Analysis of Spliceosomal snRNA Localization in Human Hela Cells Using Microinjection

Summary

Biogenesis of spliceosomal snRNAs is a complex process involving various cellular compartments. Here, we employed microinjection of fluorescently labelled snRNAs in order to monitor their transport inside the cell.

Abstract

Biogenesis of spliceosomal snRNAs is a complex process involving both nuclear and cytoplasmic phases and the last step occurs in a nuclear compartment called the Cajal body. However, sequences that direct snRNA localization into this subnuclear structure have not been known until recently. To determine sequences important for accumulation of snRNAs in Cajal bodies, we employed microinjection of fluorescently labelled snRNAs followed by their localization inside cells. First, we prepared snRNA deletion mutants, synthesized DNA templates for in vitro transcription and transcribed snRNAs in the presence of UTP coupled with Alexa488. Labelled snRNAs were mixed with 70 kDa-Dextran conjugated with TRITC, and microinjected to the nucleus or the cytoplasm of human HeLa cells. Cells were incubated for 1 h and fixed and the Cajal body marker coilin was visualized by indirect immunofluorescence, while snRNAs and dextran, which serves as a marker of nuclear or cytoplasmic injection, were observed directly using a fluorescence microscope. This method allows for efficient and rapid testing of how various sequences influence RNA localization inside cells. Here, we show the importance of the Sm-binding sequence for efficient localization of snRNAs into the Cajal body.

Introduction

RNA splicing is one of the crucial steps in gene expression, which is catalyzed by a large ribonucleoprotein complex called the spliceosome. In total, more than 150 proteins and 5 small nuclear RNAs (snRNAs) are integrated into the spliceosome at different stages of the splicing pathway. U1, U2, U4, U5 and U6 snRNAs are participating in splicing of major GU-AG introns. These snRNAs join the spliceosome as pre-formed small nuclear ribonucleoprotein particles (snRNPs) that contain snRNA, seven Sm proteins associated with snRNA (or Like-Sm proteins, which associate with the U6 snRNA) and 1-12 proteins specific for each snRNP.

Assembly of snRNP....

Protocol

1. Preparation of snRNAs for Microinjection

1. Prepare a DNA template containing the full-length or truncated/mutated version of snRNA by PCR using a following PCR setup: 98 °C for 60 s, 98 °C for 15 s, 68 °C for 30 s, 72 °C for 1 min, 98 °C for 15 s for 35x, and 72 °C for 5 min.
2. The forward primer must contain a promoter sequence for in vitro transcription just upstream of the first transcribed nucleotide. Amplify U2 snRNA sequence using the forward primer containing the .......

Discussion

We employed microinjection of fluorescently labelled snRNAs to determine sequences important for snRNA localization into nuclear Cajal bodies. Due to rapid and rather simple preparation of labelled RNAs (preparation of DNA template by PCR followed by in vitro transcription) the method offers effective analysis of how various sequences contribute to RNA localization. In relatively short time, we were able to analyze ten different deletions or substitutions of the U2 snRNA (reference⁵ and data not s.......

Materials

Name	Company	Catalog Number	Comments
ChromaTide Alexa fluor 488-5-UTP	ThermoFisher	C11403	Stock concentration 1 mM
Dulbecco's Modified Eagle Medium - high glucose	Sigma-Aldrich	D5796	Containing 4.5 g⁄L D-glucose, Phenol red and antibiotics
FemtoJet express Injector	Eppendorf	5247000013
Femtotips II	Eppendorf	930000043	Microinjection needle of 0.5 µm inner and 0.7 µm outer diameter
Fluoromont G with DAPI	SouthernBiotech	0100-20
Glycogen	ThermoFisher	AM9510	Stock concentration 5 mg/mL
Gridded Glass Coverslips	Ibidi	10817	Coverslips with a grid, no direct experience with them
InjectMan NI 2 Micromanipulator	Eppendorf	5181000017
m3-2,2,7G(5')ppp(5')G trimethyled cap analogue	Jena Bioscience	NU-853-1	Stock concentration 40 mM
MEGAshortscript T7 Transcription Kit	ThermoFisher	AM1354
Microscope Cover Glasses 12 mm, No. 1	Paul Marienfeld GmbH	111520	For routine work
Microscope Cover Glasses 12 mm, No. 1.5	Paul Marienfeld GmbH	117520	For high resolution images
Microscope DeltaVision	GE Healthcare		For image acquisition
Microscope DMI6000	Leica		For microinjection
Paraformaldehyde 32% solution EM grade	EMS	15714	Dissolved in PIPES to the final concentration 4%
Phenol:Chloroform 5:1	Sigma-Aldrich	P1944
Primers for U2 amplification: Forward: 5’-TAATACGACTCACTATAGGGATCGCTTCTCGGCCTTTTGG, Reverse: 5´ TGGTGCACCGTTCCTGGAGGT	Sigma-Aldrich		T7 rpromoter sequence in italics
Phusion High Fidelity DNA polymerase	BioLab	M0530L
RNasin Plus	Promega	N2615	Stock concentration 40 mM
Tetramethylrhodamine isothiocyanate Dextran 65-85 kDa	Sigma-Aldrich	T1162	Dissolved in water, stock concentration 1 mg/mL
Triton-X100	Serva	37240	Dissolved in water, stock concentration 10%