Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example

Summary

Here we use a polyurethane tunable nanopore integrated into a resistive pulse sensing technique to characterize nanoparticles surface chemistry via the measurement of particle translocation velocities, which can be used to determine the zeta potential of individual nanoparticles.

Abstract

Nanopore technologies, known collectively as Resistive Pulse Sensors (RPS), are being used to detect, quantify and characterize proteins, molecules and nanoparticles. Tunable resistive pulse sensing (TRPS) is a relatively recent adaptation to RPS that incorporates a tunable pore that can be altered in real time. Here, we use TRPS to monitor the translocation times of DNA-modified nanoparticles as they traverse the tunable pore membrane as a function of DNA concentration and structure (i.e., single-stranded to double-stranded DNA).

TRPS is based on two Ag/AgCl electrodes, separated by an elastomeric pore membrane that establishes a stable ionic current upon an applied electric field. Unlike various optical-based particle characterization technologies, TRPS can characterize individual particles amongst a sample population, allowing for multimodal samples to be analyzed with ease. Here, we demonstrate zeta potential measurements via particle translocation velocities of known standards and apply these to sample analyte translocation times, thus resulting in measuring the zeta potential of those analytes.

As well as acquiring mean zeta potential values, the samples are all measured using a particle-by-particle perspective exhibiting more information on a given sample through sample population distributions, for example. Of such, this method demonstrates potential within sensing applications for both medical and environmental fields.

Introduction

Functionalized nanoparticles are becoming increasingly popular as biosensors in both medical and environmental fields. The ability to alter a nanoparticle's surface chemistry, with DNA, for example, is proving useful for targeted drug delivery systems¹ and monitoring DNA-protein interactions^2-4. An increasingly common nanoparticle property being utilized in bioassays and in the delivery of therapeutics is superparamagnetism⁵. Superparamagnetic particles (SPPs) are extremely useful in identifying and removing specific analytes from complex mixtures and can do so with the simple use of a single magnet. Once removed, the analyte-bound....

Protocol

1. Making the Phosphate Buffered Saline with Tween-20 (PBST) Buffer

1. Dissolve one PBS tablet (0.01 M phosphate buffer, 0.0027 M Potassium Chloride, 0.137 M Sodium Chloride, pH 7.4) in 200 ml deionized water (18.2 MΩ cm).
2. Add 100 µl (0.05 (v/v)%) Tween-20 to the 200 ml buffer solution as a surfactant.

2. Preparing the Carboxyl Polystyrene Particle Standards

1. Vortex the calibration particles for 30 sec before sonication for 2 min at 80 watts to c.......

Discussion

The calculation for the zeta potential used a calibration based method related to work by Arjmandi et al.²¹. The duration of the translocation of particles as they traverse a nanopore is measured as a function of applied voltage, using an average electric field and particle velocities over the entirety of a regular conical pore.  The electrophoretic mobility is the derivative of 1/T (where T is the blockade duration) with respect to voltage, multiplied by the square of the sensing zone lengt.......

Materials

Name	Company	Catalog Number	Comments
Phosphate buffered Saline (PBS)	Sigma Aldrich, UK	P4417	1 tablet dissolved in 200 mL deionised water to make buffer solution.
Tween-20	Sigma Aldrich, UK	P1379	0.05% (v/v) in PBS buffer as a surfactant
Carboxyl polystyrene nanoparticles	Bangs Laboratories, US	CPC200	Nominal diamter of 220 nm, raw concentration of 1E12 particles/mL, specific surface charge of 86 µeq/g (equivalent to a surface charge density of 3.2E19 C/nm^2.
Streptavidin coated nanoparticles	Ademtech, France	3121	Batch had binding capacity of 4352 pmol/mg (188 nM theoretical DNA binding capacity) at a raw concentration of 1.1E11 particles/mL.
Biotinylated oligonucleotides	Sigma Aldrich, UK	VC00001	Supplier spec: Reverse Phase 1 purification (0.05 Scale); Biotin modification at 3' end; Lyophilised powders reconstituted to 100 µM using deionised water, and diluted as required. Sequences: CP 5'ATGGTTAAACCTCAC TACGCGTGGC[Btn]3'
Standard olignonucleotides	Sigma Aldrich, UK	VC00001	Supplier spec: Reverse Phase 1 purification (0.05 Scale); Lyophilised powders reconstituted to 100 µM using deionised water, and diluted as required. Sequences of DNA targets: Fully complementary - 5'GCCACGCGTAGTGAGGTTTAACCAT3', Middle binding - 5'GTAGTGAGGT3', End binding - 5'GTTTAACCAT3', Partially complementary overhanging - 5'GTGAGGTTTAACCAT TTTTTTTTTTTTTTT3'.
Izon qNano	Izon Science, NZ		Inherent pressure on system of 47 Pa,
Izon Variable Pressure Module (VPM)	Izon Science, NZ		Each 'cm' of pressure is equivalent to approximately 1000 Pa.
Polyurethane nanopore membranes	Izon Science, NZ	NP150	Analyte size range 60-480 nm, pore diameter of calculated to be 799 nm at a 45 mm stretch.
Magrack 6	GE Healthcare, UK	28-9489-64
Sonic Bath	Fisher Scientific, UK	10692353	80 Watts
Vortexer	IKA, Germany	0003365000
Rotary Wheel	Labnet International, US	H5500-230 V