JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Bioengineering

DNA Tension Probes to Map the Transient Piconewton Receptor Forces by Immune Cells

Published: March 20th, 2021

DOI:

10.3791/62348

1Department of Chemistry, Emory University, 2Wallace H. Coulter Department of Biomedical Engineering, Georgia Institute of Technology and Emory University

This paper describes a detailed protocol for using DNA-based tension probes to image the receptor forces applied by immune cells. This approach can map receptor forces >4.7pN in real-time and can integrate forces over time.

Mechanical forces transmitted at the junction between two neighboring cells and at the junction between cells and the extracellular matrix are critical for regulating many processes ranging from development to immunology. Therefore, developing the tools to study these forces at the molecular scale is critical. Our group developed a suite of molecular tension sensors to quantify and visualize the forces generated by cells and transmitted to specific ligands. The most sensitive class of molecular tension sensors are comprised of nucleic acid stem-loop hairpins. These sensors use fluorophore-quencher pairs to report on the mechanical extension and unfolding of DNA hairpins under force. One challenge with DNA hairpin tension sensors is that they are reversible with rapid hairpin refolding upon termination of the tension and thus transient forces are difficult to record. In this article, we describe the protocols for preparing DNA tension sensors that can be "locked" and prevented from refolding to enable "storing" of mechanical information. This allows for the recording of highly transient piconewton forces, which can be subsequently "erased" by the addition of complementary nucleic acids that remove the lock. This ability to toggle between real-time tension mapping and mechanical information storing reveals weak, short-lived, and less abundant forces, that are commonly employed by T cells as part of their immune functions.

Immune cells defend against pathogens and cancer cells by continuously crawling and scanning the surfaces of target cells for antigens, studding their surface1,2. Antigen recognition is initiated upon binding between the T cell receptor (TCR) and the peptide-major histocompatibility complex MHC (pMHC) complex expressed on the surface of target cells. Because TCR-pMHC recognition occurs at the junction between two mobile cells, it has long been suspected of experiencing mechanical forces. Moreover, this led to the mechanosensor model of TCR activation, which suggests that TCR forces contribute to its function

Log in or to access full content. Learn more about your institution’s access to JoVE content here

The OT-1 transgenic mice are housed at the Division of Animal Resources Facility at Emory University. All the experiments were approved and performed under the Institutional Animal Care and Use Committee (IACUC) protocol.

1. Oligonucleotide preparation

  1. Dissolve the ligand strand DNA in water (18.2 MΩ resistivity, used throughout the whole protocol). Vortex and spin down the solution with a tabletop centrifuge. Tune the volume of water such that the final concentration is 1 mM........

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Here we show representative surface quality control images (Figure 4). A high-quality surface should have a clean background in RICM channel (Figure 4B), and uniform fluorescence intensity in Cy3B channel (Figure 4C). With the same imaging equipment and identical fluorescence imaging acquisition conditions, the background fluorescence intensity should be consistent and reproducible each time when conducting experiments with DNA prob.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

With the detailed procedures provided here, one can prepare DNA hairpin tension probe substrates to map and quantify the receptor tension produced by immune cells. When cells are plated onto the DNA hairpin tension probe substrate, they land, attach, and spread as the receptors sense the ligands both chemically and mechanically, the latter of which is detected by our probes. However, in some cases cells may fail to spread (Figure 7A) or fail to produce tension signal. This is often a consequ.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

This work was supported by NIH Grants R01GM131099, NIH R01GM124472, and NSF CAREER 1350829. We thank the NIH Tetramer Facility for pMHC ligands. This study was supported, in part, by the Emory Comprehensive Glycomics Core.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
 3-hydroxypicolinic acid (3-HPA) Sigma 56197 maldi-TOF-MS matrix
 mPEG-SC Biochempeg MF001023-2K surface prep
(3-Aminopropyl)triethoxysilane Acros AC430941000 surface prep
10x Red blood cell lysis buffer Biolegend 00-4333-57 buffer
8.8 nm gold nanoparticles, tannic acid Nanocomposix customized order surface prep
Atto647N NHS ester Sigma 18373-1MG-F fluorophore, oligo prep
Attofluor Cell Chamber, for microscopy Thermo Fisher Scientific A7816 imaging
BD Syringes only with Luer-Lok BD bioscience 309657 cells
biotinylated anti-mouse CD3e ebioscience 13-0031-82 antibody/ligand
Biotinylated pMHC ovalbumin (SIINFEKL) NIH Tetramer Core Facility at Emory University NA antibody/ligand
bovine serum albumin Sigma 735078001 block non-specific interactions
Cell strainers Biologix 15-1100 cells
Coverslip Mini-Rack, teflon Thermo Fisher Scientific C14784 surface prep
Cy3B NHS ester GE Healthcare PA63101 fluorophore, oligo prep
Dulbecco's phosphate-buffered saline (DPBS) Corning 21-031-CM buffer
ethanol Sigma 459836 surface prep
Hank’s balanced salts (HBSS) Sigma H8264 buffer
hydrogen peroxide Sigma H1009 surface prep
LA-PEG-SC Biochempeg HE039023-3.4K surface prep
Midi MACS (LS) startup kit Miltenyi Biotec 130-042-301 cells
mouse CD8+ T cell isolation kit Miltenyi Biotec 130-104-075 cells
Nanosep MF centrifugal devices Pall laboratory ODM02C35 oligo prep
No. 2 round glass coverslips VWR 48382-085 surface prep
NTA-SAM Dojindo Molecular Technologies N475-10 surface prep
P2 gel Bio-rad 1504118 oligo prep
sufuric acid EMD Millipore Corporation SX1244-6 surface prep
Sulfo-NHS acetate Thermo Fisher Scientific 26777 surface prep
Equipment
Agilent AdvanceBio Oligonucleotide C18 column, 4.6 x 150 mm, 2.7 μm 653950-702 oligonucleotide preparation
Barnstead Nanopure water purifying system Thermo Fisher water
CFI Apo 100× NA 1.49 objective Nikon Microscopy
Cy5 cube CHROMA Microscopy
evolve electron multiplying charge coupled device (EMCCD) Photometrics Microscopy
High-performance liquid chromatography Agilent 1100 oligonucleotide preparation
Intensilight epifluorescence source Nikon Microscopy
Matrix-assisted laser desorption/ionization time-of-flight mass spectrometer (MALDI-TOF-MS) Voyager STR oligonucleotide preparation
Nanodrop 2000 UV-Vis Spectrophotometer Thermo Fisher oligonucleotide preparation
Nikon Eclipse Ti inverted microscope Nikon Microscopy
Nikon Perfect Focus System Nikon Microscopy
NIS Elements software Nikon Microscopy
quad band TIRF 405/488/561/647 cube CHROMA Microscopy
RICM cube CHROMA Microscopy
TIRF launcher with 488 nm (50 mW), 561 nm (50 mW), and 640 nm Coherent Microscopy
TRITC cube CHROMA Microscopy
oligo name 5' modification / 3' modification sequence (5' to 3') Use
15mer amine locking strand 5' modification: no modification
3' modification: /3AmMO/
AAA AAA CAT TTA TAC CCT ACC TA locking real-time tension signal
15mer Atto647N locking strand 5' modification: Atto647N
3' modification: /3AmMO/
AAA AAA CAT TTA TAC CCT ACC TA locking real-time tension signal
15mer non-fluoresccent locking strand 5' modification: no modification
3' modification: no modification
A AAA AAC ATT TAT AC locking real-time tension signal for quantitative analysis
4.7 pN hairpin strand 5' modification: no modification
3' modification: no modification
GTGAAATACCGCACAGATGCGT
TTGTATAAATGTTTTTTTCATTTAT
ACTTTAAGAGCGCCACGTAGCC
CAGC
hairpin probe
amine ligand strand 5' modification: /5AmMC6/
3' modification: /3Bio/
CGCATCTGTGCG GTA TTT CAC TTT hairpin probe
BHQ2 anchor strand 5' modification: /5ThiolMC6-D/
3' modification: /3BHQ_2/
TTTGCTGGGCTACGTGGCGCTCTT    hairpin probe
Cy3B ligand strand 5' modification: Cy3B
3' modification: /3Bio/
CGCATCTGTGCG GTA TTT CAC TTT hairpin probe
unlocking strand 5' modification: no modification
3' modification: no modification
TAG GTA GGG TAT AAA TGT TTT TTT C unlocking accumulated tension signal

  1. Dustin, M. L. T-cell activation through immunological synapses and kinapses. Immunological Reviews. 221 (1), 77-89 (2008).
  2. Spillane, K. M., Tolar, P. B cell antigen extraction is regulated by physical properties of antigen-presenting cells. Journal of Cell Biology. 216 (1), 217-230 (2017).
  3. Feng, Y., et al. Mechanosensing drives acuity of αβ T-cell recognition. Proceedings of the National Academy of Sciences. 114 (39), 8204-8213 (2017).
  4. Hong, J., et al. A TCR mechanotransduction signaling loop induces negative selection in the thymus. Nature Immunology. 19 (12), 1379-1390 (2018).
  5. Basu, R., et al. Cytotoxic T cells use mechanical force to potentiate target cell killing. Cell. 165 (1), 100-110 (2016).
  6. Bashour, K. T., et al. CD28 and CD3 have complementary roles in T-cell traction forces. Proceedings of the National Academy of Sciences. 111 (6), 2241-2246 (2014).
  7. Ma, V. P. Y., Salaita, K. DNA nanotechnology as an emerging tool to study mechanotransduction in living systems. Small. 15 (26), 1900961 (2019).
  8. Liu, Y., Yehl, K., Narui, Y., Salaita, K. Tension sensing nanoparticles for mechano-imaging at the living/nonliving interface. Journal of the American Chemical Society. 135 (14), 5320-5323 (2013).
  9. Glazier, R., et al. DNA mechanotechnology reveals that integrin receptors apply pN forces in podosomes on fluid substrates. Nature Communications. 10 (1), 1-13 (2019).
  10. Galior, K., Liu, Y., Yehl, K., Vivek, S., Salaita, K. Titin-based nanoparticle tension sensors map high-magnitude integrin forces within focal adhesions. Nano Letters. 16 (1), 341-348 (2016).
  11. Zhang, Y., Ge, C., Zhu, C., Salaita, K. DNA-based digital tension probes reveal integrin forces during early cell adhesion. Nature Communications. 5, 5167 (2014).
  12. Liu, Y., et al. DNA-based nanoparticle tension sensors reveal that T-cell receptors transmit defined pN forces to their antigens for enhanced fidelity. Proceedings of the National Academy of Sciences. 113 (20), 5610-5615 (2016).
  13. Zhang, Y., et al. Platelet integrins exhibit anisotropic mechanosensing and harness piconewton forces to mediate platelet aggregation. Proceedings of the National Academy of Sciences. 115 (2), 325-330 (2018).
  14. Huang, J., et al. The kinetics of two-dimensional TCR and pMHC interactions determine T-cell responsiveness. Nature. 464 (7290), 932-936 (2010).
  15. Ma, R., et al. DNA probes that store mechanical information reveal transient piconewton forces applied by T cells. Proceedings of the National Academy of Sciences. 116 (34), 16949-16954 (2019).
  16. Hui, E., et al. T cell costimulatory receptor CD28 is a primary target for PD-1-mediated inhibition. Science. 355 (6332), 1428-1433 (2017).
  17. Whitley, K. D., Comstock, M. J., Chemla, Y. R. Elasticity of the transition state for oligonucleotide hybridization. Nucleic Acids Research. 45 (2), 547-555 (2016).
  18. Brockman, J. M., et al. Live-cell super-resolved PAINT imaging of piconewton cellular traction forces. Nature Methods. 17 (10), 1018-1024 (2020).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved