-RFP 암줄 기세포). </li><li> 96 시간 동안 시스플라틴 (0, 1, 10, 100 및 1000 μM) 또는 파클리탁셀 (0, 0.01, 0.1, 1, 10 및 100 μM)로 처리. </li><li> MTT (3 - (4,5 - 디메틸 -2 - 일) -2,5 - 디 페닐 테트라 졸륨 브로마이드) 세포 생존 분석을 수행한다. <ol><li> 96 웰 플레이트에 잘 당 100 μL 당 플레이트 5000 세포 (중복에 판 세포와 미디어는 우물을 제어 포함). </li><li> 24 시간 후, 10 ㎎ / ㎖ MTT의 10 μl를 추가합니다. (침전물이 형성 될 때까지) 2-4 시간 동안 37 ° C에서 품어. </li><li> MTT 용매 4 mM의 염산 100 ㎕, 이소프로판올 0.1 % NP-40을 추가합니다. 어둠 속에서 15 분 동안 품어. </li><li> 접시의 연구에 570 nm에서 판을 읽고eader. </li></ol></li></ol>

<ol>
	<li>Pennington, K., Pulaski, H., Pennington, M., Liu, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Too+Much+of+a+Good+Thing:+Suicide+Prevention+Promotes+Chemoresistance+in+Ovarian+Carcinoma.">Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in Ovarian Carcinoma.</a> Curr Cancer Drug Targets. 10, 575-583 (2010).</li><li>Thigpen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rational+approach+to+the+management+of+recurrent+or+persistent+ovarian+carcinoma.">A rational approach to the management of recurrent or persistent ovarian carcinoma.</a> Clin Obstet Gynecol. 55, 114-130 (2012).</li><li>Burgos-Ojeda, D., Rueda, B. R., Buckanovich, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem+cell+markers:+prognostic+and+therapeutic+implications.">Ovarian cancer stem cell markers: prognostic and therapeutic implications.</a> Cancer letters. 322, 1-7 (2012).</li><li>Ma, L., Lai, D., Liu, T., Cheng, W., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem-like+cells+can+be+isolated+with+drug+selection+in+human+ovarian+cancer+cell+line+SKOV3.">Cancer stem-like cells can be isolated with drug selection in human ovarian cancer cell line SKOV3.</a> Acta Biochim Biophys Sin (Shanghai). 42, 593-602 (2010).</li><li>Bonnet, D., Dick, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+acute+myeloid+leukemia+is+organized+as+a+hierarchy+that+originates+from+a+primitive+hematopoietic+cell.">Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.</a> Nature Medicine. 3, 730-737 (1997).</li><li>Alison, M. R., Lim, S. M., Nicholson, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells:+problems+for+therapy.">Cancer stem cells: problems for therapy.</a> The Journal of pathology. 223, 147-161 (2011).</li><li>Luo, X., Dong, Z., Chen, Y., Yang, L., Lai, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+ovarian+cancer+stem-like+cells+is+associated+with+epithelial+to+mesenchymal+transition+through+an+miRNA-activated+AKT+pathway.">Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal transition through an miRNA-activated AKT pathway.</a> Cell proliferation. 46, 436-446 (2013).</li><li>Wang, L., Mezencev, R., Bowen, N. J., Matyunina, L. V., McDonald, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+stem-like+cells+from+a+human+ovarian+cancer+cell+line.">Isolation and characterization of stem-like cells from a human ovarian cancer cell line.</a> Molecular and cellular biochemistry. 363, 257-268 (2012).</li><li>Abubaker, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+single+treatment+of+chemotherapy+results+in+the+enrichment+of+ovarian+cancer+stem+cell-like+cells+leading+to+an+increased+tumor+burden.">Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden.</a> Molecular cancer. 12, 24 (2013).</li><li>Conic, I., Dimov, I., Tasic-Dimov, D., Djordjevic, B., Stefanovic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+epithelial+cancer+stem+cells.">Ovarian epithelial cancer stem cells.</a> ScientificWorldJournal. 11, 1243-1269 (2011).</li><li>Liu, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem-like+cells+show+induced+translineage-differentiation+capacity+and+are+suppressed+by+alkaline+phosphatase+inhibitor.">Ovarian cancer stem-like cells show induced translineage-differentiation capacity and are suppressed by alkaline phosphatase inhibitor.</a> Oncotarget. 4 (12), 2366-2382 (2013).</li><li>Liu, T., Cheng, W., Lai, D., Huang, Y., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+ovarian+cancer+cells+in+different+culture+systems.">Characterization of primary ovarian cancer cells in different culture systems.</a> Oncology reports. 23, 1277-1284 (2010).</li></ol>

The authors declare they have no competing financial interest.

치료에 저항하는 암줄 기세포 차 종양의 치료 후 재발에 대한 책임을 질 수 있습니다. 암줄 기세포의 특성은 난소 암에 대한 개선 된 치료법으로 이어질 수 있습니다. 상기 프로토콜을 사용 chemoresistant 된 CSC의 확립에 중요한 파라미터는 화학 요법 치료의 길이 및 화학 요법 농도 타이밍된다. 엄마 외의 프로토콜을 사용하는 경우. 그것은 시스플라틴과 파클리탁셀 치료의 칠일 후에 더 가능?...

Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4. 
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Name of Reagent/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">McCoy</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">16600-108</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">DMEM / F12 serum free</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td style="width:119px;">11320-033</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Minimal Essential Media</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td>42360032</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Sodium Pyruvate</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/11360070">11360070</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Polybrene</td>
			<td style="width:71px;">Millipore</td>
			<td>TR-1003-G</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Blasticidin</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/R21001">R21001</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Fetal Bovine Serum&#160;</td>
			<td style="width:71px;">Atlas Biologicals</td>
			<td style="width:119px;">F-0500-A</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Penicillin-streptomycin&#160;</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15070-063</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Cisplatin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T7402-5MG</td>
			<td style="width:167px;">Caution: Toxic Use precautions</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">pLenti-suCMV-Rsv</td>
			<td style="width:71px;">Gentarget</td>
			<td style="width:119px;">LVP023</td>
			<td style="width:167px;">BSL2 approval needed</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Insulin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">I-1882</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Human Recombinant EGF&#160;</td>
			<td style="width:71px;">Cell Signaling Technology</td>
			<td style="width:119px;">8916LC</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">bFGF</td>
			<td style="width:71px;">BD biosciences</td>
			<td style="width:119px;">354060</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="20">
			<td height="41" rowspan="2" style="height:41px;width:216px;">LIF</td>
			<td rowspan="2" style="width:71px;">Santa Cruz</td>
			<td rowspan="2" style="width:119px;">sc-4988A</td>
			<td rowspan="2" style="width:167px;"></td>
		</tr>
		<tr height="21">
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Bovine Serum Albumin</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">03 116 956 001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">TRIzol</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15596-018</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">High Capacity cDNA Reverse Transcription Kit&#160;&#160;</td>
			<td style="width:71px;">Applied Biosystems</td>
			<td style="width:119px;">4368813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">IQ Multiplex Powermix</td>
			<td style="width:71px;">BioRad</td>
			<td style="width:119px;">1725849</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Accumax</td>
			<td style="width:71px;">Millipore</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Primers</td>
			<td style="width:71px;">Integrated DNA Technology</td>
			<td style="width:119px;">individually designed and ordered (see protocol for sequnces)</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Anti-CD133 PE</td>
			<td style="width:71px;">Milenyl</td>
			<td>130-098-826</td>
			<td style="width:167px;">Primer/probe sets are light sensitive</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">CD117-Biotin</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">AntiBiotin-FITC</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td>P6148-1KG</td>
			<td style="width:167px;">Caution: Toxic always prepare in hood and make fresh.</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Trypsin</td>
			<td style="width:71px;">Life Technologies</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/25300062">25300062</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">MTT (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide)&#160;</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">25200-072</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">EVOS Fl Epifluorescence and Transmitted Light Microscope</td>
			<td>Advanced Microscopy Group</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Biorad CFX96 C1000 System</td>
			<td style="width:71px;">Biorad</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">Beckman Coulter FC500 Flow Cytometer&#160;</td>
			<td style="width:71px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Spectramax 340PC384&#160;</td>
			<td style="width:71px;">Molecular Devices</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

enrichment for chemoresistant ovarian cancer stem cells from human cell lines

암 줄기 세포 (CSC 추가)는 느린 사이클 및 높은 증식 침습적 생성하는 비대칭 분할 미분화 세포 및 chemoresistant 종양 세포의 서브 세트로서 정의된다. 따라서 암줄 기세포는 치료 대상으로 세포의 매력적인 인구입니다. CSC 추가는 혈액, 뇌, 폐, 위장관, 전립선, 난소 및 사람들을 포함한 종양의 종류의 수에 기여할 것으로 예측된​​다. 격리하고 암줄 기세포에 대한 종양 세포의 인구는 암줄 기세포의 특성, 유전학 및 치료 반응을 연구하는 연구원을 가능하게 할 것이다 풍부. 우리는 재현성 난소 암 세포주 (SKOV3 및 OVCA429)에서 난소 암 된 CSC위한 풍요롭게 프로토콜을 생성. 셀 라인은 삼일에 20 μM 시스플라틴으로 처리됩니다. 살아남은 세포는 사이토 카인 및 성장 인자를 포함하는 무 혈청 줄기 세포 배지에서 배양하고 절연한다. 우리는 K 용 절연 세포를 분석하여 이들의 정제 된 CSC의 농축을 보여nown 세포 마커 인 Oct4, Nanog를하고 Prom1 (CD133) 및 CD177 및 CD133의 세포 표면 발현을 줄기. 암줄 기세포 전시 chemoresistance 증가했다. 암줄 기세포의 분리를위한이 방법은 chemoresistance 종양 재발에 암줄 기세포의 역할을 연구하는데 유용한 도구입니다.

우리는 시스플라틴 치료를 이용한 난소 암 세포주에서 고립 된 CSC를 입증하기 위해, 우리는 먼저 사전 처리 및 선택 후 세포 라인의 이미지를 획득. 우리는 부착 (치료) 293 및 OVCA429 세포와 293 및 OVCA429 암줄 기세포 (그림 1)의 이미지를 캡처하기 위해 광학 현미경을 사용했다. CSC 추가는 조직 배양 접시에 부착하지 둥근 표시 (도 1 및도 2). 우리는 더 RFP 형질 293 세포는 세포 ...

Watch this Scientific Journal Video about Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines at JoVE.com

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

암 줄기 세포 (암줄 기세포는) 때문에 chemoresistance에 종양 재발에 관여하고 있습니다. 우리는 선택 및 난소 암 세포주에서의 확장 된 CSC 프로토콜을 최적화했다. 화학 요법 시스플라틴 세포를 치료하고 우리는 비 부착 CSC 문화에 대한 풍부 미디어를 홍보 줄기 세포에서 배양.

인간 세포주에서 Chemoresistant 난소 암 줄기 세포에 대한 심화 학습

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

enrichment-for-chemoresistant-ovarian-cancer-stem-cells-from-human

Research

JoVE Journal

Medicine

13.4K 조회수.  Indiana University School of Medicine.  암 줄기 세포 (암줄 기세포는) 때문에 chemoresistance에 종양 재발에 관여하고 있습니다. 우리는 선택 및 난소 암 세포주에서의 확장 된 CSC 프로토콜을 최적화했다. 화학 요법 시스플라틴 세포를 치료하고 우리는 비 부착 CSC 문화에 대한 풍부 미디어를 홍보 줄기 세포에서 배양. 

비디오: Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Isolation of Cardiomyocyte Nuclei from Post-mortem Tissue

Identification of cardiomyocyte nuclei has been challenging in tissue sections as most strategies rely only on cytoplasmic marker proteins1. Rare events in cardiac myocytes such as proliferation and apoptosis require an accurate identification of cardiac myocyte nuclei to analyze cellular renewal in homeostasis and in pathological conditions2. Here, we provide a method to isolate cardiomyocyte nuclei from post mortem tissue by density sedimentation and immunolabeling with antibodies against pericentriolar material 1 (PCM-1) and subsequent flow cytometry sorting. This strategy allows a high throughput analysis and isolation with the advantage of working equally well on fresh tissue and frozen archival material. This makes it possible to study material already collected in biobanks. This technique is applicable and tested in a wide range of species and suitable for multiple downstream applications such as carbon-14 dating3, cell-cycle analysis4, visualization of thymidine analogues (e.g. BrdU and IdU)4, transcriptome and epigenetic analysis.

Cardiac nuclei are isolated via density sedimentation and immunolabeled with antibodies against pericentriolar material 1 (PCM-1) to identify and sort cardiomyocyte nuclei by flow cytometry.

사후 조직에서 Cardiomyocyte 핵의 분리

Identification of cardiomyocyte nuclei has been challenging in tissue sections as most strategies rely only on cytoplasmic marker proteins1. Rare events ...

연구

의학

Human Neuroendocrine Tumor Cell Lines as a Three-Dimensional Model for the Study of Human Neuroendocrine Tumor Therapy

Neuroendocrine tumors (NETs) are rare tumors, with an incidence of two per 100,&#x200A;000 individuals per year, and they account for 0.5% of all human malignancies.1 Other than surgery for the minority of patients who present with localized disease, there is little or no survival benefit of systemic therapy. Therefore, there is a great need to better understand the biology of NETs, and in particular define new therapeutic targets for patients with nonresectable or metastatic neuroendocrine tumors. 3D cell culture is becoming a popular method for drug screening due to its relevance in modeling the in vivo tumor tissue organization and microenvironment.2,3 The 3D multicellular spheroids could provide valuable information in a more timely and less expensive manner than directly proceeding from 2D cell culture experiments to animal (murine) models.
To facilitate the discovery of new therapeutics for NET patients, we have developed an in vitro 3D multicellular spheroids model using the human NET cell lines. The NET cells are plated in a non-adhesive agarose-coated 24-well plate and incubated under physiological conditions (5% CO2, 37 &deg;C) with a very slow agitation for 16-24 hr after plating. The cells form multicellular spheroids starting on the 3rd or 4th day. The spheroids become more spherical by the 6th day, at which point the drug treatments are initiated. The efficacy of the drug treatments on the NET spheroids is monitored based on the morphology, shape and size of the spheroids with a phase-contrast light microscope. The size of the spheroids is estimated automatically using a custom-developed MATLAB program based on an active contour algorithm. Further, we demonstrate a simple method to process the HistoGel embedding on these 3D spheroids, allowing the use of standard histological and immunohistochemical techniques. 
This is the first report on generating 3D spheroids using NET cell lines to examine the effect of therapeutic drugs. We have also performed histology on these 3D spheroids, and displayed an example of a single drug's effect on growth and proliferation of the NET spheroids. Our results support that the NET spheroids are valuable for further studies of NET biology and drug development.

We present a simple agarose overlay platform to grow 3D multicellular spheroids using neuroendocrine cancer cell lines. This method provides a very convenient way to examine the effect of therapeutic drugs on the neuroendocrine tumor cells. It could also help us establish human neuroendocrine tumor spheroids for cancer therapy.

인간 Neuroendocrine 종양 치료의 연구를위한 3 차원 모델로 인간 Neuroendocrine 종양 세포 라인

Neuroendocrine tumors (NETs) are rare tumors, with an incidence of two per 100,&#x200A;000 individuals per year, and they account for 0.5% of all human ...

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

인간 치과 펄프의 줄기 세포의 분리, 특성화 및 비교 차별화 두 가지 방법을 사용하여 영구 치아에서 파생

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Time-lapse Imaging of Primary Preneoplastic Mammary Epithelial Cells Derived from Genetically Engineered Mouse Models of Breast Cancer

Time-lapse imaging can be used to compare behavior of cultured primary preneoplastic mammary epithelial cells derived from different genetically engineered mouse models of breast cancer. For example, time between cell divisions (cell lifetimes), apoptotic cell numbers, evolution of morphological changes, and mechanism of colony formation can be quantified and compared in cells carrying specific genetic lesions. Primary mammary epithelial cell cultures are generated from mammary glands without palpable tumor. Glands are carefully resected with clear separation from adjacent muscle, lymph nodes are removed, and single-cell suspensions of enriched mammary epithelial cells are generated by mincing mammary tissue followed by enzymatic dissociation and filtration. Single-cell suspensions are plated and placed directly under a microscope within an incubator chamber for live-cell imaging. Sixteen 650 &mu;m x 700 &mu;m fields in a 4x4 configuration from each well of a 6-well plate are imaged every 15 min for 5 days. Time-lapse images are examined directly to measure cellular behaviors that can include mechanism and frequency of cell colony formation within the first 24 hr of plating the cells (aggregation versus cell proliferation), incidence of apoptosis, and phasing of morphological changes. Single-cell tracking is used to generate cell fate maps for measurement of individual cell lifetimes and investigation of cell division patterns. Quantitative data are statistically analyzed to assess for significant differences in behavior correlated with specific genetic lesions.

Time-lapse imaging is used to assess behavior of primary preneoplastic mammary epithelial cells derived from genetically engineered mouse models of breast cancer risk to determine if there are correlations between specific behavioral parameters and distinct genetic lesions.

기본 Preneoplastic 유방 상피 세포의 시간 경과 영상은 유방암의 유전자 변형 마우스 모델에서 파생

Time-lapse  imaging can be used to compare behavior of cultured primary preneoplastic  mammary epithelial cells derived from different genetically ...

Patient Derived Cell Culture and Isolation of CD133+ Putative Cancer Stem Cells from Melanoma

Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for progression-free and overall survival. Therefore, translational research needs to provide further molecular evidence to improve targeted therapies for malignant melanomas. In the past, oncogenic mechanisms related to melanoma were extensively studied in established cell lines. On the way to more personalized treatment regimens based on individual genetic profiles, we propose to use patient-derived cell lines instead of generic cell lines. Together with high quality clinical data, especially on patient follow-up, these cells will be instrumental to better understand the molecular mechanisms behind melanoma progression.
Here, we report the establishment of primary melanoma cultures from dissected fresh tumor tissue. This procedure includes mincing and dissociation of the tissue into single cells, removal of contaminations with erythrocytes and fibroblasts as well as primary culture and reliable verification of the cells' melanoma origin.
Recent reports revealed that melanomas, like the majority of tumors, harbor a small subpopulation of cancer stem cells (CSCs), which seem to exclusively fuel tumor initiation and progression towards the metastatic state. One of the key markers for CSC identification and isolation in melanoma is CD133. To isolate CD133+ CSCs from primary melanoma cultures, we have modified and optimized the Magnetic-Activated Cell Sorting (MACS) procedure from Miltenyi resulting in high sorting purity and viability of CD133+ CSCs and CD133- bulk, which can be cultivated and functionally analyzed thereafter.

Patient Derived Cell Culture and Isolation of CD133+ Putative Cancer Stem Cells from Melanoma

This article describes the preparation of freshly obtained melanoma tissue into primary cell cultures, and how to remove contaminations of erythrocytes and fibroblasts from the tumor cells. Finally, we describe how CD133+ putative melanoma stem cells are sorted from the CD133- bulk using Magnetic Activated Cell Sorting (MACS).

환자 유래 세포 배양 및 CD133의 절연<sup&gt; +</sup흑종에서&gt; Putative 암 줄기 세포

Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for ...

Isolation of Cancer Stem Cells From Human Prostate Cancer Samples

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly isolated from human tissues and serially propagated in immunodeficient mice, typically through antibody labeling of subpopulations of cells and fractionation by flow cytometry. However, the unique clinical features of prostate cancer have considerably limited the study of prostate CSCs from fresh human tumor samples. We recently reported the isolation of prostate CSCs directly from human tissues by virtue of their HLA class I (HLAI)-negative phenotype. Prostate cancer cells are harvested from surgical specimens and mechanically dissociated. A cell suspension is generated and labeled with fluorescently conjugated HLAI and stromal antibodies. Subpopulations of HLAI-negative cells are finally isolated using a flow cytometer. The principal limitation of this protocol is the frequently microscopic and multifocal nature of primary cancer in prostatectomy specimens. Nonetheless, isolated live prostate CSCs are suitable for molecular characterization and functional validation by transplantation in immunodeficient mice.

The isolation of cancer stem cells (CSCs) directly from human tissues is requisite for their biological characterization. This manuscript describes a methodology for the isolation of prostate CSCs from human tissues, while also providing tips on troubleshooting difficult steps.

인간의 전립선 암 샘플에서 암 줄기 세포의 분리

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly ...

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a valuable tool for understanding ovarian cancer, their use has many limitations. These include the lack of heterogeneity and the plethora of genetic alterations associated with extended in vitro passaging.&#160;Here we describe a method that allows for rapid establishment of primary ovarian cancer cells form solid clinical specimens collected at the time of surgery. The method consists of subjecting clinical specimens to enzymatic digestion for 30 min. The isolated cell suspension is allowed to grow and can be used for downstream application including drug screening. The advantage of primary ovarian cancer cell lines over established ovarian cancer cell lines is that they are representative of the original specific clinical specimens they are derived from and can be derived from different sites whether primary or metastatic ovarian cancer.

This study describes a detailed method for isolation and characterization of primary ovarian cancer cells from solid clinical specimens. Ovarian cancer clinical specimens are subjected to enzymatic digestion to obtain viable, fibroblast-free epithelial ovarian cancer (EOC) cells highly suitable for downstream applications.

고체 시편에서 기본 난소 암 세포를 얻는 방법

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a ...

Evaluation of Stem Cell Properties in Human Ovarian Carcinoma Cells Using Multi and Single Cell-based Spheres Assays

Years of research indicates that ovarian cancers harbor a heterogeneous mixture of cells including a subpopulation of so-called &#8220;cancer stem cells&#8221; (CSCs) responsible for tumor initiation, maintenance and relapse following conventional chemotherapies. Identification of ovarian CSCs is therefore an important goal. A commonly used method to assess CSC potential in vitro is the spheres assay in which cells are plated under non-adherent culture conditions in serum-free medium supplemented with growth factors and sphere formation is scored after a few days. Here, we review currently available protocols for human ovarian cancer spheres assays and perform a side-by-side analysis between commonly used multi cell-based assays and a more accurate system based on single cell plating. Our results indicate that both multi cell-based as well as single cell-based spheres assays can be used to investigate sphere formation in vitro. The more laborious and expensive single cell-based assays are more suitable for functional assessment of individual cells and lead to overall more accurate results while multi cell-based assays can be strongly influenced by the density of plated cells and require titration experiments upfront. Methylcellulose supplementation to multi cell-based assays can be effectively used to reduce mechanical artifacts.

In vitro spheres assays are commonly used to identify cancer stem cells. Here we compare single with multi cell-based spheres assays. The more laborious single cell-based assays or methylcellulose supplementation give more accurate results while multi cell-based assays performed in liquid medium can be highly influenced by cell density.

다중 및 단일 세포 기반 분야 분석 실험을 사용하여 인간의 난소 암 세포의 줄기 세포 특성의 평가

Years of research indicates that ovarian cancers harbor a heterogeneous mixture of cells including a subpopulation of so-called &#8220;cancer stem ...

In vitro Enrichment of Ovarian Cancer Tumor-initiating Cells

Evidence suggests that small subpopulations of tumor cells maintain a unique self-renewing and differentiation capacity and may be responsible for tumor initiation and/or relapse. Clarifying the mechanisms by which these tumor-initiating cells (TICs) support tumor formation and progression could lead to the development of clinically favorable therapies. Ovarian cancer is a heterogeneous and highly recurrent disease. Recent studies suggest TICs may play an important role in disease biology. We have identified culture conditions that enrich for TICs from ovarian cancer cell lines. Growing either adherent cells or non-adherent &#8216;floater&#8217; cells in a low attachment plate with serum free media in the presence of growth factors supports the propagation of ovarian cancer TICs with stem cell markers (CD133 and ALDH activity) and increased tumorigenicity without the need to physically separate the TICs from other cell types within the culture. Although the presence of floater cells is not common for all cell lines, this population of cells with innate low adherence may have high tumorigenic potential.Compared to adherent cells grown in the presence of serum, TICs readily form spheres, are significantly more tumorigenic in mice, and express putative stem cell markers. The conditions are easy to establish in a timely manner and can be used to study signaling pathways important for maintaining stem characteristics, and to identify drugs or combinations of drugs targeting TICs. The culture conditions described herein are applicable for a variety of ovarian cancer cells of epithelial origin and will be critical in providing new information about the role of TICs in tumor initiation, progression, and relapse.

In vitro Enrichment of Ovarian Cancer Tumor-initiating Cells

Tumor-initiating cells (TICs) may represent a viable therapeutic target for the treatment of ovarian cancer, a highly recurrent and fatal disease. We present a protocol for culture conditions that enrich for this highly tumorigenic population of cells.

난소 암 종양 시작 세포의 생체 농축에

Evidence suggests that small subpopulations of tumor cells maintain a unique self-renewing and differentiation capacity and may be responsible for tumor ...

Mammosphere Formation Assay from Human Breast Cancer Tissues and Cell Lines

Similar to healthy tissues, many blood and solid malignancies are now thought to be organised hierarchically, with a subset of stem-like cancer cells that self-renew while giving rise to more differentiated progeny. Understanding and targeting these cancer stem cells in breast cancer, which may possess enhanced chemo- and radio-resistance compared to the non-stem tumor bulk, has become an important research area. Markers including CD44, CD24, and ALDH activity can be assessed using fluorescence activated cell sorting (FACS) to prospectively isolate cells that display enhanced tumorigenicity when implanted into immunocompromised mice: the mammosphere assay has also become widely used for its ability to retrospectively identify sphere-forming cells that develop from single stem cell-like clones. Here we outline approaches for the appropriate culturing of mammospheres from cell lines or primary patient samples, their passaging, and calculations to estimate sphere forming efficiency (SFE). First we discuss key considerations and pitfalls in the appropriate planning and interpretation of mammosphere experiments.

Floating mammosphere assays can investigate the subset of stem-like breast cancer cells that survive in suspension conditions and show enhanced tumorigenesis when implanted into mice. This protocol provides a convenient in vitro measure of sphere-forming ability, a proxy for in vivo tumorigenesis, while facilitating analysis of the stem-associated transcriptional landscape.

인간 유방암 조직과 세포주에서 Mammosphere 형성 분석

Similar to healthy tissues, many blood and solid malignancies are now thought to be organised hierarchically, with a subset of stem-like cancer cells that ...