This work was supported by a National Science Foundation award MCB 1616827.

1. Plant Growth
<ol>
	<li>Seed sterilization (optional)
	<ol>
		<li>Prepare 50% bleach in double-distilled water (ddH2O) with 1 or 2 drops of a non-ionic detergent (see Table of Materials) in a 50 mL tube. Invert the tube several times to mix the solution. 
		NOTE: It is preferable to conduct seed sterilization in a laminar flow cabinet with a UV sterilized surface for 15 min.</li>
		<li>Add the bleach solution to ~100&#8211;200 S. parvula seeds in a 1.5 mL tube. Mix thoroughly and let the tube sit for 5 min.</li>
		<li>Remove the bleach from the tube and add 70% ethanol. Wash the seeds by pipetting several times and then remove the ethanol solution immediately.</li>
		<li>Wash the seeds in sterilized water to remove excess bleach and ethanol, then remove the water. Repeat this step 5 to 6 times.</li>
	</ol>
	</li>
	<li>Seed stratification
	<ol>
		<li>Immerse the seeds in sterilized water, and store for 5 to 7 days at 4 &#176;C. Alternatively, sow dried unsterilized seeds directly on wet soil, and place the soil tray for 5 to 7 days at 4 &#176;C.</li>
	</ol>
	</li>
	<li>Growing plants in preparation of transformation
	<ol>
		<li>Fill the soil mix (see Table of Materials) into 7 x 6 cm2 pots, soak the pots in water, and spray water from the top to ensure a uniformly wet growth medium. Add 5&#8211; fertilizer beads (see Table of Materials) on the soil surface of each pot. 
		NOTE: As far as we have experienced, S. parvula grows well on any soil mix where A. thaliana can grow.</li>
		<li>Using a wet toothpick, transfer 20~25 seeds per pot on the soil surface. 
		NOTE: A convenient practice is to put a batch of 4&#8211;5 seeds in the four corners and the center of the pot (Figure 1, Day 15, left panel).</li>
		<li>Cover the pot tray with a clear dome to keep the seeds under high humidity during germination.</li>
		<li>Keep the plant trays in a growth chamber with a light intensity set at 130 &#181;mol m&#8722;2 s&#8722;1 light, 22&#8211;24 &#176;C temperature, and 14 h per day/10 h per night cycle. Remove the domes after 7 - 10 days following germination. Add water from the bottom of the tray to keep soil moistened uniformly at a desirable level.</li>
		<li>Weed out extra seedlings and leave only 4&#8211;5 healthy seedlings per pot well separated from each other (Figure 1, Day 15, right panel).</li>
		<li>Gently water the plants every two days and fertilize with 0.2x Hoagland&#39;s solution16 once every two weeks. 
		NOTE: Keeping the soil moisture at a uniform level is key to growing S. parvula consistently and healthily.</li>
		<li>Continue to grow the plants for 8&#8211;10 weeks until multiple inflorescences produce 100&#8211;150 floral buds per plant (Figure 1, Day 60&#8211;80). On the day planned for the floral-dip based transformation (step 4.5), remove all mature and developing siliques from the plants.</li>
	</ol>
	</li>
</ol>
2. Cloning the Gene/Genomic Element of Interest into a Vector for Plant Transformation
<ol>
	<li>Amplify the target DNA fragment using polymerase chain reaction (PCR)17 and isolate the PCR product using a gel extraction kit (see Table of Materials) according to the kit protocol or any other appropriate method to purify DNA using agarose gel electrophoresis17,18. Verify the sequence of the isolated PCR product through Sanger sequencing19.</li>
	<li>Clone the desired PCR product into the cloning vector and transform the cloned construct into the competent E. coli cells using a topoisomerase-based cloning kit (see Table of Materials) following manufacturer&#39;s guidelines.</li>
	<li>Spread 50 &#181;L of transformed products on Luria-Bertani20 (LB) agar bacterial growth media (Table 1) with appropriate antibiotics, e.g., 50 &#181;g/ mL Spectinomycin (see Table of Materials), and incubate at 37 &#176;C overnight.</li>
	<li>The following day, select 5&#8211;10 single colonies, inoculate into liquid LB medium with appropriate antibiotics, and incubate with gentle shaking at 37 &#176;C overnight.</li>
	<li>Isolate plasmids using a plasmid isolation kit (see Table of Materials) and verify through Sanger sequencing19 whether the target sequence amplified in 2.1 is properly cloned.</li>
	<li>Transfer the cloned and verified PCR product to a destination vector for plant transformation compatible with recombination-based cloning (see Table of Materials), using a recombinase enzyme mix kit (see Table of Materials), following the kit manufacturer&#39;s instruction. Repeat from step 2.3 to step 2.5 to isolate and verify clones harboring proper plasmid constructs.</li>
</ol>
3. Transforming the Vector Construct for Plant Transformation into Agrobacterium tumefaciens
<ol>
	<li>Transform the plasmid of the vector construct from 2.6 into the A. tumefaciens&#160;strain GV3101:pMP90RK21, which harbors a Rifampicin resistance gene for chromosomal background selection. Use appropriate antibiotics, e.g. Gentamycin or Kanamycin (see Table of Materials), for the selection of plant transformation construct (Ti plasmid). A brief protocol for A. tumefaciens transformation via electroporation is included in section 3.2.</li>
	<li>A. tumefaciens transformation by electroporation
	<ol>
		<li>Thaw the A. tumefaciens competent cells22 on ice. Mix 0.1&#8211;1 &#181;g of the plasmid prepared from 2.6, dissolved in 1&#8211;2 &#181;L of ddH2O, with competent cells on ice. Transfer the mixture into an electroporation cuvette (see Table of Materials).</li>
		<li>Perform electroporation on the mixture of plasmids and competent cells from 3.2.1, using an electroporator (see Table of Materials) following the manufacturer&#39;s guidelines. 
		NOTE: Clean the surface of the cuvette before starting the electroporation.</li>
		<li>Transfer the reaction mixture from the cuvette to a microcentrifuge tube that contains 1.5 mL of liquid LB and mix well with pipetting and incubate for 1 h at 28 &#176;C with gentle shaking.</li>
	</ol>
	</li>
	<li>Inoculate the transformed A. tumefaciens from section 3.2 on LB plates containing appropriate selection antibiotics (e.g. Kanamycin 25 &#181;g/ mL, Spectinomycin 50 &#181;g/ mL, Gentamycin 25 &#181;g/ mL, and Rifampicin 50 &#181;g/ mL) and incubate at 28 &#176;C for 3 days.</li>
</ol>
4. Agrobacterium-mediated Transformation of S. parvula
<ol>
	<li>Inoculate the single transformed colonies from plates into 10 mL of LB liquid media containing antibiotics (the same as in 3.3) in a sterile 50 mL conical tube (see Table of Materials). Incubate for 24 h in a shaking incubator (see Table of Materials) at 250 r.p.m. at 28 &#176;C.</li>
	<li>Transfer the bacterial solution from 3.4.1 to a sterile 250 mL flask, add 40 mL of LB liquid media with appropriate antibiotics, and incubate 12 h until the optical density at 600 nm wavelength (OD600) reaches around 2.0.</li>
	<li>Centrifuge the A. tumefaciens&#160;cultureat 3,100 x g for 10 min. Remove the supernatant and re-suspend the bacterial culture in 40 mL of A. tumefaciens&#160;infiltration solution (Table 1).</li>
	<li>Dilute the resuspended A. tumefaciens with infiltration solution to a final OD600 of 0.8. Add 25 &#181;L of surfactant solution (Table 1) to 50 mL of diluted A. tumefaciens solution and mix by inverting several times.</li>
	<li>Dip the inflorescence of the plants in the A. tumefaciens solution prepared in the section 4.4 for 20 s. Use a fresh bacterial solution after dipping inflorescence from six pots. Make sure all flowers are in contact with the solution. Pipet bacterial solutions directly onto flowers located in the lower part of the inflorescence if they cannot be dipped into the solution. 
	NOTE: For the first-round transformation, make sure to remove all mature and developing siliques using a sharp scalpel or small scissors. Do not remove siliques if performing transformation for the second time.</li>
</ol>
5. Post-transformation Plant Care and the Second Transformation
<ol>
	<li>Place the floral-dipped plants horizontally in clean trays with domes to cover the plants and place in a dark growth room for 1&#8211;2 days. 
	NOTE: Keeping the flowers under high-humidity is important at this stage (Figure 1, Plants after transformation).</li>
	<li>Return the plants to an upright position and transfer the plants to a growth room with a 14 h per day/10 h per night cycle, 130 &#181;mol m-2 s-1 light intensity and 22 to 24 &#176;C temperature.</li>
	<li>Monitor the dipped inflorescences in the following week. If a significant number of flowers abort (Figure 2), repeat the floral dip (step 4) after about 4 weeks or after a large number of flowers have newly developed. 
	NOTE: Unlike the preparation step for the first transformation (step 1.3.7), do not remove pre-existing or developing siliques (Figure 2) before the second round of transformation.</li>
	<li>Grow the plants until seeds mature and harvest seeds at ~21 weeks.</li>
	<li>Dry seeds for 2&#8211;3 weeks at room temperature in an airtight container with filled with desiccants (see Table of Materials).</li>
</ol>
6. Selection of Positive Transformants
<ol>
	<li>Plant the T1 seeds as described for wild type seeds in steps 1.2 to 1.3.</li>
	<li>Grow the plants until the first 2&#160;true leaves develop, approximately 10&#8211;14 days after germination.</li>
	<li>Perform the first selection for herbicide resistance (Figure 3A and 3B) as detailed below.
	<ol>
		<li>Dilute the glufosinate-ammonium (11.3%) herbicide (or BASTA) (Table 1) to 1:1,000 (v/v). Spray diluted BASTA solution on the seedlings and cover the plants with domes overnight.</li>
		<li>Repeat BASTA spraying 2&#8211;3 times every 5&#8211;7 days.</li>
	</ol>
	</li>
	<li>Perform the second selection using a BASTA-drop test as detailed below.
	<ol>
		<li>Identify plants that survive after being sprayed 3&#8211;4 times with BASTA solution. Grow the plants for another 2&#8211;3 weeks until 3&#8211;5 leaves develop a relatively large surface area.</li>
		<li>Select the largest mature leaf per plant, rub the surface of the leaf gently with a finger to remove the wax layer, and place a drop of the diluted BASTA solution (from step 6.3.1). 
		NOTE: Mark the location of the leaf applied with the BASTA drop by placing a paper tape on the nearest stem.</li>
		<li>Monitor the leaves applied with the BASTA drop for signs of wilting for up to one week. Select the plants with leaves unaffected by the BASTA drops. 
		NOTE: Leaves from most false-positive plants start to wilt within two days, while leaves from true-positives are intact even after the drop of BASTA solution dries up (Figure 3C).</li>
	</ol>
	</li>
	<li>Confirm positive transformants using genomic PCR.
	<ol>
		<li>Collect 2&#8211;3 leaves from the surviving plants at step 6.4.5.</li>
		<li>Extract genomic DNA from the leaves using the CTAB method23 or any other appropriate DNA extraction method.</li>
		<li>Perform PCR using extracted genomic DNA samples from target plants, wild-type plants (as negative controls), and the plasmid construct from the step 3.1 (as a positive control). Use an appropriate pair of PCR primers specific to the selective marker gene, e.g., for BASTA-resistant gene (bar), TCAGCAGGTGGGTGTAGA (forward) and GTCAACCACTACATCGAGACAA (reverse).
		<ol>
			<li>For the example PCR primers targeting the bar gene, use the following PCR conditions: the initial denaturation step at 98 &#176;C for 30 s; followed by 30 cycles of denaturing at 98 &#176;C for 30 s, annealing at 59 &#176;C for 30 s, and extending at 72 &#176;C for 30 s; and the final extension at 72 &#176;C for 5 min. 
			NOTE: To ensure the insertion of the entire T-DNA, we recommend also performing genomic PCR using a PCR primer from the selective marker gene and another PCR primer specific to the target sequence cloned to the plant transformation vector at the step</li>
		</ol>
		</li>
		<li>Confirm the presence of the expected size of the amplified bar PCR product by agarose gel electrophoresis17 for the target samples (Figure 4A) as well as by sequencing the isolated PCR product19 using the same procedure as in step 2.1.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Dassanayake, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genome+of+the+extremophile+crucifer+Thellungiella+parvula.">The genome of the extremophile crucifer Thellungiella parvula.</a> Nature Genetics. 43 (9), 913-918 (2011).</li><li>Oh, D. -. H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Life+at+the+extreme:+lessons+from+the+genome.">Life at the extreme: lessons from the genome.</a> Genome Biology. 13 (3), 241 (2012).</li><li>Whited, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Next+Top+Models.">The Next Top Models.</a> Cell. 163 (1), 18-20 (2015).</li><li>Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+scope+of+things+to+come:+New+paradigms+in+biotechnology.">The scope of things to come: New paradigms in biotechnology.</a> Plant Biotechnology and Agriculture: Prospects for the 21st Century. , 19-34 (2009).</li><li>Dittami, S. M., Tonon, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomes+of+extremophile+crucifers:+New+platforms+for+comparative+genomics+and+beyond.">Genomes of extremophile crucifers: New platforms for comparative genomics and beyond.</a> Genome Biology. 13 (8), 166 (2012).</li><li>Amtmann, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Learning+from+evolution:+Thellungiella+generates+new+knowledge+on+essential+and+critical+components+of+abiotic+stress+tolerance+in+plants.">Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants.</a> Molecular Plant. 2 (1), 3-12 (2009).</li><li>Oh, D. -. H., Hong, H., Lee, S. Y., Yun, D. -. J., Bohnert, H. J., Dassanayake, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+structures+and+transcriptomes+signify+niche+adaptation+for+the+multiple-ion-tolerant+extremophyte+Schrenkiella+parvula.">Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula.</a> Plant Physiology. 164 (4), 2123-2138 (2014).</li><li>Orsini, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparative+study+of+salt+tolerance+parameters+in+11+wild+relatives+of+Arabidopsis+thaliana.">A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana.</a> Journal of Experimental Botany. 61 (13), 3787-3798 (2010).</li><li>Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changes+in+the+alternative+electron+sinks+and+antioxidant+defence+in+chloroplasts+of+the+extreme+halophyte+Eutrema+parvulum+(Thellungiella+parvula)+under+salinity.">Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity.</a> Annals of Botany. 115 (3), 449-463 (2015).</li><li>Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cuticular+waxes+on+Arabidopsis+thaliana+close+relatives+Thellungiella+halophila+and+Thellungiella+parvula.">Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula.</a> International Journal of Plant Sciences. 163 (2), 309-315 (2002).</li><li>Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+roles+for+SOS1+in+the+convergent+evolution+of+salt+tolerance+in+Eutrema+salsugineum+and+Schrenkiella+parvula.">Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula.</a> Molecular Biology and Evolution. 31 (8), 2094-2107 (2014).</li><li>Clough, S. J., Bent, A. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Floral+dip:+A+simplified+method+for+Agrobacterium-mediated+transformation+of+Arabidopsis+thaliana.">Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.</a> Plant Journal. 16 (6), 735-743 (1998).</li><li>Koornneef, M., Meinke, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+development+of+Arabidopsis+as+a+model+plant.">The development of Arabidopsis as a model plant.</a> Plant Journal. 61 (6), 909-921 (2010).</li><li>Bai, J., Wu, F., Mao, Y., He, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+planta+transformation+of+Brassica+rapa+and+B.+napus+via+vernalization-infiltration+methods.">In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods.</a> Protocol Exchange. 10, 1028 (2013).</li><li>Sparrow, P. A. C., Goldsack, C. M. P., &#216;stergaard, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+technology+in+the+Brassicaceae.">Transformation technology in the Brassicaceae.</a> Genetics and Genomics of the Brassicaceae. , 505-525 (2011).</li><li>Hoagland, D. R., Arnon, D. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+water-culture+method+for+growing+plants+without+soil.">The water-culture method for growing plants without soil.</a> California Agricultural Experiment Station Circular. 347 (347), 1-32 (1950).</li><li>Saiki, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239 (4839), 487-491 (1988).</li><li>Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Quick,+cost-free+method+of+purification+of+dna+fragments+from+agarose+gel.">A Quick, cost-free method of purification of dna fragments from agarose gel.</a> Journal of Cancer. 3, 93-95 (2012).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (12), 5463-5467 (1977).</li><li>Bertani, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+Lysogenesis+I.+The+mode+of+phage+liberation+by+lysogenic+Eschericia+coli.">Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli.</a> Journal of Bacteriolgy. 62 (3), 293-300 (1951).</li><li>Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+vectors+for+gene+tagging+and+expression+studies.">Specialized vectors for gene tagging and expression studies.</a> Plant Molecular Biology Manual. , 53-74 (1994).</li><li>Weigel, D., Glazebrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Agrobacterium+using+electroporation.">Transformation of Agrobacterium using electroporation.</a> Cold Spring Harbor Protocols. 2006 (30), (2006).</li><li>Murray, M. G., Thompson, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+isolation+of+high+molecular+weight+plant+DNA.">Rapid isolation of high molecular weight plant DNA.</a> Nucleic Acids Research. 8 (19), 4321-4326 (1980).</li><li>Inan, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salt+cress.+a+halophyte+and+cryophyte+Arabidopsis+relative+model+system+and+its+applicability+to+molecular+genetic+analyses+of+growth+and+development+of+extremophiles.">Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles.</a> Plant Physiol. 135 (3), 1718-1737 (2004).</li><li>Ghedira, R., De Buck, S., Nolf, J., Depicker, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+efficiency+of+Arabidopsis+thaliana+floral+dip+transformation+is+determined+not+only+by+the+Agrobacterium+strain+used+but+also+by+the+physiology+and+the+ecotype+of+the+dipped+plant.">The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant.</a> Molecular Plant-Microbe Interactions. 26 (7), 823-832 (2013).</li><li>Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Brassica+napus+with+the+method+of+floral-dip.">Transformation of Brassica napus with the method of floral-dip.</a> Biotechnology: Genomics and Its Applications. , 45-49 (2005).</li><li>Li, J., Tan, X., Zhu, F., Guo, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+and+simple+method+for+Brassica+napus+floral-dip+transformation+and+selection+of+transgenic+plantlets.">A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets.</a> International Journal of Biology. 2 (1), 127 (2010).</li><li>Li, H. Q., Xu, J., Chen, L., Li, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+an+efficient+Agrobacterium+tumefaciens-mediated+leaf+disc+transformation+of+Thellungiella+halophila.">Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila.</a> Plant Cell Reports. 26 (10), 1785-1789 (2007).</li><li>Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Traffic+lines:+New+tools+for+genetic+analysis+in+Arabidopsis+thaliana.">Traffic lines: New tools for genetic analysis in Arabidopsis thaliana.</a> Genetics. 200 (1), 35-45 (2015).</li></ol>

The authors have nothing to disclose.

The physiological state of the plant significantly influences the efficiency of transformation25. The use of healthy and vigorous plants for transformation is a key requirement for successful transformation in S. parvula. Water or light stressed plants will have fewer flowers compared to the healthy plants ideal for transformation (Figure 1, center panel). S. parvula can grow at a light intensity less than 130 &#181;mol m-2 s-1,...

In this protocol, we describe the growth and establishment of stable transgenic lines for the extremophyte model Schrenkiella parvula. The availability of an efficient transformation system is a hallmark of any versatile genetic model. Plants that thrive in extreme environments, referred to as extremophytes, provide a critical resource for understanding plant adaptations to environmental stresses. Schrenkiella parvula (formerly Thellungiella parvula and Eutrema parvulum) is one such extremophyte model, with expanding genomic resources1,2,3,4,5. However, transformation protocols have not yet been reported for S. parvula in published studies.
The genome of S. parvula is the first published extremophyte genome in Brassicaceae (mustard-cabbage family) and shows an extensive overall genome synteny with the non-extremophyte model, Arabidopsis thaliana1. Thus, comparative studies between A. thaliana and S. parvula could benefit from the wealth of genetic studies performed on A. thaliana to make informative hypotheses on how the S. parvula genome has evolved and regulated differently to cope with extreme environmental stresses5,6,7. S. parvula is one of the most salt-tolerant species (based on soil NaCl LD50) among known wild relatives of A. thaliana8. In addition to the NaCl tolerance, S. parvula survives and completes its life cycle in the presence of multiple salt ions at high concentrations toxic to most plants7. In response to the abiotic stresses prevalent in its natural habitat, it has evolved various traits, among which several have been studied at the biochemical or physiological level 8,9,10,11.
Since 2010, there have been over 400 peer-reveiwed publications that used S. parvula as a target species or used it in a comparison with other plant genomes. However, a clear bottleneck could be identified with a closer look of what type of studies have been conducted. The majority of these reports discuss the potential use of S. parvula in future studies or use it in comparative genomic or phylogenomic studies. Due to the lack of a proof-of-concept transformation protocol established for S. parvula, it has not been used in functional genomic studies, despite having one of the highest quality plant genomes available to date (&#62;5 Mb contig N50) assembled and annotated into chromosome-level pseudomolecules1.
The Agrobacterium-mediated floral-dip transformation method has become the most broadly used method to create trasngenic lines in A. thaliana, and the development of a reproducible system of transformation was a critical factor in its success as a genetic model12,13. However, not all Brassicaceae species have been shown to be successfully transformed using the floral-dip method developed for A. thaliana. Specially, the Brassicaceae Lineage II species that include S. parvula has been recalcitrant to floral-dip based transformation methods14,15.
The indeterminate flowering growth habit of S. parvula, combined with its narrow leaf morphology has made it challenging to adopt the standard Agrobacterium-mediated floral-dip transformation method. In this study, we report the modified protocol we have developed for reproducible transformation of S. parvula.

<table border="0" cellpadding="0" cellspacing="0" style="width:1303px;" width="1302">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:341px;">Agar</td>
			<td style="width:293px;">VWR International, Radnor, PA</td>
			<td style="width:127px;">90000-762</td>
			<td style="width:541px;">Bacto Agar Soldifying Agent, BD Diagnostics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">B5 vitamins</td>
			<td>Sigma-Aldrich, St. Louis, MO</td>
			<td>G1019</td>
			<td>Gamborg&#8217;s Vitamin Solution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:341px;">Desiccant</td>
			<td>W A Hammond Drierite, Xenia, OH</td>
			<td style="width:127px;">22005</td>
			<td>Indicating DRIERITE 6 mesh</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:341px;">Destination vector for plant transformation</td>
			<td>TAIR</td>
			<td style="width:127px;">Vector:6531113857</td>
			<td>pKGWFS7</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Electroporation cuvette</td>
			<td>USA Scientific</td>
			<td>9104-5050</td>
			<td>Electroporation cuvette, round cap, 0.2 cm gap</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Electroporator</td>
			<td>BIO-RAD Laboratories, Hercules, CA</td>
			<td>1652100</td>
			<td>MicroPulser Electroporator</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fertilizer beads</td>
			<td>Osmocote Garden, Marysville, OH</td>
			<td>N/A</td>
			<td>Osmocote Smart-Release Plant Food&#160;Flower &#38; Vegetable</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gel extraction kit</td>
			<td>iNtRON Biotechnology, Boston, MA</td>
			<td>17289</td>
			<td>MEGAquick-spin Total fragment DNA purification kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gentamicin</td>
			<td>Sigma-Aldrich, St. Louis, MO</td>
			<td>G1914-5G</td>
			<td>Gentamicin sulfate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:341px;">Glufosinate-ammonium (11.3%) herbicide (BASTA)</td>
			<td>Bayer environmental science, Montvale, NJ</td>
			<td>N/A</td>
			<td>FINALE herbicide</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Kanamycin</td>
			<td>VWR International, Radnor, PA</td>
			<td>200004-444</td>
			<td>Kanamycin monosulfate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MES</td>
			<td>Bioworld, Dublin, OH</td>
			<td>41320024-2</td>
			<td>MES, Free Acid</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MS salt</td>
			<td>MP Biomedicals, Santa Anna, CA</td>
			<td>092621822</td>
			<td>Hoagland&#39;s modified basal salt mixture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">N6-benzylaminopurine (BA)&#160;</td>
			<td>Sigma-Aldrich, St. Louis, MO</td>
			<td>B3274</td>
			<td>6-Benzylaminopurine solution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NaCl</td>
			<td>Sigma-Alrich</td>
			<td>S7653</td>
			<td>Sodium chloride</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Non-ionic detergent</td>
			<td>Sigma-Aldrich, St. Louis, MO</td>
			<td>9005-64-5</td>
			<td>TWEEN 20&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:341px;">Plasmid isolation kit</td>
			<td>Zymo Research, Irvine, CA</td>
			<td>D4036</td>
			<td>Zyppy Plasmid Kits</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Recombinase enzyme mix kit</td>
			<td>Life Technology</td>
			<td>11791-020</td>
			<td>Gateway LR Clonase II Enzyme mix</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rifampicin</td>
			<td>Sigma-Aldrich, St. Louis, MO</td>
			<td>R3501-1G</td>
			<td>Rifampicin, powder, &#62;= 97% (HPLC)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Shaking incubator</td>
			<td>ThermoFisher Scientific, Waltham, MA</td>
			<td>SHKE4450</td>
			<td>MaxQ 4450 Benchtop Orbital Shakers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Soil mix</td>
			<td>Sun Gro</td>
			<td>SUN239223328CFLP</td>
			<td>Sun Gro Metro-Mix 360 Grower Mix</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Spectinomycin</td>
			<td>VWR International, Radnor, PA</td>
			<td>IC15206705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 50ml conical tubes</td>
			<td>USA Scientific, Ocala, FL</td>
			<td>1500-1811</td>
			<td>50 ml conical screw cap tubes, copolymer, racks, sterile</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sucrose</td>
			<td>VWR International, Radnor, PA</td>
			<td>57-50-1</td>
			<td>Sucrose, ACS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Surfactant solution</td>
			<td>Lehle seeds, Round Rock, TX</td>
			<td>VIS-02</td>
			<td>Silwet L-77</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Topoisomerase-based cloning kit</td>
			<td>Life Technologies, Carlsbad, CA</td>
			<td>K240020</td>
			<td>pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tryptone</td>
			<td>VWR International, Radnor, PA</td>
			<td>90000-282</td>
			<td>BD Bacto Tryptone, BD Biosciences</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Yeast Extract</td>
			<td>VWR International, Radnor, PA</td>
			<td>90000-722&#160;</td>
			<td>BD Bacto Yeast Extract, BD Biosciences</td>
		</tr>
	</tbody>
</table>

plant growth and agrobacterium-mediated floral-dip transformation of the extremophyte schrenkiella parvula

Schrenkiella parvula is an extremophyte adapted to various abiotic stresses, including multiple ion toxicity stresses. Despite high-quality genomic resources available to study how plants adapt to environmental stresses, its value as a functional genomics model and tool has been limited by the lack of a feasible transformation system. In this protocol, we report how to generate stable transgenic S. parvula lines using an Agrobacterium-mediated floral-dip method. We modified the transformation protocol used for A. thaliana to account for unique traits of S. parvula, such as an indeterminate flowering habit and a high epicuticular wax content on leaves. Briefly, S. parvula seeds were stratified at 4 &#176;C for five days before planting. Plants were grown at a photoperiod of a 14 h light and 10 h dark and a 130 &#181;mol m-2s-1 light intensity, at 22 &#176;C to 24 &#176;C. Eight to nine week-old plants with multiple inflorescences were selected for transformation. These inflorescences were dipped in an infiltration solution of Agrobacterium tumefaciens GV3101 carrying the pMP90RK plasmid. We performed two rounds of flower dipping with an interval of three to four weeks to increase the transformation efficiency. The T1 seeds were collected and dried for four weeks in a container with desiccants before germination to screen for candidate transformed lines. Resistance to BASTA was used to screen T1 plants. We sprayed the BASTA solution three times with an interval of three days starting at two week-old plants to reduce false positives. A BASTA drop test was performed on surviving individual plants to identify true positive transformants. The transformation efficiency was 0.033%, yielding 3&#8211;4 transgenic plants per 10,000 T1 seeds propagated.

We developed a transformation protocol that enables harvesting of T0 seeds within 150 days, using a floral-dip method modified from that for A. thaliana. Figure 1 shows a summary of the timeline and S. parvula plants that represent the optimal stage for executing the transformation through floral-dip. We selected S. parvula plants with 70 &#8211;80 flowers in multiple inflorescences at 60&#8211;80 days after germination a...

Watch this Scientific Journal Video about Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula at JoVE.com

Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula

Agrobacterium-mediated transformation using a floral-dip method can be successfully employed to create stable transgenic lines of the extremophyte model Schrenkiella parvula. We present a protocol modified from that for Arabidopsis thaliana, considering different growth habits and physiological characteristics of the extremophyte.

Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula

Schrenkiella parvula is an extremophyte adapted to various abiotic stresses, including multiple ion toxicity stresses. Despite high-quality genomic ...

plant-growth-agrobacterium-mediated-floral-dip-transformation

Research

JoVE Journal

Genetics

12.9K Views.  Louisiana State University. Agrobacterium-mediated transformation using a floral-dip method can be successfully employed to create stable transgenic lines of the extremophyte model Schrenkiella parvula. We present a protocol modified from that for Arabidopsis thaliana, considering different growth habits and physiological characteristics of the extremophyte.

Video: Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula

A Robotic Platform for High-throughput Protoplast Isolation and Transformation

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal transduction pathways, transcriptional regulatory networks, gene expression, genome-editing, and gene-silencing. Furthermore, significant progress has been made in the regeneration of plants from protoplasts, which has generated even more interest in the use of these systems for plant genomics. In this work, a protocol has been developed for automation of protoplast isolation and transformation from a &#39;Bright Yellow&#39; 2 (BY-2) tobacco suspension culture using a robotic platform. The transformation procedures were validated using an orange fluorescent protein (OFP) reporter gene (pporRFP) under the control of the Cauliflower mosaic virus 35S promoter (35S). OFP expression in protoplasts was confirmed by epifluorescence microscopy. Analyses also included protoplast production efficiency methods using propidium iodide. Finally, low-cost food-grade enzymes were used for the protoplast isolation procedure, circumventing the need for lab-grade enzymes that are cost-prohibitive in high-throughput automated protoplast isolation and analysis. Based on the protocol developed in this work, the complete procedure from protoplast isolation to transformation can be conducted in under 4 hr, without any input from the operator. While the protocol developed in this work was validated with the BY-2 cell culture, the procedures and methods should be translatable to any plant suspension culture/protoplast system, which should enable acceleration of crop genomics research.

A high-throughput, automated, tobacco protoplast production and transformation methodology is described. The robotic system enables massively parallel gene expression and discovery in the model BY-2 system that should be translatable to non-model crops.

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal ...

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the replacement of the entire gene with a selectable marker via homologous recombination. During homologous recombination, exchange of DNA takes place between sequences with high similarity. Therefore, linear genomic sequences flanking a target gene can be used to specifically direct a selectable marker to the desired integration site. Blunt ends of the deletion construct activate the cell&#39;s DNA repair systems and thereby promote integration of the construct either via homologous recombination or by non-homologous-end-joining. In organisms with efficient homologous recombination, the rate of successful gene deletion can reach more than 50% making this strategy a valuable gene disruption system. The smut fungus Ustilago maydis is a eukaryotic model microorganism showing such efficient homologous recombination. Out of its about 6,900 genes, many have been functionally characterized with the help of deletion mutants, and repeated failure of gene replacement attempts points at essential function of the gene. Subsequent characterization of the gene function by tagging with fluorescent markers or mutations of predicted domains also relies on DNA exchange via homologous recombination. Here, we present the U. maydis strain generation strategy in detail using the simplest example, the gene deletion.

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

We describe a robust gene replacement strategy to genetically manipulate the smut fungus Ustilago maydis. This protocol explains how to generate deletion mutants to investigate infection phenotypes. It can be extended to modify genes in any desired way, e.g., by adding a sequence encoding a fluorescent protein tag.

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the ...

The Use of Induced Somatic Sector Analysis (ISSA) for Studying Genes and Promoters Involved in Wood Formation and Secondary Stem Development

Secondary stem growth in trees and associated wood formation are significant both from biological and commercial perspectives. However, relatively little is known about the molecular control that governs their development. This is in part due to physical, resource and time limitations often associated with the study of secondary growth processes. A number of in vitro techniques have been used involving either plant part or whole plant system in both woody and non-woody plant species. However, questions about their applicability for the study of secondary stem growth processes, the recalcitrance of certain species and labor intensity are often prohibitive for medium to high throughput applications. Also, when looking at secondary stem development and wood formation the specific traits under investigation might only become measurable late in a tree&#39;s lifecycle after several years of growth. In addressing these challenges alternative in vivo protocols have been developed, named Induced Somatic Sector Analysis, which involve the creation of transgenic somatic tissue sectors directly in the plant&#39;s secondary stem. The aim of this protocol is to provide an efficient, easy and relatively fast means to create transgenic secondary plant tissue for gene and promoter functional characterization that can be utilized in a range of tree species. Results presented here show that transgenic secondary stem sectors can be created in all live tissues and cell types in secondary stems of a variety of tree species and that wood morphological traits as well as promoter expression patterns in secondary stems can be readily assessed facilitating medium to high throughput functional characterization.

The Use of Induced Somatic Sector Analysis ISSA for Studying Genes and Promoters Involved in Wood Formation and Secondary Stem Development

Here we present a protocol that facilitates the medium to high throughput functional characterization of gene and promoter constructs in tree secondary stem tissue within comparatively short time frames. It is efficient, easy to use and widely applicable to a range of tree species.

Secondary stem growth in trees and associated wood formation are significant both from biological and commercial perspectives. However, relatively little ...

Rapid Deletion Production in Fungi via Agrobacterium Mediated Transformation of OSCAR Deletion Constructs

Precise deletion of gene(s) of interest, while leaving the rest of the genome unchanged, provides the ideal product to determine that particular gene&#39;s function in the living organism. In this protocol the OSCAR method of precise and rapid deletion plasmid construction is described. OSCAR relies on the cloning system in which a single recombinase reaction is carried out containing the purified PCR-amplified 5&#39; and 3&#39; flanks of the gene of interest and two plasmids, pA-Hyg OSCAR (the marker vector) and pOSCAR (the assembly vector). Confirmation of the correctly assembled deletion vector is carried out by restriction digestion mapping followed by sequencing. Agrobacterium tumefaciens is then used to mediate introduction of the deletion construct into fungal spores (referred to as ATMT). Finally, a PCR assay is described to determine if the deletion construct integrated by homologous or non-homologous recombination, indicating gene deletion or ectopic integration, respectively. This approach has been successfully used for deletion of numerous genes in Verticillium dahliae and in Fusarium verticillioides among other species.

Rapid Deletion Production in Fungi via Agrobacterium Mediated Transformation of OSCAR Deletion Constructs

Gene deletion mutants generated through homologous recombination are the gold standard for gene function studies. The OSCAR (One Step Construction of Agrobacterium-Recombination-ready-plasmids) method for rapid generation of deletion constructs is described. Agrobacterium mediated fungal transformation follows. Finally, a PCR based confirmation method of gene deletions in fungal transformants is presented.

Precise deletion of gene(s) of interest, while leaving the rest of the genome unchanged, provides the ideal product to determine that particular ...

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species.
Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family,&#160;it could be easily used to other prokaryote and eukaryote species

Here, we present a protocol for tracing genomic DNA (gDNA) contamination in RNA samples. The presented method utilizes primers specific for the internal transcribed spacer region (ITS) of ribosomal DNA (rDNA) genes. The method is suited for reliable and sensitive detection of DNA contamination in most eukaryotes and prokaryotes.

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time ...

Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing

The powdery mildew fungi are a group of economically important fungal plant pathogens. Relatively little is known about the molecular biology and genetics of these pathogens, in part due to a lack of well-developed genetic and genomic resources. These organisms have large, repetitive genomes, which have made genome sequencing and assembly prohibitively difficult. Here, we describe methods for the collection, extraction, purification and quality control assessment of high molecular weight genomic DNA from one powdery mildew species, Golovinomyces cichoracearum. The protocol described includes mechanical disruption of spores followed by an optimized phenol/chloroform genomic DNA extraction. A typical yield was 7 &#181;g DNA per 150 mg conidia. The genomic DNA that is isolated using this procedure is suitable for long-read sequencing (i.e., &#62; 48.5 kbp). Quality control measures to ensure the size, yield, and purity of the genomic DNA are also described in this method. Sequencing of the genomic DNA of the quality described here will allow for the assembly and comparison of multiple powdery mildew genomes, which in turn will lead to a better understanding and improved control of this agricultural pathogen.

Described here is a method for the extraction, purification, and quality control of genomic DNA from the obligate biotrophic fungal pathogen, powdery mildew, for use in long-read genome sequencing.

The powdery mildew fungi are a group of economically important fungal plant pathogens. Relatively little is known about the molecular biology and genetics ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.

This article demonstrates a detailed protocol for DNA isolation and high-throughput sequencing library construction from herbarium material including rescue of exceptionally poor-quality DNA.

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to abiotic stresses and diseases. As the plant microbiome can be highly complex, low-cost, high-throughput methods such as amplicon-based sequencing of the 16S rRNA gene are often preferred for characterizing its microbial composition and diversity. However, the selection of appropriate methodology when conducting such experiments is critical for reducing biases that can make analysis and comparisons between samples and studies difficult. This protocol describes in detail a standardized methodology for the collection and extraction of DNA from soil, rhizosphere, and root samples. Additionally, we highlight a well-established 16S rRNA amplicon sequencing pipeline that allows for the exploration of the composition of bacterial communities in these samples, and can easily be adapted for other marker genes. This pipeline has been validated for a variety of plant species, including sorghum, maize, wheat, strawberry, and agave, and can help overcome issues associated with the contamination from plant organelles.

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Discrimintion and Mapping of the Primary and Processed Transcripts in Maize Mitochondrion Using a Circular RT-PCR-based Strategy

In plant mitochondria, some steady-state transcripts have 5&#39; triphosphate derived from transcription initiation (primary transcripts), while the others contain 5&#39; monophosphate generated post-transcriptionally (processed transcripts). To discriminate between the two types of transcripts, several strategies have been developed, and most of them depend on presence/absence of 5&#39; triphosphate. However, the triphosphate at primary 5&#39; termini is unstable, and it hinders a clear discrimination of the two types of transcripts. To systematically differentiate and map the primary and processed transcripts stably accumulated in maize mitochondrion, we have developed a circular RT-PCR (cRT-PCR)-based strategy by combining cRT-PCR, RNA 5&#39; polyphoshpatase treatment, quantitative RT-PCR (RT-qPCR), and Northern blot. As an improvement, this strategy includes an RNA normalization step to minimize the influence of unstable 5&#39; triphosphate.
In this protocol, the enriched mitochondrial RNA is pre-treated by RNA 5&#39; polyphosphatase, which converts 5&#39; triphsophate to monophosphate. After circularization and reverse transcription, the two cDNAs derived from 5&#39; polyphosphatase-treated and non-treated RNAs are normalized by maize 26S mature rRNA, which has a processed 5&#39; end and is insensitive to 5&#39; polyphosphatase. After normalization, the primary and processed transcripts are discriminated by comparing cRT-PCR and RT-qPCR products obtained from the treated and non-treated RNAs. The transcript termini are determined by cloning and sequencing of the cRT-PCR products, and then verified by Northern blot.
By using this strategy, most steady-state transcripts in maize mitochondrion have been determined. Due to the complicated transcript pattern of some mitochondrial genes, a few steady-state transcripts were not differentiated and/or mapped, though they were detected in a Northern blot. We are not sure whether this strategy is suitable to discriminate and map the steady-state transcripts in other plant mitochondria or in plastids.

We present a circular RT-PCR-based strategy by combining circular RT-PCR, quantitative RT-PCR, RNA 5&#39; polyphosphatase-treatment, and Northern blot. This protocol includes a normalization step to minimize the influence of unstable 5&#39; triphosphate, and it is suitable for discriminating and mapping the primary and processed transcripts stably accumulated in maize mitochondrion.

In plant mitochondria, some steady-state transcripts have 5&#39; triphosphate derived from transcription initiation (primary transcripts), while the ...

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to agriculture. However, the Ralstonia model is considerably underexplored in comparison to other models involving bacterial plant pathogens, such as Pseudomonas syringae in Arabidopsis. Research targeted to understanding the interaction between Ralstonia and crop plants is essential to develop sustainable solutions to fight against bacterial wilt disease but is currently hindered by the lack of straightforward experimental assays to characterize the different components of the interaction in native host plants. In this scenario, we have developed a method to perform genetic analysis of Ralstonia infection of tomato, a natural host of Ralstonia. This method is based on Agrobacterium rhizogenes-mediated transformation of tomato roots, followed by Ralstonia soil-drenching inoculation of the resulting plants, containing transformed roots expressing the construct of interest. The versatility of the root transformation assay allows performing either gene overexpression or gene silencing mediated by RNAi. As a proof of concept, we used this method to show that RNAi-mediated silencing of SlCESA6 in tomato roots conferred resistance to Ralstonia. Here, we describe this method in detail, enabling genetic approaches to understand bacterial wilt disease in a relatively short time and with small requirements of equipment and plant growth space.

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Here, we present a versatile method for tomato root transformation followed by inoculation with Ralstonia solanacearum to perform straightforward genetic analysis for the study of bacterial wilt disease.

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to ...

Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula

Summary

Explore More Videos

Chapters in this video

A Robotic Platform for High-throughput Protoplast Isolation and Transformation

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

The Use of Induced Somatic Sector Analysis (ISSA) for Studying Genes and Promoters Involved in Wood Formation and Secondary Stem Development

Rapid Deletion Production in Fungi via Agrobacterium Mediated Transformation of OSCAR Deletion Constructs

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

Discrimintion and Mapping of the Primary and Processed Transcripts in Maize Mitochondrion Using a Circular RT-PCR-based Strategy

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease