Name: in situ hybridization for sipunculus nudus coelomic fluid
Uploaded: 2020-05-01T14:45:00.000+00:00
Duration: 7 min 35 s
Description: Watch this Scientific Journal Video about In situ Hybridization for Sipunculus nudus Coelomic Fluid at JoVE.com

This work was supported by the Young Scientists Fund of the National Natural Science Foundation of China (Grant No. 31801034), the Natural Science Foundation of Fujian Province, China (2016J01161), the Scientific Research Funds of Huaqiao University (15BS306) and Postgraduates&#8217; Innovative Fund in Scientific Research of Huaqiao University.

The animal procedure was approved by the Animal Care and Welfare Committee of Huaqiao University.
1. Riboprobe preparation
<ol>
	<li>Primer design
	<ol>
		<li>Open the program Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/primer3/). Copy the dmrt1 sequence (GenBank: MK182259) into the sequence window.</li>
		<li>Set primer length (23-25 bp), melting temperature (55-60 &#176;C), and G/C content (40-60%). Click Pick Primers. 
		NOTE: The minimal size required for the RNA probe is approximately 500 bp. Longer probes normally have higher specificity.</li>
		<li>Add the T7 RNA polymerase promoter sequence (5, -TAATACGACTCACTATAGGG-3,) to one of the selected primers. The dmrt1 primer sequences for ISH are shown in Table 1. 
		NOTE: For sense probes, the T7 RNA polymerase promoter is located at the 5&#8217; end of the forward primers. For antisense probes, the T7 RNA polymerase promoter is located at the 5&#8217;-end of the reverse primers.</li>
	</ol>
	</li>
	<li>PCR amplification
	<ol>
		<li>Place the microfuge tubes on ice, and prepare the following reaction mix (for a 50 &#181;L reaction): 1x &#160;Taq DNA polymerase mix, 1 &#181;g of cDNA (which is prepared from 100 &#181;L of coelomic fluid), 1 &#181;M forward primer, 1 &#181;M reverse primer and nuclease-free water.</li>
		<li>Mix the PCR reaction by pipetting and centrifuge briefly.</li>
		<li>Place the reaction tube in a thermal cycler, and run the PCR using the following conditions: initial denaturation at 95 &#176;C for 2 min followed by 36 cycles of denaturation at 95 &#176;C for 30 s, annealing at 55-60 &#176;C for 30 s, extension at 72 &#176;C for 30 s and a final extension at 72 &#176;C for 7 min. 
		NOTE: The annealing temperature should be optimized according to the primers.</li>
	</ol>
	</li>
	<li>PCR product purification and verification
	<ol>
		<li>Load the 50 &#181;L of PCR mixture directly on a 1% agarose gel. Run the agarose gel at 150-180 V for 10 min in 0.5x TBE. Isolate the specific DNA fragments from the 1% agarose gel. 
		NOTE: DNA should appear as a single band and not as a smear.</li>
		<li>Purify the DNA fragments using a gel extraction kit according to the manufacturer&#39;s protocol. Quantify the purified products by spectrophotometry at a wavelength of 260 nm.</li>
		<li>Verify the authenticity of the PCR products by sequencing. 
		NOTE: (Pause point) The purified PCR products can be stored at -20 &#176;C for several months.</li>
	</ol>
	</li>
	<li>Riboprobe synthesis
	<ol>
		<li>Place the RNase-free microfuge tubes on ice, and add the following to the microfuge tube (for a 10 &#181;L reaction): 1x Digoxygenin RNA Labeling Mix, 1x transcription buffer, 0.5 &#181;L of RNase inhibitors, 1 &#181;L of T7 RNA polymerases, 1 &#181;g of PCR product and RNase-free water. Mix the reaction by pipetting and centrifuge briefly. Incubate for 2 h at 37 &#176;C.</li>
		<li>Add 2 &#181;L of RNase-free DNase I. Mix the reaction by pipetting and centrifuge briefly. Incubate for 15 min at 37 &#176;C.</li>
		<li>Add 2 &#181;L 0.2 M EDTA (pH 8.0). Mix the reaction by pipetting and centrifuge briefly.</li>
		<li>Add 2.5 &#181;L of 4 M LiCl and 75 &#181;L of prechilled ethanol to the above reaction. Mix well. Leave for 30 min at -70 &#176;C.</li>
		<li>Centrifuge at 12,000 x g for 10 min at 4 &#176;C. Decant the ethanol. Add 1 mL of prechilled 70% ethanol (v/v) and wash the precipitation by mixing gently.</li>
		<li>Centrifuge at 12,000 x g for 5 min at 4 &#176;C. Decant the 70% ethanol and dry the precipitation briefly near an alcohol lamp. Dissolve the precipitation by adding 30 &#181;L of RNase-free water and mix gently.</li>
		<li>Load 2 &#181;L of synthesized RNA on a 1% agarose gel. Run the agarose gel at 180 V for 5-10 min in 0.5x TBE. Measure the concentration of the labeled RNA using a spectrophotometer at a wavelength of 260 nm.
		<ol>
			<li>Use RNase-free microfuge tubes and filter tips to avoid RNase contamination. 
			NOTE: (Pause point) The digoxygenin-labeled probes can be stored at -70 &#176;C for several months.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Coelomic fluid collection
<ol>
	<li>Fix the S. nudus on the dissection table with pins. Open the body of the S. nudus with small autoclaved scissors. Isolate the coelomic fluid with a pipette.</li>
	<li>Collect and transfer 1 mL coelomic fluid with a pipette to poly-D-lysine treated microscope slides. Apply the coelomic fluid evenly with a pipette tip. Air-dry the slides for 1 h at 37 &#176;C.</li>
</ol>
3. In situ hybridization
<ol>
	<li>Day 1
	<ol>
		<li>Rehydrate the slides in a slide staining jar containing 100 mL of 1x diethyl pyrocarbonate treated phosphate buffered saline (DEPC-PBS). Rehydrate 3 times with 1x DEPC-PBS, 5 min per wash with gentle agitation.</li>
		<li>Permeabilize the smear of coelomic fluid by digestion with 10 &#181;g/mL proteinase K at room temperature for 5 min. Incubate the slides in 4% paraformaldehyde (PFA) for 20 min to stop the digestion. Wash the slides in 1x DEPC-PBS with gentle agitation for 5 min 3 times.</li>
		<li>Add 50 &#181;L of hybridization mix (HM) containing the sense/antisense riboprobe on the slides and add a cover slip.</li>
		<li>Add wet box buffer into the wet box. Put the slides into the wet box and seal well with paraffin film. Hybridize overnight (at least 16 h) at 60 &#176;C.</li>
	</ol>
	</li>
	<li>Day 2
	<ol>
		<li>Preheat the wash buffer at 65 &#176;C. Immerse the slide in the slide staining jar containing the wash buffer and let it stand until the coverslip slides off automatically. It takes about 5 min.</li>
		<li>Wash 2 times with wash buffer at 65 &#176;C, 30 min per wash with gentle agitation. Wash 2 times with 0.2x saline-sodium citrate (SSC) at 65 &#176;C, 30 min per wash with gentle agitation. Wash 2 times with maleic acid buffer containing Tween 20 (MABT) at room temperature, 30 min per wash with gentle agitation.</li>
		<li>Incubate the slides at room temperature for 3&#8211;4 h in the blocking buffer. Incubate the slides in 1 mL anti-digoxigenin-AP Fab fragments solution diluted at 1/5000 with the blocking buffer at 4 &#176;C overnight.</li>
	</ol>
	</li>
	<li>Day 3
	<ol>
		<li>Remove the antibody solution and wash the slides briefly in MABT. Wash 4 times with MABT at room temperature, 25 min per wash with gentle agitation.</li>
		<li>Incubate the slides with alkaline phosphatase buffer at room temperature 3 times, 5 min per wash. Remove the alkaline phosphatase buffer, and add 1 mL of 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) staining solution. Keep the slides in the dark.</li>
		<li>Observe the color reaction periodically under an optical microscope. When the color is fully developed (reaction time in the range of 1-4 h), wash the slides 2 times with MABT at room temperature, 5 min per wash with gentle agitation.</li>
		<li>Wash 2 times with stop solution at room temperature, 15 min per wash with gentle agitation. Incubate the slides in methanol to remove excess stain, at room temperature for 30 min. According to the background color, the methanol wash can be done 2 or 3 times and the decolorization time can be extended.</li>
		<li>Wash 2 times with MABT at room temperature, 5 min per wash with gentle agitation. Transfer the slides to a fresh filter paper. Add 50 &#181;L of glycerol. Add the coverslips and observe microscopically. 
		NOTE: The solution composition is showed in Table 2.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Tsai, C. J., Harding, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization.">In situ hybridization.</a> Methods in Cell Biology. 113, 339-359 (2013).</li><li>Koshiba-Takeuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-mount+and+section+in+situ+hybridization+in+mouse+embryos+for+detecting+mRNA+expression+and+localization.">Whole-mount and section in situ hybridization in mouse embryos for detecting mRNA expression and localization.</a> Methods in Cell Biology. 1752, 123-131 (2018).</li><li>Wu, J., Feng, J. Q., Wang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+on+mouse+paraffin+sections+using+DIG-labeled+RNA+probes.">In situ hybridization on mouse paraffin sections using DIG-labeled RNA probes.</a> Methods in Molecular Biology. 1922, 163-171 (2019).</li><li>Thisse, C., Thisse, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+resolution+in+situ+hybridization+on+whole-mount+zebrafish+embryo.">High resolution in situ hybridization on whole-mount zebrafish embryo.</a> Nature Protocols. 3, 59-69 (2008).</li><li>Luc, H., Sears, C., Raczka, A., Gross, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wholemount+in+situ+hybridization+for+Astyanax+embryos.">Wholemount in situ hybridization for Astyanax embryos.</a> Journal of Visualized Experiments. (145), (2019).</li><li>Abler, L. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high+throughput+in+situ+hybridization+method+to+characterize+mRNA+expression+patterns+in+the+fetal+mouse+lower+urogenital+tract.">A high throughput in situ hybridization method to characterize mRNA expression patterns in the fetal mouse lower urogenital tract.</a> Journal of Visualized Experiments. (54), (2011).</li><li>Du, X., Chen, Z., Deng, Y., Wang, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+genetic+diversity+and+population+structure+of+Sipunculus+nudus+as+revealed+by+mitochondrial+COI+sequences.">Comparative analysis of genetic diversity and population structure of Sipunculus nudus as revealed by mitochondrial COI sequences.</a> Biochemical Genetics. 47, 884 (2009).</li><li>Lemer, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Re-evaluating+the+phylogeny+of+Sipuncula+through+transcriptomics.">Re-evaluating the phylogeny of Sipuncula through transcriptomics.</a> Molecular Phylogenetics and Evolution. 83, 174-183 (2015).</li><li>Jiang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radioprotective+effects+of+Sipunculus+nudus+L.+polysaccharide+combined+with+WR-2721,+rhIL-11+and+rhG-CSF+on+radiation-injured+mice.">Radioprotective effects of Sipunculus nudus L. polysaccharide combined with WR-2721, rhIL-11 and rhG-CSF on radiation-injured mice.</a> Journal of Radiation Research. 56, 515-522 (2015).</li><li>Zhang, C. X., Dai, Z. R., Cai, Q. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-inflammatory+and+anti-nociceptive+activities+of+Sipunculus+nudus+L.+extract.">Anti-inflammatory and anti-nociceptive activities of Sipunculus nudus L. extract.</a> Journal of Ethnopharmacology. 137, 1177-1182 (2011).</li><li>Ying, X. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fine+structure+of+coelomocytes+in+the+sipunculid+Phascolosoma+esculenta.">The fine structure of coelomocytes in the sipunculid Phascolosoma esculenta.</a> Micron. 41, 71-78 (2010).</li><li>Raymond, C. S., Murphy, M. W., O'Sullivan, M. G., Bardwell, V. J., Zarkower, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dmrt1,+a+gene+related+to+worm+and+fly+sexual+regulators,+is+required+for+mammalian+testis+differentiation.">Dmrt1, a gene related to worm and fly sexual regulators, is required for mammalian testis differentiation.</a> Genes &amp; Development. 14, 2587-2595 (2000).</li><li>Kopp, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dmrt+genes+in+the+development+and+evolution+of+sexual+dimorphism.">Dmrt genes in the development and evolution of sexual dimorphism.</a> Trends in Genetics. 28, 175-184 (2012).</li><li>Wu, G. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Testicular+dmrt1+is+involved+in+the+sexual+fate+of+the+ovotestis+in+the+protandrous+black+porgy.">Testicular dmrt1 is involved in the sexual fate of the ovotestis in the protandrous black porgy.</a> Biology of Reproduction. 86, 41 (2012).</li><li>Li, W. H., Wu, Y. Q., Ma, G. X., Yuan, M. R., Xu, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+expression+analysis+of+peanut+worms+transcription+factor+dmrt1.">Cloning and expression analysis of peanut worms transcription factor dmrt1.</a> Acta Hydrobiologica Sinica. 43, 1210-1215 (2019).</li><li>Wang, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAscope:+a+novel+in+situ+RNA+analysis+platform+for+formalin-fixed,+paraffin-embedded+tissues.">RNAscope: a novel in situ RNA analysis platform for formalin-fixed, paraffin-embedded tissues.</a> Journal of Molecular Diagnostics. 14, 22-29 (2012).</li><li>Baleriola, J., Jean, Y., Troy, C., Hengst, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+axonally+localized+mRNAs+in+brain+sections+using+high-resolution+in+situ+hybridization.">Detection of axonally localized mRNAs in brain sections using high-resolution in situ hybridization.</a> Journal of Visualized Experiments. (100), e52799 (2015).</li><li>Wilkinson, D. G., Nieto, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+messenger+RNA+by+in+situ+hybridization+to+tissue+sections+and+whole+mounts.">Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts.</a> Methods in Enzymology. 225, 361 (1993).</li></ol>

The authors have nothing to disclose.

Previous studies showed that ISH is suitable for detecting multiple target RNAs16,17,18. In this protocol, we described a high-resolution ISH method to detect the mRNA in coelomic fluid and emphasize the optimized hybridization conditions in Sipunculus nudus. The obvious signals of dmrt1 we observed demonstrated the successful application of this protocol in the detection of gene expression (Figure 2).
During the experiment, a series of steps need to be given particular attention. Firstly, sense riboprobes for the target genes must be synthesized as the control. After the synthesis, the quality of the riboprobe should be checked on a gel. Poor RNA synthesis will result in no staining in the sections. Secondly, the sample collection process should be gentle to prevent cell deformation and the experiment must be performed immediately after coelomic fluid collection to prevent RNA degradation. Thirdly, incubation time and times should be exactly followed in all steps without shortening or lengthening. In particular, pay attention to the timing of proteinase K treatment. Too long treatment time of proteinase K will lead to the destruction of the cell structure of the sample, while too short treatment time will not allow the riboprobe to enter the cell properly. Finally, slides should not dry out during the experiment. This method involves a hybridization step at 60 &#176;C, which will increase the risks of reagent evaporation. As stated in the protocol section, slides must be put into a wet box and covered with paraffin film to avoid evaporation.
One limitation of this protocol is the acquisition of riboprobe sequences in non-model organism Sipunculus nudus, because poorly sequenced mRNA may confer low specificity of the riboprobe. With the development of sequencing technology, more and more high-quality sequences of Sipunculus nudus will be released, which will greatly improve this situation.

ISH, using a labeled nucleic acid probe to detect the specific DNA or RNA sequence of interest, is a useful method to describe the spatial expression pattern of target genes in morphologically preserved tissues1,2,3. Normally, the target sequence is generated by polymerase chain reaction (PCR), and then used as the template to synthesize the antisense/sense RNA probe labeled with digoxigenin uridine-5&#8217;-triphosphate. Samples are fixed and permeabilized before incubation with riboprobe. After washing off the excess probe, hybridization is visualized by immunohistochemistry using an anti-digoxygenin antibody, which is alkaline phosphatase-conjugated3,4,5,6.
Sipunculus nudus (Phylum Sipuncula; order Sipunculida: Sipunculidae) is an unsegmented, coelomate and bilaterally symmetrical marine worm7,8. Sipunculus nudus is a cosmopolitan species widely distributed in tropical and temperate coastal waters. It is also an important marine fishery resource in southern China because of its high nutritional and medicinal values9,10. However, Sipunculus nudus in molecular biology is still in its infancy. To fully understand the biological role of genes, the investigation of genes expression patterns at a cellular resolution is of great interest. In the non-model organism Sipunculus nudus, the ISH method, which is an ideal method to detect the genes expression patterns, has not yet been established. Its coelomic fluid contains several cell types, including granulocytes, urn cells, vesicular cells, germ cells, erythrocytes, etc11. The double sex/mab-3 related transcription factor-1 (dmrt1), used as a representative gene in this method, is a highly conserved transcriptional regulator of sex determination and differentiation in most species ranging from invertebrates to mammals12,13. In a range of species (i.e., black porgy, etc.)14, dmrt1 was expressed in the Sertoli cells, surrounding the germinal cells, whose function is similar to trophoblast cells of Sipunculus nudus. Therefore, we hypothesized that dmrt1 of Sipunculus nudus is expressed in trophoblast cells of spermatozeugmata, and the result of the ISH method clearly confirmed the hypothesis.
This protocol for the first time describes ISH, with digoxigenin-labeled antisense/sense mRNA probes, to determine mRNA expression patterns in its coelomic fluid smear. The optimal reaction conditions are supplied, which allow very sensitive visualization of mRNA expression at high resolution. The developed ISH method could be potentially applied in more Sipunculida species other than Sipunculus nudus.

<table><tbody><tr><td>Agarose</td><td>Biowest</td><td>111860</td><td></td></tr><tr><td>Anti-digoxigenin-AP Fab fragments</td><td>Roche</td><td>11093274910</td><td></td></tr><tr><td>BCIP/NBT alkaline phosphatase color development kit</td><td>Beyotime</td><td>C3206</td><td></td></tr><tr><td>Bovine Serum Albumin</td><td>Sigma</td><td>B2064</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5415R</td><td></td></tr><tr><td>Citric acid</td><td>Sinopharm Chemical Reagent Co.</td><td>5949-29-1</td><td></td></tr><tr><td>Citric acid trisodium</td><td>Sinopharm Chemical Reagent Co.</td><td>4/3/6132</td><td></td></tr><tr><td>Coverslips</td><td>Beyotime</td><td>FCGF60</td><td></td></tr><tr><td>Deionized formamide</td><td>Amresco</td><td>12/7/1975</td><td></td></tr><tr><td>Diethyl pyrocarbonate, DEPC</td><td>Sigma</td><td>D5758</td><td>Noxious substance</td></tr><tr><td>Digoxigenin (DIG) RNA Labeling Mix</td><td>Roche</td><td>11277073910</td><td></td></tr><tr><td>DNase I, RNase-free</td><td>Invitrogen</td><td>18047019</td><td></td></tr><tr><td>EDTA</td><td>Sigma</td><td>431788</td><td></td></tr><tr><td>Electrophoresis gel imaging</td><td>Bio-Rad</td><td>Universal Hood III</td><td></td></tr><tr><td>Ethanol</td><td>Sinopharm Chemical Reagent Co.</td><td>64-17-5</td><td></td></tr><tr><td>Gel extraction kits</td><td>Omega</td><td>D2500</td><td></td></tr><tr><td>Gel-electrophoresis apparatus</td><td>Beijing Liuyi Instrument Factory</td><td>DYY-6C</td><td></td></tr><tr><td>Glycerol</td><td>Sinopharm Chemical Reagent Co.</td><td>56-81-5</td><td></td></tr><tr><td>Glycine</td><td>Sigma</td><td>G5417</td><td></td></tr><tr><td>Heparin</td><td>Sigma</td><td>8/1/9041</td><td></td></tr><tr><td>KCl</td><td>Sinopharm Chemical Reagent Co.</td><td>7447-40-7</td><td></td></tr><tr><td>KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sinopharm Chemical Reagent Co.</td><td>7778-77-0</td><td></td></tr><tr><td>LiCl</td><td>Sigma</td><td>203637</td><td></td></tr><tr><td>Maleic acid</td><td>Sinopharm Chemical Reagent Co.</td><td>110-16-7</td><td></td></tr><tr><td>Methanol</td><td>Sinopharm Chemical Reagent Co.</td><td>67-56-1</td><td>Noxious substance</td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sinopharm Chemical Reagent Co.</td><td>7786-30-3</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sinopharm Chemical Reagent Co.</td><td>7558-79-4</td><td></td></tr><tr><td>NaCl</td><td>Biofount</td><td>JT0001</td><td></td></tr><tr><td>NaOH</td><td>Sinopharm Chemical Reagent Co.</td><td>1310-73-2</td><td>Corrosive</td></tr><tr><td>Paraffin film</td><td>Bemis Company, Inc.</td><td>PM-996</td><td></td></tr><tr><td>Paraformaldehyde, PFA</td><td>Sigma</td><td>158127</td><td>Noxious substance</td></tr><tr><td>PCR Instrument</td><td>Life Technology</td><td>Proflex</td><td></td></tr><tr><td>Pins</td><td>Deli</td><td>16</td><td></td></tr><tr><td>Pipette</td><td>Eppendorf</td><td>plus G</td><td></td></tr><tr><td>Poly-D-lysine treated microscope slides</td><td>Liusheng</td><td>VER_A01</td><td></td></tr><tr><td>Proteinase K</td><td>Sigma</td><td>SRE0005</td><td></td></tr><tr><td>RNase free water</td><td>HyClone</td><td>SH30538. 02</td><td></td></tr><tr><td>RNase inhibitor</td><td>Roche</td><td>3335399001</td><td></td></tr><tr><td>S. nudus</td><td></td><td></td><td></td></tr><tr><td>Sheep serum</td><td>Beyotime</td><td>C0265</td><td></td></tr><tr><td>Slide staining jar</td><td>Beyotime</td><td>FG010</td><td></td></tr><tr><td>Slide storage box</td><td>Beyotime</td><td>FBX011</td><td></td></tr><tr><td>Small autoclaved scissors</td><td>Shuanglu</td><td>sku_8330</td><td></td></tr><tr><td>Spectrophotometers</td><td>Thermo Fisher</td><td>NanoDrop 2000/2000c</td><td></td></tr><tr><td>T7 RNA polymerases</td><td>Roche</td><td>10881767001</td><td></td></tr><tr><td>Taq DNA polymerase mix (2X)</td><td>Thermo Scientific</td><td>K1081</td><td></td></tr><tr><td>Tris HCl</td><td>Sigma</td><td>RES3098T</td><td></td></tr><tr><td>tRNA</td><td>Roche</td><td>10109517001</td><td></td></tr><tr><td>Tween-20</td><td>Sigma</td><td>P1379</td><td></td></tr><tr><td>Water bath</td><td>Zhengzhou Great Wall Scientific Industrial</td><td>HH-S2</td><td></td></tr></tbody></table>

in situ hybridization for sipunculus nudus coelomic fluid

In situ hybridization (ISH) is a very informative technique to present cellular distribution patterns of specific genes (e.g., mRNA and ncRNA) in tissues. The sipunculid worm Sipunculus nudus is a crucial fishery resource as it has high nutritional and medicinal values. Currently, the research on the molecular biology of Sipunculus nudus is still in its infancy. The purpose of this article is to develop a sensitive method for localizing specific mRNA in Sipunculus nudus coelomic fluid. The protocol includes detailed steps of ISH, including digoxigenin-labeled antisense and sense riboprobe preparation, coelomic fluid collection and section preparation, specific riboprobe hybridization, antibody incubation, coloration and post-coloration treatments. The representative results obtained from a successful experiment using this method are demonstrated. The protocol should be applicable to other Sipuncula species as well.

A summary of the steps involved in ISH is illustrated in Figure 1. Antisense and corresponding sense riboprobes for dmrt1 were synthesized from PCR products amplified from the coelomic fluid cDNAs. The authenticity of the PCR products was verified by direct sequencing. Riboprobes were synthesized using T7 RNA polymerases according to the manufacturer&#39;s protocols and a previous report4 with some minor modifications. The representative signals of ISH are shown in Figure 2. ISH of Sipunculus nudus coelomic fluid with antisense riboprobe that targets dmrt1 reveals purple staining concentrated in trophoblast cells of the spermatozeugmata (Figure 2A, B, red arrows). A sense riboprobe was used as a negative control, and the sense riboprobe for dmrt1 did not detect any hybridization signal (Figure 2C).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61022/61022fig1.jpg" /> 
Figure 1. Flow diagram of ISH. Blue boxes are the steps for synthesizing riboprobe. Light green boxes are steps for in situ procedures. <a href="https://www.jove.com/files/ftp_upload/61022/61022fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61022/61022fig2.jpg" /> 
Figure 2. The expression of dmrt1 in Sipunculus nudus coelomic fluid detected by ISH. (A, B) Hybridization with dmrt1 antisense riboprobe. (C) Hybridization with dmrt1 sense riboprobe. The red arrows represent hybridization signals in trophoblast cells. sz, spermatozeugmata. Scale bar: 50 &#181;m. This figure has been modified from Li et al.15. <a href="https://www.jove.com/files/ftp_upload/61022/61022fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Sequence (5&#8242;-3&#8242;)</td>
		</tr>
		<tr>
			<td>Anti-Probe F</td>
			<td>ACAATGTAGCAGGGTTTAATCTTGG</td>
		</tr>
		<tr>
			<td>Anti-Probe R</td>
			<td>TAATACGACTCACTATAGGGAGACTGTTTTCTCTATGCATCCAGTAA</td>
		</tr>
		<tr>
			<td>Sense-Probe F</td>
			<td>TAATACGACTCACTATAGGGAGAACAATGTAGCAGGGTTTAATCTTGG</td>
		</tr>
		<tr>
			<td>Sense-Probe R</td>
			<td>CTGTTTTCTCTATGCATCCAGTAA</td>
		</tr>
	</tbody>
</table>
Table 1. The dmrt1 primer sequences.
<table border="1" fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>Composition</td>
		</tr>
		<tr>
			<td>5 &#215; TBE (1 L)</td>
			<td>54 g of Tris, 27.5 g of boric acid and 20 mL 0.5 M EDTA (pH 8.0).</td>
		</tr>
		<tr>
			<td>10 &#215; PBS (5 L)</td>
			<td>400 g of NaCl, 10 g of KCl, 72 g of Na2HPO4 and 12 g of KH2PO4.</td>
		</tr>
		<tr>
			<td>DEPC-PBS (1 L)</td>
			<td>1 L of 1 &#215; PBS and 1 mL DEPC.</td>
		</tr>
		<tr>
			<td>4% PFA in 1 &#215; PBS (100 mL, pH 7.4)</td>
			<td>4 g of PFA and 100 mL PBS.</td>
		</tr>
		<tr>
			<td>10 mg/mL proteinase K (1 mL)</td>
			<td>10 mg of proteinase K.</td>
		</tr>
		<tr>
			<td>20 &#215; SSC (1 L)</td>
			<td>175.3 g of NaCl and 88.2 g of citric acid trisodium salt.</td>
		</tr>
		<tr>
			<td>Wet box buffer (50 mL)</td>
			<td>2.5 mL of 20 &#215; SSC, 22.5 mL of RNase free water and 25 mL of deionized formamide.</td>
		</tr>
		<tr>
			<td>Hybridization mix (HM, 200 mL)</td>
			<td>100 mL of deionized formamide, 50 mL of 20 &#215; SSC, 10 mg of heparin, 100 mg of tRNA, 0.39 g of citric acid, 200 &#181;L of Tween-20 and RNase free water to 200 mL.</td>
		</tr>
		<tr>
			<td>Wash buffer (1 L)</td>
			<td>50 mL of 20 &#215; SSC, 500 mL of deionized formamide, 450 mL of sterile water and 1 mL Tween-20.</td>
		</tr>
		<tr>
			<td>MABT (1 L)</td>
			<td>11.6 g of maleic acid, 8.77 g of NaCl, 8.25 g of NaOH and 1 mL Tween-20.</td>
		</tr>
		<tr>
			<td>Blocking buffer</td>
			<td>1 &#215; MABT, 2% sheep serum (vol/vol) and 2 mg/mL BSA.</td>
		</tr>
		<tr>
			<td>Alkaline phosphatase buffer</td>
			<td>100 mM NaCl, 100 mM Tris HCl (pH 9.5), 50 mM MgCl2, and 0.1% Tween 20 (vol/vol).</td>
		</tr>
		<tr>
			<td>Stop solution</td>
			<td>0.1 M glycine, pH 2.2.</td>
		</tr>
	</tbody>
</table>
Table 2. The composition of solutions used in the ISH protocol.

Watch this Scientific Journal Video about In situ Hybridization for Sipunculus nudus Coelomic Fluid at JoVE.com

In situ Hybridization for Sipunculus nudus Coelomic Fluid

This protocol describes an effective in situ hybridization approach to detect the mRNA expression levels and spatial patterns of target genes in Sipunculus nudus coelomic fluid.

In situ Hybridization for Sipunculus nudus Coelomic Fluid

In situ hybridization (ISH) is a very informative technique to present cellular distribution patterns of specific genes (e.g., mRNA and ncRNA) in tissues. ...

in-situ-hybridization-for-sipunculus-nudus-coelomic-fluid

Nanyang Technological University

Research

JoVE Journal

Biology

5.3K Views.  Huaqiao University. This protocol describes an effective in situ hybridization approach to detect the mRNA expression levels and spatial patterns of target genes in Sipunculus nudus coelomic fluid.

Video: In situ Hybridization for Sipunculus nudus Coelomic Fluid

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development. The Xenopuslaevis embryo is very useful for studying organogenesis because their large size makes them very suitable for identifying organs at the earliest steps in organogenesis. At this time, the primary method used for identifying a specific organ or primordium is whole mount in situ hybridization with labeled antisense RNA probes specific to a gene that is expressed in the organ of interest. In addition, it is relatively easy to manipulate genes or signaling pathways in Xenopus and in situ hybridization allows one to then assay for changes in the presence or morphology of a target organ. Whole mount in situ hybridization is a multi-day protocol with many steps involved. Here we provide a simplified protocol with reduced numbers of steps and reagents used that works well for routine assays. In situ hybridization robots have greatly facilitated the process and we detail how and when we utilize that technology in the process. Once an in situ hybridization is complete, capturing the best image of the result can be frustrating. We provide advice on how to optimize imaging of in situ hybridization results. Although the protocol describes assessing organogenesis in Xenopus laevis, the same basic protocol can almost certainly be adapted to Xenopus tropicalis and other model systems.

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

The Xenopus laevis embryo continues to be exceptionally useful in the study of early development due to its large size and ease of manipulation. A simplified protocol for whole mount in situ hybridization protocol is provided that can be used in the identification of specific organs in this model system.

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development.  The Xenopuslaevis embryo ...

Developmental Biology

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these diseases, do not exist in isolation when they colonize the vector; rather, they likely engage in interactions with resident microorganisms in the gut lumen. The vector microbiota has been demonstrated to play an important role in pathogen transmission for several vector-borne diseases. Whether resident bacteria in the gut of the Ixodes scapularis tick, the vector of several human pathogens including Borrelia burgdorferi, influence tick transmission of pathogens is not determined. We require methods for characterizing the composition of the bacteria associated with the tick gut to facilitate a better understanding of potential interspecies interactions in the tick gut. Using whole-mount in situ hybridization to visualize RNA transcripts associated with particular bacterial species allows for the collection of qualitative data regarding the abundance and distribution of the microbiota in intact tissue. This technique can be used to examine changes in the gut microbiota milieu over the course of tick feeding and can also be applied to analyze expression of tick genes. Staining of whole tick guts yield information about the gross spatial distribution of target RNA in the tissue without the need for three-dimensional reconstruction and is less affected by environmental contamination, which often confounds the sequencing-based methods frequently used to study complex microbial communities. Overall, this technique is a valuable tool that can be used to better understand vector-pathogen-microbiota interactions and their role in disease transmission.

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Here, we present a protocol to spatially and temporally assess the presence of viable microbiota in tick guts using a modified whole-mount in situ hybridization approach.

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these ...

Genetics

In Situ Hybridization Techniques for Paraffin-Embedded Adult Coral Samples

Corals are important ocean invertebrates that are critical for overall ocean health as well as human health. However, due to human impacts such as rising ocean temperatures and ocean acidification, corals are increasingly under threat. To tackle these challenges, advances in cell and molecular biology have proven to be crucial for diagnosing the health of corals. Modifying some of the techniques commonly used in human medicine could greatly improve researchers&#39; ability to treat and save corals. To address this, a protocol for in situ hybridization used primarily in human medicine and evolutionary developmental biology has been adapted for use in adult corals under stress.
The purpose of this method is to visualize the spatial expression of an RNA probe in adult coral tissue that has been embedded in paraffin and sectioned onto glass slides. This method focuses on removal of the paraffin and rehydration of the sample, pretreatment of the sample to ensure permeability of the sample, pre-hybridization incubation, hybridization of the RNA probe, and visualization of the RNA probe. This is a powerful method when using non-model organisms to discover where specific genes are expressed, and the protocol can be easily adapted for other non-model organisms. However, the method is limited in that it is primarily qualitative, because expression intensity can vary depending on the amount of time used during the visualization step and the concentration of the probe. Furthermore, patience is required, as this protocol can take up to 5 days (and in many cases, longer) depending on the probe being used. Finally, non-specific background staining is common, but this limitation can be overcome.

In Situ Hybridization Techniques for Paraffin-Embedded Adult Coral Samples

The goal of this protocol is to perform in situ hybridization on adult coral samples that have been embedded in paraffin and sectioned onto glass slides. This is a qualitative method used to visualize the spatial expression of an RNA anti-sense probe in paraffin-embedded tissues.

Corals are important ocean invertebrates that are critical for overall ocean health as well as human health. However, due to human impacts such as rising ...

Environment

Wholemount In Situ Hybridization for Astyanax Embryos

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of genes. Prior research into this emerging model system capitalized on comprehensive genome-wide investigations that have identified numerous quantitative trait loci (QTL) associated with various cave-associated phenotypes. However, the ability to connect genes of interest to the heritable basis for phenotypic change remains a significant challenge. One technique that can facilitate deeper understanding of the role of development in troglomorphic evolution is whole-mount in situ hybridization. This technique can be implemented to directly compare gene expression between cave- and surface-dwelling forms, nominate candidate genes underlying established QTL, identify genes of interest from next-generation sequencing studies, or develop other discovery-based approaches. In this report, we present a simple protocol, supported by a flexible checklist, that can be widely adapted for use well beyond the presented study system. It is hoped that this protocol can serve as a broad resource for the Astyanax community and beyond.

Wholemount In Situ Hybridization for Astyanax Embryos

This protocol enables visualization of gene expression in embryonic Astyanax cavefish. This approach has been developed with the goal of maximizing gene expression signal, while minimizing non-specific background staining.

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of ...

In Situ Hybridization in Zebrafish Larvae and Juveniles during Mesonephros Development

The zebrafish forms two kidney structures in its lifetime. The pronephros (embryonic kidney) forms during embryonic development and begins to function at 2 days post fertilization. Consisting of only two nephrons, the pronephros serves as the sole kidney during larval life until more renal function is required due to the increasing body mass. To cope with this higher demand, the mesonephros (adult kidney) begins to form during metamorphosis. The new primary nephrons fuse to the pronephros and form connected lumens. Then, secondary nephrons fuse to primary ones (and so on) to create a branching network in the mesonephros. The vast majority of research is focused on the pronephros due to the ease of using embryos. Thus, there is a need to develop techniques to study older and larger larvae and juvenile fish to better understand mesonephros development. Here, an in situ hybridization protocol for gene expression analysis is optimized for probe penetration, washing of probes and antibodies, and bleaching of pigments to better visualize the mesonephros. The Tg(lhx1a-EGFP) transgenic line is used to label progenitor cells and the distal tubules of nascent nephrons. This protocol fills a gap in mesonephros research. It is a crucial model for understanding how new kidney tissues form and integrate with existing nephrons and provide insights into regenerative therapies.

In Situ Hybridization in Zebrafish Larvae and Juveniles during Mesonephros Development

The zebrafish is an important model for understanding kidney development. Here, an in situ hybridization protocol is optimized to detect gene expression in zebrafish larvae and juveniles during mesonephros development.

The zebrafish forms two kidney structures in its lifetime. The pronephros (embryonic kidney) forms during embryonic development and begins to function at ...

A High Throughput in situ Hybridization Method to Characterize mRNA Expression Patterns in the Fetal Mouse Lower Urogenital Tract

Development of the lower urogenital tract (LUT) is an intricate process. This complexity is evidenced during formation of the prostate from the fetal male urethra, which relies on androgenic signals and epithelial-mesenchymal interactions1,2. Understanding the molecular mechanisms responsible for prostate development may reveal growth mechanisms that are inappropriately reawakened later in life to give rise to prostate diseases such as benign prostatic hyperplasia and prostate cancer.
The developing LUT is anatomically complex. By the time prostatic budding begins on 16.5 days post conception (dpc), numerous cell types are present. Vasculature, nerves and smooth muscle reside within the mesenchymal stroma3. This stroma surrounds a multilayered epithelium and gives rise to the fetal prostate through androgen receptor-dependent paracrine signals4. The identity of the stromal androgen receptor-responsive genes required for prostate development and the mechanism by which prostate ductal epithelium forms in response to these genes is not fully understood. The ability to precisely identify cell types and localize expression of specific factors within them is imperative to further understand prostate development. In situ hybridization (ISH) allows for localization of mRNAs within a tissue. Thus, this method can be used to identify pattern and timing of expression of signaling molecules and their receptors, thereby elucidating potential prostate developmental regulators.
Here, we describe a high throughput ISH technique to identify mRNA expression patterns in the fetal mouse LUT using vibrating microtome-cut sections. This method offers several advantages over other ISH protocols. Performing ISH on thin sections adhered to a slide is technically difficult; cryosections frequently have poor structural quality while both cryosections and paraffin sections often result in weak signal resolution. Performing ISH on whole mount tissues can result in probe trapping. In contrast, our high throughput technique utilizes thick-cut sections that reveal detailed tissue architecture. Modified microfuge tubes allow easy handling of sections during the ISH procedure. A maximum of 4 mRNA transcripts can be screened from a single 17.5dpc LUT with up to 24 mRNA transcripts detected in a single run, thereby reducing cost and maximizing efficiency. This method allows multiple treatment groups to be processed identically and as a single unit, thereby removing any bias for interpreting data. Most pertinently for prostate researchers, this method provides a spatial and temporal location of low and high abundance mRNA transcripts in the fetal mouse urethra that gives rise to the prostate ductal network.

A High Throughput in situ Hybridization Method to Characterize mRNA Expression Patterns in the Fetal Mouse Lower Urogenital Tract

Here, we describe an efficient high throughput in situ hybridization (ISH) method for visualizing patterns of mRNA expression in developing fetal mouse prostate tissue sections. The method can be easily adapted to visualize mRNA expression patterns in other mouse tissues or in tissues from other species.

Development of the lower urogenital tract (LUT) is an intricate process. This complexity is evidenced during formation of the prostate from the fetal male ...

RNA In situ Hybridization in Whole Mount Embryos and Cell Histology Adapted for Marine Elasmobranchs

Marine elasmobranchs are valued animal models for biomedical and genomic studies as they are the most primitive vertebrates to have adaptive immunity and have unique mechanisms for osmoregulation 1-3. As the most primitive living jawed-vertebrates with paired appendages, elasmobranchs are an evolutionarily important model, especially for studies in evolution and development. Marine elasmobranchs have also been used to study aquatic toxicology and stress physiology in relationship to climate change 4. Thus, development and adaptation of methodologies is needed to facilitate and expand the use of these primitive vertebrates to multiple biological disciplines. Here I present the successful adaptation of RNA whole mount in situ hybridization and histological techniques to study gene expression and cell histology in elasmobranchs.
Monitoring gene expression is a hallmark tool of developmental biologists, and is widely used to investigate developmental processes 5. RNA whole mount in situ hybridization allows for the visualization and localization of specific gene transcripts in tissues of the developing embryo. The expression pattern of a gene's message can provide insight into what developmental processes and cell fate decisions a gene may control. By comparing the expression pattern of a gene at different developmental stages, insight can be gained into how the role of a gene changes during development.
While whole mount in situ's provides a means to localize gene expression to tissue, histological techniques allow for the identification of differentiated cell types and tissues. Histological stains have varied functions. General stains are used to highlight cell morphology, for example hematoxylin and eosin for general staining of nuclei and cytoplasm, respectively. Other stains can highlight specific cell types. For example, the alcian blue stain reported in this paper is a widely used cationic stain to identify mucosaccharides. Staining of the digestive tract with alcian blue can identify the distribution of goblet cells that produce mucosaccharides. Variations in mucosaccharide constituents on short peptides distinguish goblet cells by function within the digestive tract 6. By using RNA whole mount in situ's and histochemical methods concurrently, cell fate decisions can be linked to gene-specific expression.
Although RNA in situ's and histochemistry are widely used by researchers, their adaptation and use in marine elasmobranchs have met limited and varied success. Here I present protocols developed for elasmobranchs and used on a regular basis in my laboratory. Although further modification of the RNA in situ's hybridization method may be needed to adapt to different species, the protocols described here provide a strong starting point for researchers wanting to adapt the use of marine elasmobranchs to their scientific inquiries.

RNA In situ Hybridization in Whole Mount Embryos and Cell Histology Adapted for Marine Elasmobranchs

By combining methods for RNA whole mount in situ hybridization and histology, gene expression can be linked with cell fate decisions in the developing embryo. These methods have been adapted to marine elasmobranchs and facilitate the use of these animals as model organisms for biomedical, toxicology and comparative studies.

Marine  elasmobranchs are valued animal models for biomedical and genomic studies as  they are the most primitive vertebrates to have adaptive immunity ...

High Resolution Whole Mount In Situ Hybridization within Zebrafish Embryos to Study Gene Expression and Function

This article focuses on whole-mount in situ hybridization (WISH) of zebrafish embryos. The WISH technology facilitates the assessment of gene expression both in terms of tissue distribution and developmental stage. Protocols are described for the use of WISH of zebrafish embryos using antisense RNA probes labeled with digoxigenin. Probes are generated by incorporating digoxigenin-linked nucleotides through in vitro transcription of gene templates that have been cloned and linearized. The chorions of embryos harvested at defined developmental stages are removed before incubation with specific probes. Following a washing procedure to remove excess probe, embryos are incubated with anti-digoxigenin antibody conjugated with alkaline phosphatase. By employing a chromogenic substrate for alkaline phosphatase, specific gene expression can be assessed. Depending on the level of gene expression the entire procedure can be completed within 2-3 days.

High Resolution Whole Mount In Situ Hybridization within Zebrafish Embryos to Study Gene Expression and Function

The zebrafish, a small tropical fish, has become a popular model for studying gene function during vertebrate development and disease. The temporal and spatial expression of target genes can be determined by in situ hybridization. Our improved protocol allows for the detection of low abundant transcripts with low non-specific background signal.

This article focuses on whole-mount in situ hybridization (WISH) of zebrafish embryos. The WISH technology facilitates the assessment of gene expression ...

RNA Fluorescence in situ Hybridization (FISH) to Visualize Microbial Colonization and Infection in Caenorhabditis elegans Intestines

The intestines of wild Caenorhabditis nematodes are inhabited by a variety of microorganisms, including gut microbiome bacteria and pathogens, such as microsporidia and viruses. Because of the similarities between Caenorhabditis elegans and mammalian intestinal cells, as well as the power of the C. elegans system, this host has emerged as a model system to study host intestine-microbe interactions in vivo. While it is possible to observe some aspects of these interactions with bright-field microscopy, it is difficult to accurately classify microbes and characterize the extent of colonization or infection without more precise tools. RNA fluorescence in situ hybridization (FISH) can be used as a tool to identify and visualize microbes in nematodes from the wild or to experimentally characterize and quantify infection in nematodes infected with microbes in the lab. FISH probes, labeling the highly abundant small subunit ribosomal RNA, produce a bright signal for bacteria and microsporidian cells. Probes designed to target conserved regions of ribosomal RNA common to many species can detect a broad range of microbes, whereas targeting divergent regions of the ribosomal RNA is useful for narrower detection. Similarly, probes can be designed to label viral RNA. A protocol for RNA FISH staining with either paraformaldehyde (PFA) or acetone fixation is presented. PFA fixation is ideal for nematodes associated with bacteria, microsporidia, and viruses, whereas acetone fixation is necessary for the visualization of microsporida spores. Animals were first washed and fixed in paraformaldehyde or acetone. After fixation, FISH probes were incubated with samples to allow for the hybridization of probes to the desired target. The animals were again washed and then examined on microscope slides or using automated approaches. Overall, this FISH protocol enables detection, identification, and quantification of the microbes that inhabit the C. elegans intestine, including microbes for which there are no genetic tools available.

RNA Fluorescence in situ Hybridization FISH to Visualize Microbial Colonization and Infection in Caenorhabditis elegans Intestines

Intestinal microbes, including extracellular bacteria and intracellular pathogens like the Orsay virus and microsporidia (fungi), are often associated with wild Caenorhabditis nematodes. This article presents a protocol for detecting and quantifying microbes that colonize and/or infect C. elegans nematodes, and for measuring pathogen load after controlled infections in the lab.

The intestines of wild Caenorhabditis nematodes are inhabited by a variety of microorganisms, including gut microbiome bacteria and pathogens, such as ...

Immunology and Infection

A Strategy for the Study of IL-9-Producing Lymphoid Cells in the Nippostrongylus brasiliensis Infection Model

IL-9 is a pleiotropic cytokine associated with various processes, including antitumor immunity, induction of allergic pathologies, and the immune response against helminth infections, where it plays an important role in the expulsion of the parasite. In a murine model of Nippostrongylus brasiliensis infection, IL-9 is produced mainly by CD4+ T lymphocytes and innate lymphoid cells found in the lung, small intestine, and draining lymph nodes. Given the technical difficulties involved in the intracellular staining of IL-9, as well as the complexity of isolating hematopoietic cells from the small intestine upon infection, there is a pressing need for a comprehensive but straightforward protocol to analyze the expression of IL-9 in different lymphoid and non-lymphoid tissues in this model. The protocol described here outlines the kinetics of IL-9 produced by CD4+ T cells and innate lymphoid cells in the lung and small intestine, the main organs targeted by N. brasiliensis, as well as in the mediastinal and mesenteric lymph nodes, throughout the infection. In addition, it details the number of larvae needed for infection, depending on the cell type and organ of interest. This protocol aims to assist in the standardization of assays to save time and resources by offering the opportunity to focus on the specific cells, organs, and disease stages of interest in the N. brasiliensis infection model.

A Strategy for the Study of IL-9-Producing Lymphoid Cells in the Nippostrongylus brasiliensis Infection Model

IL-9-expressing T and ILC2 cells are induced during N. brasiliensis infection, yet their characterization has been largely overlooked in the infected intestine due to their low frequency and differential kinetics. This protocol describes the isolation of these cells from different target organs and confirmation of their identity via flow cytometry at different infection stages.

IL-9 is a pleiotropic cytokine associated with various processes, including antitumor immunity, induction of allergic pathologies, and the immune response ...

In situ Hybridization for Sipunculus nudus Coelomic Fluid

Summary

Explore More Videos

Chapters in this video

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

In Situ Hybridization Techniques for Paraffin-Embedded Adult Coral Samples

Wholemount In Situ Hybridization for Astyanax Embryos

In Situ Hybridization in Zebrafish Larvae and Juveniles during Mesonephros Development

A High Throughput in situ Hybridization Method to Characterize mRNA Expression Patterns in the Fetal Mouse Lower Urogenital Tract

RNA In situ Hybridization in Whole Mount Embryos and Cell Histology Adapted for Marine Elasmobranchs

High Resolution Whole Mount In Situ Hybridization within Zebrafish Embryos to Study Gene Expression and Function

RNA Fluorescence in situ Hybridization (FISH) to Visualize Microbial Colonization and Infection in Caenorhabditis elegans Intestines

A Strategy for the Study of IL-9-Producing Lymphoid Cells in the Nippostrongylus brasiliensis Infection Model