This work was supported by the Department of Defense DoD grant AZ180075. Stefan Stamm thanks Jacqueline Noonan Endowment. Anna Pawluchin was supported by the DAAD, German academic exchange program, Justin R. Welden was a recipient of the University of Kentucky Max Steckler Award.

1. Design of the constructs
<ol>
	<li>Use the UCSC genome browser24 to identify repetitive elements necessary for circular RNA formation and incorporate them in the constructs. Importantly, primers for amplification need to be outside the repetitive elements.</li>
	<li>Paste the circular RNA sequence (Supplemental Figure 1 is a test sequence) into <a href="https://genome.ucsc.edu/cgi-bin/hgBlat?command=start" target="_blank">https://genome.ucsc.edu/cgi-bin/hgBlat?command=start</a> and select the right organism. Submit the sequence and go to browser view, zoom out 1.5x or as appropriate (Figure 2A). 
	NOTE: The search sequence appears in the top line (Figure 2A, 1). Depending on the order of the exons in the circular RNA, BLAT will not connect all the exons. In this example, exon 12 (Figure 2A, 4) is not connected to 11 (Figure 2A, 2, 3), because exon 12 is upstream of exon 11 in the circular RNA sequence (Supplemental Figure 1). The repetitive elements are in the &#39;repeat masker&#39; track, indicated by boxes, where black to gray color indicates the evolutionary conservation (Figure 2A, 5).</li>
	<li>Mouse over the repetitive elements to identify their subtype in a floating window. Alu elements are in the SINE (short interspersed nuclear element) line. Use the &#39;default tracks&#39; button under the window to reset the browser if a different picture than Figure 2 is obtained. 
	NOTE: Mousing over the exons in the gene display generates a window with exon numbers that are computer generated. These numbers do not correspond to the exon numbering established in the literature and also change between isoforms.</li>
</ol>
2. Select the sequence to be cloned in an expression vector
<ol>
	<li>Download the DNA sequence shown in the window by going to View &#8594; DNA on the top line of the UCSC genome browser. In the Sequencing Formatting Option, select Extended Case/Color Options.</li>
	<li>Select the default case as Lower and select toggle case for NCBI refseq. Select underline, and bold, and italic for Repeat Masker. Click Submit. There will be exons as capital letters and introns as small letters. Check the exon/intron borders.</li>
	<li>In this example there is a &#39;ccctttacCTTTTT&#39; sequence, indicating that the browser shows the reverse complement. If this is the case, go back and select the reverse complement box until seeing the correct exon intron borders (agEXONgt), in this example AAAAAGgtaaaggg.</li>
	<li>Copy the file with the correct orientation (internal exons are surrounded by intronic ag&#8230;gt) into a word processing document and highlight the exons (Supplemental Figure 2). 
	NOTE: In this example, the genomic fragment encompassing exons 9-12 is around 24 kb and thus too large to be amplified from genomic DNA. Therefore, each exon surrounded by about 1 kb intronic region is individually amplified and these four fragments are assembled in a cloning vector.</li>
	<li>Select fragments to be amplified (exon &#177; 500 nt intron). Make sure that the intron does not begin or end in a repetitive region, as primers in these regions will not amplify specific sequences. The selected regions are shown in Figure 2B, and their sequences are shown in Supplemental Figure 3. 
	NOTE: In general, the larger the constructs, the more difficult the cloning will be. The fragments can be assembled either step wise (i.e., exon 9 is combined with the vector and in the next step exon 10 is introduced into this construct via cloning until all exons are in place), or alternatively, all fragments are assembled simultaneously. A stepwise approach always works but requires more time. A simultaneous assembly does not always work and depends on how well the individual fragments can be amplified from genomic DNA and on the overall size of the construct. We therefore usually start with both approaches simultaneously.</li>
</ol>
3. Design primers for cloning
<ol>
	<li>Use a web tool (<a href="https://nebuilder.neb.com/#!/" target="_blank">https://nebuilder.neb.com/#!/</a>) to design the primers for cloning. For example, enter fragments 9, 10, 11 and 12 and the vector sequence (Supplemental Figure 3) to this tool.</li>
	<li>For the vector sequence, add the insertion site as the last nucleotide and subsequently add the fragments. Since the vector numbering does not start with a given insertion site, the site of insertion in the vector is located and the downstream part is put in in front of the upstream sequence. In this example the inserts start directly after the HindIII [AAGCTT] site and ends directly after the PmeI [GTTTAAAC] site of pcDNA3.1. The sequence from cccgctgatcag &#8230; ccgtaaaaaggccgc is pasted in front of position 1 in the pcDNA3.1 sequence (gttgctggcgtttttcc &#8230;).</li>
	<li>Adjust primers if their melting points are more than 4 &#176;C apart, as they will not work in amplification. The assembly of the fragments and primer sequences designed are shown in Supplemental Figure 4. Primers for cloning can also be designed manually25.</li>
</ol>
4. PCR and amplicon detection
<ol>
	<li>Standard PCR Reaction: Make a reaction mix for total volume of 50 &#181;L per reaction. Below is the recipe for one reaction using polymerase 1: 
	10 &#181;L of 5x Reaction Buffer 
	1 &#181;L of 10 mM dNTPs 
	2.5 &#181;L of 10 &#181;M Forward Primer 
	2.5 &#181;L of 10 &#181;M Reverse Primer 
	0.5 &#181;L of Polymerase 1 
	32.5 &#181;L of Nuclease free H2O
	<ol>
		<li>Optionally, add 10 &#181;L of 5x GC Enhancer if the product has high GC content; make a separate mix containing GC Enhancer to test PCR reaction.</li>
	</ol>
	</li>
	<li>Aliquot 49 &#181;L of the mix into PCR tubes per reaction sample.</li>
	<li>Add 1 &#181;L of DNA to the PCR, the amount ranges from 10 pg to 1 ng.</li>
	<li>Spin down the samples to remove residue off the sides and place them in a PCR machine. Use the same machine as well as same spots in the machine when optimizing the PCR conditions.</li>
</ol>
5. Optimization for longer DNA fragments for use of different polymerases
<ol>
	<li>Temperature
	<ol>
		<li>Optimize the long-range Polymerase 2.
		<ol>
			<li>Use a lower denaturation temperature (Polymerase 1: 98 &#176;C, Polymerase 2: 94 &#176;C).</li>
			<li>Use a longer denaturation time (Polymerase 1: 10 s, Polymerase 2: 30 s).</li>
			<li>Use a longer annealing time (Polymerase 1: 30 s, Polymerase 2: 60 s).</li>
			<li>Use a longer extension time (Polymerase 1: 30 s/kb, Polymerase 2: 50 s/kb).</li>
			<li>Use a lower extension temperature (Polymerase 1: 72 &#176;C, Polymerase 2: 65 &#176;C).</li>
			<li>Use an annealing temperature 5 &#176;C below the Tm of the primers.</li>
		</ol>
		</li>
		<li>Optimize the primer concentrations (5x less to 5x more than the original primer concentration). Optimize DNA concentrations from 10 pg to 50 pg, 100 pg, 1 ng, 5 ng, 10 ng.</li>
		<li>As an example of a PCR program to amplify a 15 kb product size using Polymerase 2, perform an initial denaturation at 94 &#176;C for 30 s, DNA denaturation at 94 &#176;C for 30 s followed by annealing at 58 &#176;C for 30 s, and DNA extension at 65 &#176;C for 12 min 30 s. Perform a final extension at 65 &#176;C for 10 min with a final 4 &#176;C hold. 
		NOTE: The annealing temperature (Ta) specific for the primers determined by web-based temperature calculations that are specific for each polymerase. Extension times may vary and need to be optimized if fragments are larger than 10 kb.</li>
	</ol>
	</li>
	<li>Extension times and DNA concentrations
	<ol>
		<li>Use longer extension times for DNA fragments over 6 kb: 1 min per 1 kb. Longer fragments should use less DNA.</li>
		<li>Perform dilutions of DNA to find the optimum DNA concentration for amplification, usually 1 pg to 1 ng for plasmids or 1 ng to 1 &#181;g for genomic DNA. 
		NOTE: For most cloning use polymerase 1, engineered by fusing the Sso7d DNA binding domain to a proprietary thermostable DNA polymerase26. The polymerase has a low error rate and due to the Sso7d domain a high processivity, needed to amplify large (10-15 kb) genomic fragments. Due to this large fragment size, enzymatic assembly of DNA molecules27 is used for insertion into vectors, as this method does not require restriction enzymes. The amplification of fragments longer than 15 kb gets increasingly difficult with polymerase 1. For large fragment amplification use polymerase 2 made from pyrococcus-like proofreading polymerase fused to Sso7d or the long range PCR kit that gives, however, higher error rates.</li>
	</ol>
	</li>
</ol>
6. Purification of PCR products for cloning
<ol>
	<li>Run half of the PCR products on 1% agarose gels containing an intercalating nucleic acid stain (e.g., 1x GelGreen). Visualize the stained gels on a dark reader transilluminator. This stained DNA does not run true to size. 
	NOTE: GelGreen intercalates into DNA, similar to ethidium bromide, but it is excited by light around 500 nm (cyan), a wavelength that does not damage DNA, which highly improves cloning.</li>
	<li>In parallel, run half of the PCR products on a 1% gel that is stained post-run with ethidium bromide (Figure 3A,B).</li>
	<li>Excise bands of the right size from the stained gel (step 6.1) and isolate DNA using a gel and PCR cleanup kit. In deviation from its standard protocol, elute the DNA in only 20 &#181;L of double distilled water, as usually the DNA concentrations are low.</li>
	<li>Prior to cloning, check the isolated DNA on an agarose gel for concentration and integrity (Figure 3B). Aim for a 2:1 molar insert to vector ratio. When using several inserts, the ratio is 2:2:2:1.</li>
</ol>
7. DNA assembly and clone detection
NOTE: Cloning is done using an enzymatic DNA assembly kit, with minor modifications. The assembly is performed for 60 min at 50 &#176;C and generally the lower range of DNA is used for assembly (20-100 fmol/20 &#181;L reaction). The whole reaction mix is added to chemical competent cells and the whole cells plated out on a 6 cm agar plate.
<ol>
	<li>Combine the vector and insert in a 1:2 molar ratio (20-500 fmol each) in 10 &#181;L of water.</li>
	<li>Add 10 &#181;L of DNA Assembly Master Mix.</li>
	<li>Incubate samples for 60 minutes at 50 &#176;C.</li>
	<li>Next, transform competent cells with the total assembly reaction. Here, use E. coli strain 1 cells for shorter constructs or E. coli strain 2 cells for longer or unstable constructs. Cells should be in a 50 &#181;L volume.</li>
	<li>Thaw cells on ice and add 2 &#181;L of the chilled assembled product to the competent cells. Mix by gently flicking the tube 4-5 times. Do not vortex.</li>
	<li>Let the mixture sit on ice for 30 min.</li>
	<li>Heat shock at 42 &#176;C for 30 s. Do not mix.</li>
	<li>Transfer the tube back to ice for 2 min.</li>
	<li>Add 950 &#181;L of room-temperature SOC Media to the tube.</li>
	<li>Incubate the reaction tube at 37 &#176;C for 60 min. Shake vigorously (300 rpm).</li>
	<li>Warm selection plates with the appropriate antibiotic during incubation at 37 &#176;C.</li>
	<li>Pellet the cells through centrifugation (10,000 x g, 30 s) and plate out &#188; and &#190; of cells on two selection plates and incubate at 37 &#176;C overnight.</li>
</ol>
8. Validation of clones
<ol>
	<li>Use colony PCR, employing PCR primers spanning the assembly sites (Figure 1C) for detection.</li>
	<li>Take a sterile toothpick and touch a single bacterial colony.</li>
	<li>Touch the bottom of a PCR tube with the toothpick that has the colony and then streak the toothpick on an antibiotic agar plate, incubate the streaked plate at 37 &#176;C or room temperature for sensitive constructs overnight.</li>
	<li>Overlay the PCR tube touched with the colony with a PCR mix containing the detection primers. These are designed using primer 3 (<a href="http://bioinfo.ut.ee/primer3-0.4.0/" target="_blank">http://bioinfo.ut.ee/primer3-0.4.0/</a>). The program has the option to force primer design across a defined sequence using the &#34;[ccc]&#34; signs to select primers across the assembly junction. DNA from positive strains is isolated and verified by sequencing.</li>
</ol>
9. Analysis of circular RNA expressing reporter genes
<ol>
	<li>For analysis, transfect reporter genes into eukaryotic cells. Here, use HEK293 cells (ATTC #CRL-1573) as they give high transfection efficiency. To save costs, use PEI (polyethyleneimine) solutions.</li>
	<li>For the PEI solution, dissolve linear polyethyleneimine hydrochloride (PEI) at 1 mg/mL in water at low pH, pH 2. Bring up the pH to 7 with NaOH. Sterile filter with 0.22 &#181;m filters and store at 4 &#176;C.</li>
	<li>Split cells into six wells (approximately 150,000 cells per well) and let them grow overnight in 10% FBS in DMEM media.</li>
	<li>Aliquot 1 &#181;g of the reporter gene in a sterile tube and add 200 &#181;L of sterile filtered 150 mM NaCl. Mix with the DNA by vortexing.</li>
	<li>Add PEI solution to this mix and vortex, briefly centrifuge to collect samples at bottom of tube. Use a ratio of 1 &#181;g of DNA per 3 &#181;L of PEI.</li>
	<li>Incubate at room temperature for 10 min and then add directly to HEK 293 cells.</li>
	<li>Incubate HEK293 cells at 37 &#176;C, 5% CO2, overnight.</li>
	<li>Isolate RNA for RT-PCR via an RNA isolation kit.</li>
</ol>
10. RNase R treatment to remove linear RNAs
<ol>
	<li>Use 10 &#181;g of total RNA in an RNase-free tube.</li>
	<li>Add 10 &#181;L of 10x RNase R buffer (0.2 M Tris-HCl (pH 8.0), 1 M KCl, 1 mM MgCl2) to RNA.</li>
	<li>Add RNase R to RNA (1 &#181;l = 20U).</li>
	<li>Add 1 &#181;L of glycol blue to the RNA and bring the volume up to 100 &#181;L with sterile water.</li>
	<li>Incubate samples at 37 &#176;C for 30 min.</li>
	<li>Add 100 &#181;L of phenol/chloroform and vortex for 1 min.</li>
	<li>Centrifuge at 21,000 x g for 1 min to separate phases.</li>
	<li>Take the supernatant (aqueous phase) and add 1 volume (around 80 &#181;L of chloroform).</li>
	<li>Vortex for 1 min, and then centrifuge for 1 min to separate phases.</li>
	<li>Take supernatant, add 1:10 vol KAc and 2.5 vol ethanol, and precipitate at -20 &#176;C for 1-4 h. Centrifuge at 4 &#176;C for 30 min at full speed (21,000 x g). There will be a small blue pellet at the bottom.</li>
	<li>Remove the supernatant, and wash with 80% ethanol. Let air dry for 5 min at room temperature, and dissolve in 10 &#181;L water.</li>
</ol>
11. RT-PCR analysis
<ol>
	<li>Use 1 &#181;g of RNA per RT reaction.</li>
	<li>Make reaction mix for a final total volume of 20 &#181;L per reaction. For one reaction, use 1 &#181;L of 10 mM dNTPs, 1 &#181;L of 0.1 M Dithiothreitol (DTT), 4 &#181;L of 5x First-Strand Buffer, and 0.5 &#181;L of Reverse Transcriptase.</li>
	<li>Aliquot 6.5 &#181;L of reaction mix into new PCR tubes.</li>
	<li>Mix up to 5 primers in one mix. However, some primers may mis-pair with other primers in the PCR (Figure 5). Primer sequences are in Table 2. We routinely use gene-specific exon-junction primers but priming with random hexamers is also possible.</li>
	<li>Add 1 &#181;L of 10 &#181;M Reverse primer to desired RT reaction tube.</li>
	<li>Add 1 &#181;g of RNA to PCR reaction tube.</li>
	<li>Add RNase-free H2O up to a total volume of 20 &#181;L.</li>
	<li>Spin tubes down to remove residue on side of tubes and place in thermocycler.</li>
	<li>Run the RT reaction in thermocycler at 50 &#176;C for 50 minutes.</li>
	<li>Store RT cDNA at -20 &#176;C or proceed to the PCR reaction.</li>
</ol>

<ol>
	<li>Jeck, W. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circular+RNAs+are+abundant,+conserved,+and+associated+with+ALU+repeats.">Circular RNAs are abundant, conserved, and associated with ALU repeats.</a> RNA. 19 (2), 141-157 (2013).</li><li>Zhang, X. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complementary+sequence-mediated+exon+circularization.">Complementary sequence-mediated exon circularization.</a> Cell. 159 (1), 134-147 (2014).</li><li>Deininger, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alu+elements:+know+the+SINEs.">Alu elements: know the SINEs.</a> Genome Biology. 12 (12), 236 (2011).</li><li>Bazak, L., Levanon, E. Y., Eisenberg, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+Alu+editability.">Genome-wide analysis of Alu editability.</a> Nucleic Acids Research. 42 (11), 6876-6884 (2014).</li><li>Levanon, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+abundant+A-to-I+editing+sites+in+the+human+transcriptome.">Systematic identification of abundant A-to-I editing sites in the human transcriptome.</a> Nature Biotechnology. 22 (8), 1001-1005 (2004).</li><li>Hansen, T. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+RNA+circles+function+as+efficient+microRNA+sponges.">Natural RNA circles function as efficient microRNA sponges.</a> Nature. 495 (7441), 384-388 (2013).</li><li>Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exon+Skipping+Is+Correlated+with+Exon+Circularization.">Exon Skipping Is Correlated with Exon Circularization.</a> Journal of Molecular Biology. 427 (15), 2414-2417 (2015).</li><li>Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exon-intron+circular+RNAs+regulate+transcription+in+the+nucleus.">Exon-intron circular RNAs regulate transcription in the nucleus.</a> Nature Structural &amp; Molecular Biology. 22 (3), 256-264 (2015).</li><li>Yang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extensive+translation+of+circular+RNAs+driven+by+N(6)-methyladenosine.">Extensive translation of circular RNAs driven by N(6)-methyladenosine.</a> Cell Research. 27 (6), 626-641 (2017).</li><li>Abe, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rolling+Circle+Translation+of+Circular+RNA+in+Living+Human+Cells.">Rolling Circle Translation of Circular RNA in Living Human Cells.</a> Scientific Reports. 5, 16435 (2015).</li><li>Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-type+specific+features+of+circular+RNA+expression.">Cell-type specific features of circular RNA expression.</a> PLOS Genetics. 9 (9), 1003777 (2013).</li><li>Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Survival+Motor+Neuron+genes+generate+a+vast+repertoire+of+circular+RNAs.">Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs.</a> Nucleic Acids Research. 47 (6), 2884-2905 (2019).</li><li>Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+in+vivo+minigene+approach+to+analyze+tissue-specific+splicing.">The in vivo minigene approach to analyze tissue-specific splicing.</a> Brain Research Protocols. 4, 383-394 (1999).</li><li>Mardon, H. J., Sebastio, G., Baralle, F. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+role+for+exon+sequences+in+alternative+splicing+of+the+human+fibronectin+gene.">A role for exon sequences in alternative splicing of the human fibronectin gene.</a> Nucleic Acids Research. 15, 7725-7733 (1987).</li><li>Gaildrat, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+splicing+reporter+minigene+assay+to+evaluate+the+effect+on+splicing+of+unclassified+genetic+variants.">Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants.</a> Methods in Molecular Biology. 653, 249-257 (2010).</li><li>Cooper, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+minigene+systems+to+dissect+alternative+splicing+elements.">Use of minigene systems to dissect alternative splicing elements.</a> Methods. 37 (4), 331-340 (2005).</li><li>Baralle, D., Baralle, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Splicing+in+action:+assessing+disease+causing+sequence+changes.">Splicing in action: assessing disease causing sequence changes.</a> Journal of Medical Genetics. 42 (10), 737-748 (2005).</li><li>Percifield, R., Murphy, D., Stoilov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Medium+throughput+analysis+of+alternative+splicing+by+fluorescently+labeled+RT-PCR.">Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR.</a> Methods in Molecular Biology. 1126, 299-313 (2014).</li><li>Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-throughput+screening+strategy+identifies+cardiotonic+steroids+as+alternative+splicing+modulators.">A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators.</a> Proceedings of the National Academy of Sciences of the United States of America. 105 (32), 11218-11223 (2008).</li><li>Shen, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrvinium+pamoate+changes+alternative+splicing+of+the+serotonin+receptor+2C+by+influencing+its+RNA+structure.">Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure.</a> Nucleic Acids Research. 41 (6), 3819-3832 (2013).</li><li>Noto, J. J., Schmidt, C. A., Matera, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+and+expressing+circular+RNAs+via+tRNA+splicing.">Engineering and expressing circular RNAs via tRNA splicing.</a> RNA Biology. , 1-7 (2017).</li><li>Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Method+for+Expressing+and+Imaging+Abundant,+Stable,+Circular+RNAs+In+Vivo+Using+tRNA+Splicing.">A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing.</a> Methods in Enzymology. 572, 215-236 (2016).</li><li>Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+MAPT+locus+generates+circular+RNAs.">The human MAPT locus generates circular RNAs.</a> Biochimica et Biophysica Acta - Molecular Basis of Disease. , 2753-2760 (2018).</li><li>Casper, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+UCSC+Genome+Browser+database:+2018+update.">The UCSC Genome Browser database: 2018 update.</a> Nucleic Acids Research. 46, 762-769 (2018).</li><li>Grozdanov, P. N., MacDonald, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+plasmid+vectors+expressing+FLAG-tagged+proteins+under+the+regulation+of+human+elongation+factor-1alpha+promoter+using+Gibson+assembly.">Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly.</a> Journal of Visualized Experiments. (96), (2015).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+strategy+to+engineer+DNA+polymerases+for+enhanced+processivity+and+improved+performance+in+vitro.">A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro.</a> Nucleic Acids Research. 32 (3), 1197-1207 (2004).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Conn, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RNA+binding+protein+quaking+regulates+formation+of+circRNAs.">The RNA binding protein quaking regulates formation of circRNAs.</a> Cell. 160 (6), 1125-1134 (2015).</li><li>Jeck, W. R., Sharpless, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+and+characterizing+circular+RNAs.">Detecting and characterizing circular RNAs.</a> Nature Biotechnology. 32 (5), 453-461 (2014).</li><li>Pamudurti, N. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+of+CircRNAs.">Translation of CircRNAs.</a> Molecular Cell. 66 (1), 9-21 (2017).</li><li>Kramer, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+control+of+Drosophila+circular+RNA+expression+by+intronic+repeats,+hnRNPs,+and+SR+proteins.">Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins.</a> Genes &amp; Development. 29 (20), 2168-2182 (2015).</li><li>Starke, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exon+circularization+requires+canonical+splice+signals.">Exon circularization requires canonical splice signals.</a> Cell Reports. 10 (1), 103-111 (2015).</li><li>Suzuki, H., Tsukahara, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+view+of+pre-mRNA+splicing+from+RNase+R+resistant+RNAs.">A view of pre-mRNA splicing from RNase R resistant RNAs.</a> International Journal of Molecular Sciences. 15 (6), 9331-9342 (2014).</li><li>Zhang, X. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+alternative+back-splicing+and+alternative+splicing+landscape+of+circular+RNAs.">Diverse alternative back-splicing and alternative splicing landscape of circular RNAs.</a> Genome Research. 26 (9), 1277-1287 (2016).</li><li>Liang, D., Wilusz, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short+intronic+repeat+sequences+facilitate+circular+RNA+production.">Short intronic repeat sequences facilitate circular RNA production.</a> Genes &amp; Development. 28 (20), 2233-2247 (2014).</li><li>Wang, Y., Mandelkow, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tau+in+physiology+and+pathology.">Tau in physiology and pathology.</a> Nature Reviews Neuroscience. 17 (1), 5-21 (2016).</li><li>Fejes-Toth, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-transcriptional+processing+generates+a+diversity+of+5'-modified+long+and+short+RNAs.">Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs.</a> Nature. 457 (7232), 1028-1032 (2009).</li><li>Gao, Q. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complex+regulation+of+tau+exon+10,+whose+missplicing+causes+frontotemporal+dementia.">Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia.</a> Journal of Neurochemistry. 74 (2), 490-500 (2000).</li><li>Hartmann, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+alternative+splicing+of+human+tau+exon+10+by+phosphorylation+of+splicing+factors.">Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors.</a> Molecular and Cellular Neuroscience. 18 (1), 80-90 (2001).</li><li>Wang, Y., Wang, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+backsplicing+produces+translatable+circular+mRNAs.">Efficient backsplicing produces translatable circular mRNAs.</a> RNA. 21 (2), 172-179 (2015).</li><li>Yang, Y., Wang, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Constructing+GFP-Based+Reporter+to+Study+Back+Splicing+and+Translation+of+Circular+RNA.">Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA.</a> Methods in Molecular Biology. 1724, 107-118 (2018).</li><li>Zheng, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circular+RNA+profiling+reveals+an+abundant+circHIPK3+that+regulates+cell+growth+by+sponging+multiple+miRNAs.">Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs.</a> Nature Communications. 7, 11215 (2016).</li><li>Jia, W., Xu, B., Wu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circular+RNA+expression+profiles+of+mouse+ovaries+during+postnatal+development+and+the+function+of+circular+RNA+epidermal+growth+factor+receptor+in+granulosa+cells.">Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells.</a> Metabolism. 85, 192-204 (2018).</li><li>Liang, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Output+of+Protein-Coding+Genes+Shifts+to+Circular+RNAs+When+the+Pre-mRNA+Processing+Machinery+Is+Limiting.">The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting.</a> Molecular Cell. 68 (5), 940-954 (2017).</li><li>Legnini, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circ-ZNF609+Is+a+Circular+RNA+that+Can+Be+Translated+and+Functions+in+Myogenesis.">Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis.</a> Molecular Cell. 66 (1), 22-37 (2017).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+circRNA+Biogenesis+and+Function+with+NF90/NF110+in+Viral+Infection.">Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection.</a> Molecular Cell. 67 (2), 214-227 (2017).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Biogenesis+of+Nascent+Circular+RNAs.">The Biogenesis of Nascent Circular RNAs.</a> Cell Reports. 15 (3), 611-624 (2016).</li></ol>

Nothing to disclose.

In general, circular RNAs are low abundant1, which complicates the study of their function and formation. Similar to linear RNAs13, the use of reporter minigenes allows the identification of cis and trans-acting factors that regulate the formation of circular RNAs. Thus, this approach generates hypotheses that can be further tested using the endogenous genes.
The most critical step is the design of the reporter gene. The enzymatic assembly of DNA fragments (&#34;Gibson cloning&#34;27) facilitates this design, as it allows construction of large reporter genes independent of restriction sites.
The back-splicing sites are brought together through flanking inverted repeats, which should be taken into account in reporter gene construction. The repeats are annotated in the genome browser &#39;repeat track&#39; and selecting them shows their orientation. Keep in mind that proteins can also force the back-splicing sites into a secondary structure needed for circular RNA expression28 and for an unbiased analysis 1-2 kb of flanking intronic regions should be investigated.
To ensure stability of the constructs, an important consideration is the type of bacterial strains and their growth conditions. For shorter, simple constructs standard cloning bacteria are used, which are almost identical to DH5-alpha (huA2 &#916;(argF-lacZ)U169 phoA glnV44 &#934;80 &#916;(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). For longer fragments, containing more than 6 Alu elements, &#34;stable&#34; competent cells are used that lack a recombinase (recA) and endonuclease (endA1) (F&#39; proA+B+ lacIq &#8710;(lacZ)M15 zzf::Tn10 (TetR) &#8710;(ara-leu) 7697 araD139 fhuA &#8710;lacX74 galK16 galE15 e14- &#934;80dlacZ&#8710;M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 &#8710;(mrr-hsdRMS-mcrBC). If problems appear with recombination, indicated by low transformation counts, plate the transformed bacteria on two plates and let them grow at 30 &#186;C and 37 &#186;C, respectively. Due to the presence of numerous repetitive elements in the minigenes, they need to be fully sequenced using next generation sequencing, which is commercially available for around $150 per plasmid at 2019 rates. The sequence of the example is shown in Supplemental Figure 5. In addition, restriction fragment length polymorphism analysis for new larger preparation of the constructs is routinely performed. For example, using sites that cut 1-4 times results in a characteristic band pattern that rules out recombinations (Figure 4). Enzymes should be selected that give a characteristic band pattern of fragments that can be separated on an agarose gel.
Circular RNAs are analyzed with RT-PCR using exon junction primers that overlap with the backsplicing event (Figure 1F). Due to the circular nature of the RNA, the reverse (i.e. antisense) primer is upstream of the forward (i.e. sense) primer (Figure 1G). Primers detecting the abundantly expressed homeodomain-interacting protein kinase 3 (HIPK3) circular RNA1 are used as a positive control. HIPK3 and minigene specific reverse primers are reverse transcribed in the same tube, which allows their comparison. PCR reactions are performed with primers amplifying the linear mRNAs to compare processing patterns of circular and linear pre-mRNAs. We frequently observed aberrant bands when primers for linear and circular RNAs were mixed (Figure 5), and thus keep the reverse transcription of these samples separate.
RT-PCR analysis of circular RNAs is challenging and needs to be carefully controlled. While sensitive and convenient, it can produce artifacts unique for circular RNAs29. The reverse transcriptase can move several times around the RNA circle, which generates concatemers. Most circular RNA reporter genes generate both circular and linear RNA, which can cross-hybridize, leading to more PCR artifacts21,30,31. It is thus imperative to sequence the PCR products and validate findings using different techniques using Northern blots32 or RNase protections23.
Unexplained bands can also originate from aberrant amplification of linear RNA. Linear RNA can be removed using the exonuclease RNase R, which enriches circular RNAs33 (Figure 5C). RNase R treatment helps in the initial optimization of detection primers and can often be omitted once primers are optimized.
Alternative back-splicing can also contribute to unexplained bands as multiple circular RNAs can be formed from a genomic locus34. This alternative back-splicing is often the result of competing pre-mRNA structures formed by more than two inverted repeat elements. In addition, cryptic back-splice sites can occur32,35. Depending on the experimental goal, Alu elements can be repeated or added to the constructs. The complementary regions flanking back-splicing sites can be as short as 30-40 nt35 and replacement of Alu elements with shorter complementary regions can increase circular RNA formation2, which can be tested to improve circular RNA formation. Once the pre-mRNA sequences that cause back-splicing have been identified, it is thus possible to shorten circular RNA expressing constructs, which can improve transfection efficiency in some cases.

Circular RNAs 
Circular RNAs (circRNAs) are covalently closed single stranded RNAs that are expressed in most organisms. They are generated by joining a downstream 5&#39; splice site to an upstream 3&#39; splice site, a process called back-splicing (Figure 1A)1. Sequences in the pre-mRNA that exhibit base complementary as short as 30-40 nt bring back-splice sites into proper alignment for circRNA formation2. In humans, Alu elements1, representing about 11% of the genome3, form extensive double stranded RNA structures in pre-mRNA due to their self-complementarity4,5 and thus promote the formation of circRNAs1.
Currently, three major functions of circRNAs have been described. Some circRNAs bind microRNAs (miRNAs) and through sequestration act like miRNA sponges6. CircRNAs have been implicated in transcriptional and post transcriptional regulation, through competition with linear splicing7 or modulation of transcription factor activity8. Finally, circRNAs contain short open reading frames and proof of principle studies show that they can be translated9,10. However, the function of most circRNAs remains enigmatic. The majority of circular RNAs have been detected using next-generation sequencing methods11. Detailed analyses of individual genes using targeted RT-PCR approaches reveal that a large number of circular RNAs remains to be discovered12.
Use of reporter genes to analyze pre-mRNA processing 
The analysis of mRNA derived from DNA reporter constructs transfected into cells is a well-established method to study alternative pre-mRNA splicing, which can be applied to circular RNAs. In general, the alternative exon, its surrounding introns, and constitutive exons are amplified and cloned into a eukaryotic expression vector. Frequently, the introns are shortened. The constructs are transfected into eukaryotic cells and usually analyzed by RT-PCR13,14. This approach has been extensively used to map regulatory splice sites and trans-acting factors in co-transfection experiments13,15,16,17,18. In addition, the generation of protein-expressing minigenes allowed for screening of substances that change alternative splicing19,20.
The method has been applied to circular RNAs. Currently, at least 12 minigene backbones have been described in the literature and are summarized in Table 1. With the exception of the tRNA based expression system21,22, they are all dependent on polymerase II promoters. Here, we describe a method to generate human reporter minigenes to determine cis and trans-acting factors involved in the generation of circular RNAs. An overview of the method using sequences of a published reporter gene23 is shown in Figure 1.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>(PEI) Hydrochloride</td>
			<td>Polysciences</td>
			<td>24765-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Builder tool</td>
			<td>NEB</td>
			<td></td>
			<td><a href="https://nebuilder.neb.com/#!/" target="_blank">https://nebuilder.neb.com/#!/</a></td>
		</tr>
		<tr>
			<td>Dark Reader Transilluminator.</td>
			<td>Clare Chemical Research</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Enzymatic DNA assembly kit</td>
			<td>NEB</td>
			<td>E2621S</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel and PCR cleanup kit</td>
			<td>Promega</td>
			<td>A9282</td>
			<td></td>
		</tr>
		<tr>
			<td>Glyco Blue</td>
			<td>Thermo Fisher</td>
			<td>AM9516</td>
			<td></td>
		</tr>
		<tr>
			<td>pcDNA3.1 cloning site</td>
			<td>Polycloning site</td>
			<td></td>
			<td><a href="https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf" target="_blank">https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf</a></td>
		</tr>
		<tr>
			<td>Polymerase 1</td>
			<td>NEB</td>
			<td>M0491L</td>
			<td>Q5 DNA polymerase</td>
		</tr>
		<tr>
			<td>Polymerase 2</td>
			<td>Biorad</td>
			<td>1725310</td>
			<td>Long range polymerase (NEB), iproof (BioRad)</td>
		</tr>
		<tr>
			<td>Polymerase 2</td>
			<td>Qiagen</td>
			<td>206402</td>
			<td>Qiagen long range polymerase kit</td>
		</tr>
		<tr>
			<td>Reverse Transcriptase</td>
			<td>Thermo Fisher</td>
			<td>18080044</td>
			<td></td>
		</tr>
		<tr>
			<td>RNA isolation kit</td>
			<td>Life Technologies</td>
			<td>12183025</td>
			<td>Ambion by Life Technologies</td>
		</tr>
		<tr>
			<td>RNAse R</td>
			<td>Lucigen</td>
			<td>RNR07250</td>
			<td>Epicenter/Lucigen</td>
		</tr>
		<tr>
			<td>Stable competent cells</td>
			<td>NEB</td>
			<td>C3040H</td>
			<td>NEB stable cells</td>
		</tr>
		<tr>
			<td>Standard cloning bacteria</td>
			<td>NEB</td>
			<td>C2988J</td>
			<td>NEB5-alpha competent</td>
		</tr>
		<tr>
			<td>Web tool to design primers</td>
			<td>NEB</td>
			<td></td>
			<td><a href="https://nebuilder.neb.com/#!/" target="_blank">https://nebuilder.neb.com/#!/</a></td>
		</tr>
		<tr>
			<td>Web-based temperature calculations</td>
			<td>NEB</td>
			<td></td>
			<td><a href="https://tmcalculator.neb.com/#!/main" target="_blank">https://tmcalculator.neb.com/#!/main</a></td>
		</tr>
	</tbody>
</table>

use of alu element containing minigenes to analyze circular rnas

In addition to linear mRNAs, many eukaryotic genes generate circular RNAs. Most circular RNAs are generated by joining a 5&#39; splice site with an upstream 3&#39; splice site within a pre-mRNA, a process called back-splicing. This circularization is likely aided by secondary structures in the pre-mRNA that bring the splice sites into close proximity. In human genes, Alu elements are thought to promote these secondary RNA structures, as Alu elements are abundant and exhibit base complementarities with each other when present in opposite directions in the pre-mRNA. Here, we describe the generation and analysis of large, Alu element containing reporter genes that form circular RNAs. Through optimization of cloning protocols, reporter genes with up to 20 kb insert length can be generated. Their analysis in co-transfection experiments allows the identification of regulatory factors. Thus, this method can identify RNA sequences and cellular components involved in circular RNA formation.

Reporter genes allow determination of regulatory factors that influence circular RNA formation. However, these reporter genes are large and contain repetitive elements that often make DNA constructs unstable. Due to their large size, it is often necessary to delete parts of the introns, which is achieved by amplifying genomic pieces containing the exons and smaller flanking intronic parts. These DNA pieces are enzymatically assembled, allowing construction without restriction enzymes.
The example of a circular RNA generated from the microtubule associated protein tau (MAPT) shows an application of the minigene approach to analyze circular RNAs. The tau 9&#8594;12 minigene used in this example was co-transfected with different splicing factors and the effect of these splicing factors was detected by RT-PCR (Figure 6). Different trans-acting factors influence both circular RNA and linear pre-mRNA formation. The experiment also shows that all the sequence elements necessary for circular RNA formation are localized in the cloned fragment.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59760/59760fig1.jpg" /> 
Figure 1: Overview of the technique. (A) A hypothetical gene is shown. Introns are lines, exons are boxes, Alu elements are smaller striped boxes. Backsplicing from exon C to A creates a circular RNA. The structure of this circular RNA is shown in panel (E). (B) To create a reporter gene, exons and surrounding introns (at least 500 nt on each side) are amplified. The constructs should contain repetitive elements, which are usually Alu elements in humans. An exon upstream of exon A was included to provide an additional Alu element. The genomic fragments will overlap with their flanking 25 nts. (C) Fragments are cloned into an expression vector, driven by a CMV promoter. The successful recombination is detected by detection primers and validated by sequencing. (D) Cells are transfected with this construct. (E) Circular RNA is isolated and (F) amplified using circular RNA specific primers, preferable exon junction primers. During PCR amplification, linear RNA can also be amplified (G). (G) Orientation of the primers used to detect circular RNAs. The forward primer is in sense orientation (i.e., has the same sequence as the RNA) and the reverse primer is in antisense orientation (i.e., is the reverse complement of the RNA). Note that different from RT-PCR for linear mRNAs, the reverse primer is upstream of the forward primer. <a href="https://www.jove.com/files/ftp_upload/59760/59760fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59760/59760fig2.jpg" /> 
Figure 2: Selection of the sequence for minigene construction. (A) Browser display after the sequence shown in Supplemental Figure 1 is run against the human genomic database using BLAT. Literature exon numbers36 are indicated in the gene display, they are different from the numbers given by the browser. 
1. The aligned sequences are shown under &#39;YourSeq&#39; 
2-4. Note that due to the circularity of the RNA, BLAT does not connect all exons with lines as it does in linear RNA. Exons 10 and 11 (corresponding to 2 and 3) are connected, but exon 12 (corresponding to 4) is not connected to exon 11. 
5. Alu elements are shown in the repetitive element track. 
(B) Sequence alignment between the planned construct and genomic DNA. 
6. The planned construct was run against the database using BLAT. 
7. Note the inclusion of several Alu elements in the construct. <a href="https://www.jove.com/files/ftp_upload/59760/59760fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59760/59760fig3a.jpg" /> 
Figure 3: Example of the amplicons prior to cloning. (A) Optimized PCR products separated on a 1% agarose gel containing 1x GelGreen. The individual bands represent the PCR products that will be used in enzymatic DNA assembly. (B) The bands from (A) were cut out from the gel and purified. The purified PCR products were separated on a 1% agarose gel, which was subsequently stained with ethidium bromide. <a href="https://www.jove.com/files/ftp_upload/59760/59760fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59760/59760fig4a.jpg" /> 
Figure 4: Restriction analysis of reporter genes. The tau 9-12 minigene used as an example was cut with restriction enzymes indicated to rule out major recombinations. Lane 1: cut with NcoI expected sizes 735 bp, 3345 bp, 6266 bp, lane 2 cut with XbaI expected size 10346 bp, lane 3 cut with HindIII expected sizes 3951 bp, 6395 bp, lane 4 cut with SmaI expected sizes 1168 bp, 1688 bp, 2708 bp, 4782 bp. <a href="https://www.jove.com/files/ftp_upload/59760/59760fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/59760/59760fig5a.jpg" /> 
Figure 5: Effect of primer multiplexing and RNase R treatment on circular RNA detection. (A) cDNA from samples A and B derived from human brain tissues was amplified with circular RNA primers circTau exon12_10 Reverse and circTau exon10_11 Forward. The reverse transcription for the cDNA was performed with the primers for linear and circular tau RNA. The expected band corresponding to tau circular RNA is shown by a triangle. The other strong bands are artifacts that did not match the human genome. (B) The experiment was repeated with identical PCR conditions, but the reverse transcription was performed only with the circTau exon12_10 Reverse primer. Only the expected band was amplified and validated through sequencing. (C) The RNA was treated with RNase R that removes linear RNA. The circular RNA is detectable after the treatment (left), whereas linear RNA gives no longer a detectable signal (right) <a href="https://www.jove.com/files/ftp_upload/59760/59760fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/59760/59760fig6a.jpg" /> 
Figure 6: Example of an analysis of a circRNA reporter gene. 1 &#181;g of the tau 9&#8594;1237 reporter gene was transfected with 1 &#181;g of splicing factors indicated. RNA was isolated 24 h post transfection and analyzed by RT-PCR. (A) Amplification of the linear tau mRNA. Due to alternative splicing of exon 10 two bands are observed. Their ratio changes due to the overexpression of splicing factors38,39. (B) Amplification of the circular 12&#8594;10 tau RNA23. Note the dependency of tau circRNA expression on expression of some splicing factors, especially the cdc2 like kinase clk2 and the SR protein 9G8. (C) The circular RNA of HIPK3 was used as a positive control indicating equal loading. <a href="https://www.jove.com/files/ftp_upload/59760/59760fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Table 1: List of current minigenes expressing circular RNAs. <a href="https://www.jove.com/files/ftp_upload/59760/Table_1.xlsx" target="_blank">Please click here to download this file.</a>
<table>
	<tbody>
		<tr>
			<td>Circular HIPK3 Control Primers</td>
			<td></td>
		</tr>
		<tr>
			<td>HIPK3 Reverse 
			HIPK3 Forward</td>
			<td>TGCTTGGCTCTACTTTGAGTTTC 
			TCGGCCAGTCATGTATCAAA</td>
		</tr>
		<tr>
			<td>Linear Primers</td>
			<td></td>
		</tr>
		<tr>
			<td>Tau Exon 12 Reverse 
			Tau Exon 9 Forward</td>
			<td>CCCAATCTTCGACTGGACTC 
			TGTCAAGTCCAAGATCGGCT</td>
		</tr>
		<tr>
			<td>Circular Primers</td>
			<td></td>
		</tr>
		<tr>
			<td>circTau exon12_10 Reverse 
			circTau exon10_11 Forward</td>
			<td>CAGCTTCTTATTAATTATCTGCACCTTTT 
			GAGGCGGCAGTGTGCAA</td>
		</tr>
	</tbody>
</table>
Table 2: List of Primers.
<img alt="Supplemental Figure 1" src="/files/ftp_upload/59760/59760supfig1.jpg" /> 
Supplemental Figure 1: Tau circular RNA test sequence. Test sequence corresponding to a circular RNA from the MAPT locus. Different exons are indicated by underline, small caps and large caps. <a href="https://www.jove.com/files/ftp_upload/59760/59760supfig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Supplemental Figure 2" src="/files/ftp_upload/59760/59760supfig2.jpg" /> 
Supplemental Figure 2: Genomic sequence containing the planned minigene. Exons are highlighted in color and repetitive elements are underlined, italic and bold. Gray shading indicates flanking regions of low complexity that can be used to generate primers. <a href="https://www.jove.com/files/ftp_upload/59760/Supplemental_Figure_2.docx" target="_blank">Please click here to download this file.</a>
<img alt="Supplemental Figure 3" src="/files/ftp_upload/59760/59760supfig3.jpg" /> 
Supplemental Figure 3: Sequences of the planned reporter gene. The vector sequence and the planned genomic fragments are shown. <a href="https://www.jove.com/files/ftp_upload/59760/Supplemental_Figure_3.docx" target="_blank">Please click here to download this file.</a>
<img alt="Supplemental Figure 4" src="/files/ftp_upload/59760/59760supfig4.jpg" /> 
Supplemental Figure 4: Primers design for assembly. The sequence from Supplemental Figure 3 was entered into the builder tool. <a href="https://www.jove.com/files/ftp_upload/59760/59760supfig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Supplemental Figure 5" src="/files/ftp_upload/59760/59760supfig5.jpg" /> 
Supplemental Figure 5: Sequence of the tau 9-&#62;12 reporter gene used as an example. <a href="https://www.jove.com/files/ftp_upload/59760/Supplemental_Fig._5.docx" target="_blank">Please click here to download this file.</a>

Watch this Scientific Journal Video about Use of Alu Element Containing Minigenes to Analyze Circular RNAs at JoVE.com

Use of Alu Element Containing Minigenes to Analyze Circular RNAs

We clone and analyze reporter genes generating circular RNAs. These reporter genes are larger than constructs to analyze linear splicing and contain Alu elements. To investigate the circular RNAs, the constructs are transfected into cells and resulting RNA is analyzed using RT-PCR after removal of linear RNA.

Use of Alu Element Containing Minigenes to Analyze Circular RNAs

In addition to linear mRNAs, many eukaryotic genes generate circular RNAs. Most circular RNAs are generated by joining a 5&#39; splice site with an ...

use-of-alu-element-containing-minigenes-to-analyze-circular-rnas

Nanyang Technological University

Research

JoVE Journal

Biochemistry

7.2K Views.  University of Kentucky. We clone and analyze reporter genes generating circular RNAs. These reporter genes are larger than constructs to analyze linear splicing and contain Alu elements. To investigate the circular RNAs, the constructs are transfected into cells and resulting RNA is analyzed using RT-PCR after removal of linear RNA.

Video: Use of Alu Element Containing Minigenes to Analyze Circular RNAs

Combining Wet and Dry Lab Techniques to Guide the Crystallization of Large Coiled-coil Containing Proteins

Obtaining crystals for structure determination can be a difficult and time consuming proposition for any protein. Coiled-coil proteins and domains are found throughout nature, however, because of their physical properties and tendency to aggregate, they are traditionally viewed as being especially difficult to crystallize. Here, we utilize a variety of quick and simple techniques designed to identify a series of possible domain boundaries for a given coiled-coil protein, and then quickly characterize the behavior of these proteins in solution. With the addition of a strongly fluorescent tag (mRuby2), protein characterization is simple and straightforward. The target protein can be readily visualized under normal lighting and can be quantified with the use of an appropriate imager. The goal is to quickly identify candidates that can be removed from the crystallization pipeline because they are unlikely to succeed, affording more time for the best candidates and fewer funds expended on proteins that do not produce crystals. This process can be iterated to incorporate information gained from initial screening efforts, can be adapted for high-throughput expression and purification procedures, and is augmented by robotic screening for crystallization.

We describe a framework incorporating straightforward biochemical and computational analysis to guide the characterization and crystallization of large coiled-coil domains. This framework can be adapted for globular proteins or extended to incorporate a variety of high-throughput techniques.

Obtaining crystals for structure determination can be a difficult and time consuming proposition for any protein. Coiled-coil proteins and domains are ...

Method to Visualize and Analyze Membrane Interacting Proteins by Transmission Electron Microscopy

Monotopic proteins exert their function when attached to a membrane surface, and such interactions depend on the specific lipid composition and on the availability of enough area to perform the function. Nanodiscs are used to provide a membrane surface of controlled size and lipid content. In the absence of bound extrinsic proteins, sodium phosphotungstate-stained nanodiscs appear as stacks of coins when viewed from the side by transmission electron microscopy (TEM). This protocol is therefore designed to intentionally promote stacking; consequently, the prevention of stacking can be interpreted as the binding of the membrane-binding protein to the nanodisc. In a further step, the TEM images of the protein-nanodisc complexes can be processed with standard single-particle methods to yield low-resolution structures as a basis for higher resolution cryoEM work. Furthermore, the nanodiscs provide samples suitable for either TEM or non-denaturing gel electrophoresis. To illustrate the method, Ca2+-induced binding of 5-lipoxygenase on nanodiscs is presented.

Many proteins perform their function when attached to membrane surfaces. The binding of extrinsic proteins on nanodisc membranes can be indirectly imaged by transmission electron microscopy. We show that the characteristic stacking (rouleau) of nanodiscs induced by the negative stain sodium phosphotungstate is prevented by the binding of extrinsic protein.

Monotopic proteins exert their function when attached to a membrane surface, and such interactions depend on the specific lipid composition and on the ...

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. The relative levels of different tRNAs, and the ratio of aminoacylated tRNA to total tRNA, known as the charging level, are important factors in determining the accuracy and speed of translation. Therefore, the abundance and charging levels of tRNAs are important variables to measure when studying protein synthesis, for example under various stress conditions. Here, we describe a method for harvesting tRNA and directly measuring both the relative abundance and the absolute charging level of specific tRNA species in Escherichia coli. The tRNA is harvested in such a way that the labile bond between the tRNA and its amino acid is preserved. The RNA is then subjected to gel electrophoresis and Northern blotting, which results in separation of the charged and uncharged tRNAs. The levels of specific tRNAs in different samples can be compared due to the addition of spike-in cells for normalization. Prior to RNA purification, we add 5% of E. coli cells that overproduce the rare tRNAselC to each sample. The amount of the tRNA species of interest in a sample is then normalized to the amount of tRNAselC in the same sample. Addition of spike-in cells prior to RNA purification has the advantage over addition of purified spike-in RNAs that it also accounts for any differences in cell lysis efficiency between samples.

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Here we present a method for directly measuring transfer RNA charging levels from purified Escherichia coli RNA as well as a way to compare relative levels of transfer RNA, or any other short RNA, across different samples based on the addition of spike-in cells expressing a reference gene.

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. ...

Simultaneous Measurement of Superoxide/Hydrogen Peroxide and NADH Production by Flavin-containing Mitochondrial Dehydrogenases

It has been reported that mitochondria can contain up to 12 enzymatic sources of reactive oxygen species (ROS). A majority of these sites include flavin-dependent respiratory complexes and dehydrogenases that produce a mixture of superoxide (O2&#9679;-) and hydrogen peroxide (H2O2). Accurate quantification of the ROS-producing potential of individual sites in isolated mitochondria can be challenging due to the presence of antioxidant defense systems&#160;and side reactions that also form O2&#9679;-/H2O2. Use&#160;of nonspecific inhibitors that can disrupt mitochondrial bioenergetics can also compromise measurements by altering&#160;ROS release from other sites of production. Here, we present an easy method for the simultaneous measurement of H2O2 release and nicotinamide adenine dinucleotide (NADH) production by purified flavin-linked dehydrogenases. For our purposes here, we have used purified pyruvate dehydrogenase complex (PDHC) and &#945;-ketoglutarate dehydrogenase complex (KGDHC) of porcine heart origin as examples. This method allows for an accurate measure of native H2O2 release rates by individual sites of production by eliminating other potential sources of ROS and antioxidant systems. In addition, this method allows for a direct comparison of the relationship between H2O2 release and enzyme activity and the screening of the effectiveness and selectivity of inhibitors for ROS production. Overall, this approach can allow for the in-depth assessment of native rates of ROS release for individual enzymes prior to conducting more sophisticated experiments with isolated mitochondria or permeabilized muscle fiber.

Mitochondria contain several flavin-dependent enzymes that can produce reactive oxygen species (ROS). Monitoring ROS release from individual sites in mitochondria is challenging due to unwanted side reactions. We present an easy, inexpensive method for direct assessment of native rates for ROS release using purified flavoenzymes and microplate fluorometry.

It has been reported that mitochondria can contain up to 12 enzymatic sources of reactive oxygen species (ROS). A majority of these sites include ...

Use of Two Dimensional Semi-denaturing Detergent Agarose Gel Electrophoresis to Confirm Size Heterogeneity of Amyloid or Amyloid-like Fibers

Amyloid or amyloid-like fibers have been associated with many human diseases, and are now being discovered to be important for many signaling pathways. The ability to readily detect the formation of these fibers under various experimental conditions is essential for understanding their potential function. Many methods have been used to detect the fibers, but not without some drawbacks. For example, electron microscopy (EM), or staining with Congo Red or Thioflavin T often requires purification of the fibers. On the other hand, semi-denaturing detergent agarose gel electrophoresis (SDD-AGE) allows detection of the SDS-resistant amyloid-like fibers in the cell extracts without purification. In addition, it allows the comparison of the size difference of the fibers. More importantly, it can be used to identify specific proteins within the fibers by Western blotting. It is less time consuming and more easily accessible to a wider number of labs. SDD-AGE results often show variable degree of heterogeneity. It raises the question whether part of the heterogeneity results from the dissociation of the protein complex during the electrophoresis in the presence of SDS. For this reason, we have employed a second dimension of SDD-AGE to determine if the size heterogeneity seen in SDD-AGE is truly a result of fiber heterogeneity in vivo and not a result of either degradation or dissociation of some of the proteins during electrophoresis. This method allows fast, qualitative confirmation that the amyloid or amyloid-like fibers are not partially dissociating during the SDD-AGE process.

Here we use two-dimensional semi-denaturing agarose gel electrophoresis to confirm the presence of amyloid-like fibers of heterogeneous size and exclude the possibility that the size heterogeneity is due to dissociation of the amyloid fibers during the gel running process.

Amyloid or amyloid-like fibers have been associated with many human diseases, and are now being discovered to be important for many signaling pathways. ...

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts of recombinant RNAs are limited. Here, we describe a protocol to produce large amounts of recombinant RNA in Escherichia coli based on co-expression of a chimeric molecule that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. Viroids are relatively small, non-coding, highly base-paired circular RNAs that are infectious to higher plants. The host plant tRNA ligase is an enzyme recruited by viroids that belong to the family Avsunviroidae, such as Eggplant latent viroid (ELVd), to mediate RNA circularization during viroid replication. Although ELVd does not replicate in E. coli, an ELVd precursor is efficiently transcribed by the E. coli RNA polymerase and processed by the embedded hammerhead ribozymes in bacterial cells, and the resulting monomers are circularized by the co-expressed tRNA ligase reaching a remarkable concentration. The insertion of an RNA of interest into the ELVd scaffold enables the production of tens of milligrams of the recombinant RNA per liter of bacterial culture in regular laboratory conditions. A main fraction of the RNA product is circular, a feature that facilitates the purification of the recombinant RNA to virtual homogeneity. In this protocol, a complementary DNA (cDNA) corresponding to the RNA of interest is inserted in a particular position of the ELVd cDNA in an expression plasmid that is used, along the plasmid to co-express eggplant tRNA ligase, to transform E. coli. Co-expression of both molecules under the control of strong constitutive promoters leads to production of large amounts of the recombinant RNA. The recombinant RNA can be extracted from the bacterial cells and separated from the bulk of bacterial RNAs taking advantage of its circularity.

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

Here, we present a protocol to produce large amounts of recombinant RNA in Escherichia coli by co-expressing a chimeric RNA that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. The main product is a circular molecule that facilitates purification to homogeneity.

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this superfamily generally display multi-functionality, involving mainly hydrolase and decarboxylase mechanisms. This article presents a series of consecutive methods for the expression and purification of FAHD proteins, mainly FAHD protein 1 (FAHD1) orthologues among species (human, mouse, nematodes, plants, etc.). Covered methods are protein expression in E. coli, affinity chromatography, ion exchange chromatography, preparative and analytical gel filtration, crystallization, X-ray diffraction, and photometric assays. Concentrated protein of high levels of purity (&#62;98%) may be employed for crystallization or antibody production. Proteins of similar or lower quality may be employed in enzyme assays or used as antigens in detection systems (Western-Blot, ELISA). In the discussion of this work, the identified enzymatic mechanisms of FAHD1 are outlined to describe its hydrolase and decarboxylase bi-functionality in more detail.

Expression and purification of fumarylacetoacetate hydrolase domain-containing proteins is described with examples (expression in E. coli, FPLC). Purified proteins are used for crystallization and antibody production and employed for enzyme assays. Selected photometric assays are presented to display the multi-functionality of FAHD1 as oxaloacetate decarboxylase and acylpyruvate hydrolase.

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Use of Microscale Thermophoresis to Measure Protein-Lipid Interactions

The ability to determine the binding affinity of lipids to proteins is an essential part of understanding protein-lipid interactions in membrane trafficking, signal transduction and cytoskeletal remodeling. Classic tools for measuring such interactions include surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC). While powerful tools, these approaches have setbacks. ITC requires large amounts of purified protein as well as lipids, which can be costly and difficult to produce. Furthermore, ITC as well as SPR are very time consuming, which could add significantly to the cost of performing these experiments. One way to bypass these restrictions is to use the relatively new technique of microscale thermophoresis (MST). MST is fast and cost effective using small amounts of sample to obtain a saturation curve for a given binding event. There currently are two types of MST systems available. One type of MST requires labeling with a fluorophore in the blue or red spectrum. The second system relies on the intrinsic fluorescence of aromatic amino acids in the UV range. Both systems detect the movement of molecules in response to localized induction of heat from an infrared laser. Each approach has its advantages and disadvantages. Label-free MST can use untagged native proteins; however, many analytes, including pharmaceuticals, fluoresce in the UV range, which can interfere with determination of accurate KD values. In comparison, labeled MST allows for a greater diversity of measurable pairwise interactions utilizing fluorescently labeled probes attached to ligands with measurable absorbances in the visible range as opposed to UV, limiting the potential for interfering signals from analytes.

Microscale thermophoresis obtains binding constants quickly at low material cost. Either labeled or label free microscale thermophoresis is commercially available; however, label free thermophoresis is not capable of the diversity of interaction measurements that can be performed using fluorescent labels. We provide a protocol for labeled thermophoresis measurements.

The ability to determine the binding affinity of lipids to proteins is an essential part of understanding protein-lipid interactions in membrane ...

Quantification of Humic and Fulvic Acids in Humate Ores, DOC, Humified Materials and Humic Substance-Containing Commercial Products

The purpose of this method is to provide an accurate and precise concentration of humic (HA) and/or fulvic acids (FA) in soft coals, humic ores and shales, peats, composts and humic substance-containing commercial products. The method is based on the alkaline extraction of test materials, using 0.1 N NaOH as an extractant, and separation of the alkaline soluble humic substances (HS) from nonsoluble products by centrifugation. The pH of the centrifuged alkaline extract is then adjusted to pH 1 with conc. HCl, which results in precipitation of the HA. The precipitated HA are separated from the fulvic fraction (FF) (the fraction of HS that remains in solution,) by centrifugation. The HA is then oven or freeze dried and the ash content of the dried HA determined. The weight of the pure (i.e., ash-free) HA is then divided by the weight of the sample and the resulting fraction multiplied by 100 to determine the % HA in the sample. To determine the FA content, the FF is loaded onto a hydrophobic DAX-8 resin, which adsorbs the FA fraction also referred to as the hydrophobic fulvic acid (HFA). The remaining non-fulvic acid fraction, also called the hydrophilic fulvic fraction (HyFF) is then removed by washing the resin with deionized H2O until all nonabsorbed material is completely removed. The FA is then desorbed with 0.1 N NaOH. The resulting Na-fulvate is then protonated by passing it over a strong H+-exchange resin. The resulting FA is oven or freeze dried, the ash content determined and the concentration in the sample calculated as described above for HA.

This method provides a gravimetric quantification of humic substances (e.g., humic and fulvic acids) on an ash-free basis, in dry and liquid materials from soft coals (i.e., oxidized and non-oxidized lignite and sub-bituminous coal), humate ores and shales, peats, composts and commercial fertilizers and soil amendments.

The purpose of this method is to provide an accurate and precise concentration of humic (HA) and/or fulvic acids (FA) in soft coals, humic ores and ...

Ready-To-Use qPCR for Detection of DNA from Trypanosoma cruzi or Other Pathogenic Organisms

Real-time PCR (qPCR) is a remarkably sensitive and precise technique&#160;that allows for amplifying&#160;minute amounts of nucleic acid targets from a multitude of samples. It has been extensively used in many research areas and achieved industrial application in fields such as human diagnostics and trait selection in crops of genetically modified organisms (GMO) crops. However, qPCR is not an error-proof technique. Mixing all reagents into a single master mix subsequently distributed onto 96 wells of a regular qPCR plate might lead to operator mistakes such as incorrect mixing of reagents or inaccurate dispensing into the wells. Here, a technique called gelification is presented, whereby most of the water present in the master mix is substituted by reagents that form a sol-gel mixture when submitted to a vacuum. As a result, qPCR reagents are effectively preserved for a few weeks at room temperature or a few months at 2-8 oC. Details of preparing each solution are shown here along with the expected aspect of a gelified reaction designed to detect&#160;T. cruzi satellite DNA (satDNA). A similar procedure can be applied to detect other organisms. Starting a gelified qPCR run is as simple as removing the plate from the refrigerator, adding the samples to their respective wells, and starting the run, thus decreasing the setup time of a full-plate reaction to the time it takes to load the samples. Additionally, gelified PCR reactions can be produced and controlled for quality in batches, saving time and avoiding common operator mistakes while running routine PCR reactions.

Ready-To-Use qPCR for Detection of DNA from Trypanosoma cruzi or Other Pathogenic Organisms

The present work describes the steps for producing ready-to-use qPCR for T. cruzi DNA detection that can be pre-loaded on the reaction vessel and stored in the refrigerator for several months.

Real-time PCR (qPCR) is a remarkably sensitive and precise technique&#160;that allows for amplifying&#160;minute amounts of nucleic acid targets from a ...