We thank Dr. Xin-Ru Wang from the University of Minnesota for insightful suggestions and guidance. This work was supported by a grant from the National Natural Science Foundation of China (No.81760374).

1. Materials and reagents
<ol>
	<li>Use pyrogen-free solutions and media for cell culture (see the Table of Materials).</li>
	<li>Use ultrapure water to prepare all solutions.</li>
	<li>Be careful in selecting fetal bovine serum (FBS) for cell culture, following a lot-check process. 
	NOTE: As FBS lots are subject to regular change, it is impossible to state the relevant catalog and lot numbers in this protocol.</li>
	<li>Select Aa23 cell strains derived from A. albopictus eggs, corresponding to Wolbachia-free Aa23-T.</li>
</ol>
2. Cell culture
<ol>
	<li>Prepare 25 cm2 cell culture flasks with 4 mL of Schneider&#39;s medium with 10% FBS.</li>
	<li>Incubate the flasks at 28 &#176;C under a 5% CO2 atmosphere for 5 to 7 days7,24.</li>
	<li>Observe unstained Aa23 and Aa23-T cells in the flasks using light microscopy at 100x magnification (Figure 1).</li>
</ol>
3. DNA extraction
<ol>
	<li>Culture the cells for 5-7 days until 70-80% confluence per flask (step 2). Harvest the cells with manual pipetting from 1 mL of resuspended culture medium by centrifugation for 5 min at 100 &#215; g in a microcentrifuge.</li>
	<li>Remove the supernatant by aspiration and store the resulting cell pellet at -20 &#176;C.</li>
	<li>Resuspend the pellets in 0.40 mL of phosphate-buffered saline (PBS), place 50 &#181;L of the solution in a microcentrifuge tube, add 5 &#181;L of proteinase K (20 mg/mL), and incubate at 55 &#176;C for 1 h. Finally, heat these tubes at 99 &#176;C for 15 min to obtain the crude DNA and store it at -20 &#176;C.</li>
</ol>
4. Detection of Wolbachia nucleic acid
<ol>
	<li>PCR analysis
	<ol>
		<li>Perform PCR in a total reaction volume of 20 &#181;L, containing 8 &#181;L of ddH2O, 10 &#181;L of Taq polymerase (see the Table of Materials), 1 &#181;L of DNA template (from step 3), 0.5 &#181;L of forward and reverse primers (10 &#181;M): wsp81F (5&#39; TGG TCC AAT AAG TGATGA AGAAAC 3&#39;) and wsp691R (5&#39; AAA AAT TAA ACG CTA CTC CA 3&#39;)25, respectively.</li>
		<li>Use the following PCR conditions: initial denaturation at 95 &#176;C for 5 min, followed by 35 cycles of denaturation at 94 &#176;C, annealing at 55 &#176;C, and extension at 72 &#176;C; then, a final extension at 72 &#176;C for 7 min.</li>
		<li>Detect the DNA on a 1% agarose gel (1% w/v agarose in PBS) using a gel imager.</li>
	</ol>
	</li>
	<li>qPCR analysis
	<ol>
		<li>Analyze the Wolbachia genome copy for three biological replicates (n = 6) from the extracted DNA (step 3) using wsp primers 183 F (5&#39; AAGGAACCGAAGTTCATG 3&#39;) and QBrev R (5&#39; AGTTGAGAGTAAAGTCCC 3&#39;)22, normalized with ribosomal protein S6 (RPS6) forward and reverse primers (5&#39; GAAGTTGAACGTATCGTTTC 3&#39; and 5&#39; GAGATGGTCAGCGGTGATTT 3&#39;, respectively)3.</li>
		<li>Generate a standard curve for wAlbB and RPS6.
		<ol>
			<li>Extract DNA from PMD-18T (a special vector for efficient cloning of PCR products (TA cloning)) recombinant plasmid containing wsp and rps6 gene fragments (Supplemental File) and measure the plasmid DNA concentration (see the Table of Materials).</li>
			<li>Convert the plasmid DNA concentration to copy number concentration using Eq (1). 
			Plasmid copy number = <img alt="Equation 1" src="/files/ftp_upload/63662/63662eq01v3.jpg" /> (1)</li>
			<li>Dilute the plasmid copy number from 101 to 108 with ultrapure water, and set 3 replicates for each concentration gradient.</li>
			<li>Perform qPCR amplification using TB Green and a real-time PCR system (see the Table of Materials), and record the results of each reaction. Use the Ct value to develop a standard curve. Analyze the DNA in a total reaction volume of 20 &#181;L, comprising 7 &#181;L of ddH2O, 10.4 &#181;L of TB Green (see the Table of Materials), 1 &#181;L of DNA template (provided by Step 3), and 0.8 &#181;L of forward and reverse primers (10 &#181;M). Use the following reaction conditions: initial denaturation at 95 &#176;C for 5 min, followed by 40 cycles of denaturation at 95 &#176;C for 10 s, and annealing at 60 &#176;C for 35 s.</li>
			<li>Calculate the WSP and&#8203; RPS6 gene copy numbers in the cells according to the established standard curve and the Wolbachia relative density by the copy number of wsp/RPS6. Analyze the data using an independent samples t-test.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Western blot analysis of Wolbachia protein
	<ol>
		<li>Protein extraction
		<ol>
			<li>Collect 2 &#215; 107 Aa23 and Aa23-T cells from the six-well plate (from step 2) in a microcentrifuge tube, wash them three times with PBS, and centrifuge them at 100 &#215; g for 5 min at 4 &#176;C.</li>
			<li>Prepare 1 mL lysates with RIPA lysis buffer (50 mM Tris (pH 7.4), 150 mM NaCl, 1%Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS], 2 mM sodium pyrophosphate, 25 mM &#946;-glycerophosphate, 1 mM EDTA, 1 mM Na3VO4, 0.5 &#181;g/mL leupeptin) and PMSF (final concentration 1 mM).</li>
			<li>Add 200 &#181;L of lysis buffer to the cell pellet and maintain for 30 min on ice. Centrifuge the lysates at 12,000 &#215; g for 10 min at 4 &#176;C and remove the supernatant.</li>
		</ol>
		</li>
		<li>Assay the wsp concentration of the supernatant using a bicinchoninic acid (BCA) protein assay kit (see the Table of Materials) following the manufacturer&#39;s instructions.</li>
		<li>Load equal amounts of protein on a 15% SDS-PAGE gel [10% distilled water; 50% (30% Acr-Bis (29:1), 38% 1 M Tris, pH 8.8; 1% (10% SDS), 1% (10% ammonium persulfate), 0.04% TEMED].</li>
		<li>Transfer the protein to nitrocellulose membranes, block the membranes with 5% skimmed milk for 2 h26,27 at room temperature, and then wash the membranes three times with TBST (1 mL of Tween 20 in 1 L of TBS) (see the Table of Materials).</li>
		<li>Incubate the membranes overnight at 4 &#176;C with 100 &#181;L of anti-wsp polyclonal antibody (prepared in-house, see Supplemental File)), prepared by diluting the primary antibody with 5% skimmed milk (1:12,000).</li>
		<li>Wash the primary antibody three times with TBST.</li>
		<li>Incubate the membranes in 100 &#181;L of horseradish peroxidase (HRP)-conjugated secondary antibody on a shaker for 1 h at room temperature.</li>
		<li>Wash the membranes three times with TBST, and mix 20 &#181;L of solution A (HRP Substrate Luminol Reagent) and 20 &#181;L of solution B (HRP Substrate Peroxide Reagent) in the chemiluminescence detection kit at a ratio of 1:1. Immerse the entire membrane into the luminescence solution at the same time, and observe the signals using a multifunctional imaging system.</li>
	</ol>
	</li>
	<li>Immunofluorescence localization of Wolbachia protein
	<ol>
		<li>Incubate 5 &#215; 105 Aa23 and Aa23-T cells at 28 &#176;C on a Laser confocal Petri dish with a thickness of 0.17 mm at the bottom, under a 5% CO2 atmosphere for 3 to 4 days7,24. Wait until the cell is 60%-70% confluence and wash the cells three times with PBS.</li>
		<li>Fix the cells for 20 min at 4 &#176;C in 1 mL of 4% (w/v) paraformaldehyde in PBS.</li>
		<li>Wash the fixed cells using PBST (0.2% v/v Triton X-100 in PBS) for 5 min and wash the cells again twice with PBS.</li>
		<li>Incubate the slides for 1 h at 37 &#176;C in 1 mL of 3% (w/v) bovine serum albumin in PBS.</li>
		<li>Incubate the slides overnight in 100 &#181;L of mouse anti-wsp polyclonal antibody (prepared in-house) and mouse serum (1:1,000 dilution in PBS) in a wet box (it can maintain humidity and prevent moisture from evaporating) at 4 &#176;C.</li>
		<li>Remove the slides from the wet box and return them to room temperature; wash them three times with PBS and remove the PBS. 
		NOTE: From step 4.4.7 onward, all operations must be protected from light.</li>
		<li>Incubate the slides with 100 &#181;L of an Alexa Fluor 488-conjugated goat anti-mouse antibody (1:2,000 dilution in PBS) at 37 &#176;C for 30 min.</li>
		<li>Incubate the sample slides with 50 &#181;L of 4&#39;,6-diamidino-2-phenylindole (DAPI diluted in PBS to 10 &#181;g/mL, binds strongly to DNA) at 37 &#176;C for 5 min and then wash them three times with PBS.</li>
		<li>Observe the immunostaining under a confocal microscope.
		<ol>
			<li>Turn on the power and the laser.</li>
			<li>Turn on the normal and mercury lamps of the microscope.</li>
			<li>Start the system and run the operation software. Put a drop of cedar oil on the sample slides, place the sample slides on the microscope stage, and move the stage to the appropriate position.</li>
			<li>Click the mercury lamp observation button in the software, open the mercury lamp shutter, and observe the sample under an inverted microscope to focus.</li>
			<li>Use the manual control panel to select green and blue fluorescence to take fluorescence photos under 100x magnification.</li>
			<li>Turn off the mercury lamp observation button and start acquiring images.</li>
			<li>To ensure good image quality, prescan by scan size (512 pixels x 512 pixels). Adjust the scan size to get clear images (1,024 pixels x 1,024 pixels).</li>
			<li>Carry out noise reduction if the background noise is too high.</li>
			<li>Stop scanning and save the images.</li>
			<li>Turn off the mercury lamp and lasers.</li>
			<li>Wipe the objective with 75% alcohol and lower the objective to the lowest position.</li>
			<li>Turn off the shutter and microscope power.</li>
			<li>After the instrument has cooled, cover it with the dust cover.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Wiwatanaratanabutr, I., Kittayapong, P. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+crowding+and+temperature+on+Wolbachia+infection+density+among+life+cycle+stages+of+Aedes+albopictus.">Effects of crowding and temperature on Wolbachia infection density among life cycle stages of Aedes albopictus.</a> Journal of Invertebrate Patholology. 102 (3), 220-224 (2009).</li><li>Sinkins, S. P., Braig, H. R., O'Neill, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+superinfections+and+the+expression+of+cytoplasmic+incompatibility.">Wolbachia superinfections and the expression of cytoplasmic incompatibility.</a> Proceedings of Biologial Sciences. 261 (1362), 325-330 (1995).</li><li>Dobson, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+infections+are+distributed+throughout+insect+somatic+and+germ+line+tissues.">Wolbachia infections are distributed throughout insect somatic and germ line tissues.</a> Insect Biochemistry and Molecular Biology. 29 (2), 153-160 (1999).</li><li>O'Neill, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+cultivation+of+Wolbachia+pipientis+in+an+Aedes+albopictus+cell+line.">In vitro cultivation of Wolbachia pipientis in an Aedes albopictus cell line.</a> Insect Molecular Biology. 6 (1), 33-39 (1997).</li><li>Sinha, A., Li, Z., Sun, L., Carlow, C. K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+genome+sequence+of+the+Wolbachia+wAlbB+endosymbiont+of+Aedes+albopictus.">Complete genome sequence of the Wolbachia wAlbB endosymbiont of Aedes albopictus.</a> Genome Biology and Evoution. 11 (3), 706-720 (2019).</li><li>Sinkins, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+and+cytoplasmic+incompatibility+in+mosquitoes.">Wolbachia and cytoplasmic incompatibility in mosquitoes.</a> Insect Biochemistry and Molecular Biology. 34 (7), 723-729 (2004).</li><li>Fallon, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytological+properties+of+an+Aedes+albopictus+mosquito+cell+line+infected+with+Wolbachia+strain+wAlbB.">Cytological properties of an Aedes albopictus mosquito cell line infected with Wolbachia strain wAlbB.</a> In Vitro Cellular Developmental Biology - Animals. 44 (5-6), 154-161 (2008).</li><li>Hilgenboecker, K., Hammerstein, P., Schlattmann, P., Telschow, A., Werren, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+many+species+are+infected+with+Wolbachia?-A+statistical+analysis+of+current+data.">How many species are infected with Wolbachia?-A statistical analysis of current data.</a> Microbiology Letters. 281 (2), 215-220 (2008).</li><li>Werren, J. H., Baldo, L., Clark, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia:+master+manipulators+of+invertebrate+biology.">Wolbachia: master manipulators of invertebrate biology.</a> National Review of Microbiology. 6 (10), 741-751 (2008).</li><li>Kittayapong, P., Baisley, K. J., Baimai, V., O'Neill, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+and+diversity+of+Wolbachia+infections+in+Southeast+Asian+mosquitoes+(Diptera:+Culicidae).">Distribution and diversity of Wolbachia infections in Southeast Asian mosquitoes (Diptera: Culicidae).</a> Journal of Medical Entomology. 37 (3), 340-345 (2000).</li><li>O'Neill, S. L., Hoffmann, A., Werren, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Influential passengers: inherited microorganisms and arthropod reproduction. , (1997).</li><li>McGraw, E. A., O'Neill, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beyond+insecticides:+new+thinking+on+an+ancient+problem.">Beyond insecticides: new thinking on an ancient problem.</a> National Review of Microbiology. 11 (3), 181-193 (2013).</li><li>Bourtzis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Harnessing+mosquito-Wolbachia+symbiosis+for+vector+and+disease+control.">Harnessing mosquito-Wolbachia symbiosis for vector and disease control.</a> Acta Tropica. 132, 150-163 (2014).</li><li>Turelli, M., Hoffmann, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+spread+of+an+inherited+incompatibility+factor+in+California+Drosophila.">Rapid spread of an inherited incompatibility factor in California Drosophila.</a> Nature. 353 (6343), 440-442 (1991).</li><li>Hoffmann, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+establishment+of+Wolbachia+in+Aedes+populations+to+suppress+dengue+transmission.">Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission.</a> Nature. 476 (7361), 454-457 (2011).</li><li>Walker, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+wMel+Wolbachia+strain+blocks+dengue+and+invades+caged+Aedes+aegypti+populations.">The wMel Wolbachia strain blocks dengue and invades caged Aedes aegypti populations.</a> Nature. 476 (7361), 450-453 (2011).</li><li>Hughes, G. L., Koga, R., Xue, P., Fukatsu, T., Rasgon, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+infections+are+virulent+and+inhibit+the+human+malaria+parasite+Plasmodium+falciparum+in+Anopheles+gambiae.">Wolbachia infections are virulent and inhibit the human malaria parasite Plasmodium falciparum in Anopheles gambiae.</a> PLoS Pathogens. 7 (5), 1002043 (2011).</li><li>Bian, G., Xu, Y., Lu, P., Xie, Y., Xi, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+endosymbiotic+bacterium+Wolbachia+induces+resistance+to+dengue+virus+in+Aedes+aegypti.">The endosymbiotic bacterium Wolbachia induces resistance to dengue virus in Aedes aegypti.</a> PLoS Pathogens. 6 (4), 1000833 (2010).</li><li>Moreira, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Wolbachia+symbiont+in+Aedes+aegypti+limits+infection+with+dengue,+Chikungunya,+and+Plasmodium.">A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium.</a> Cell. 139 (7), 1268-1278 (2009).</li><li>Caragata, E. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dietary+cholesterol+modulates+pathogen+blocking+by+Wolbachia.">Dietary cholesterol modulates pathogen blocking by Wolbachia.</a> PLoS Pathogens. 9 (6), 1003459 (2013).</li><li>Zhang, G., Hussain, M., O'Neill, S. L., Asgari, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+uses+a+host+microRNA+to+regulate+transcripts+of+a+methyltransferase,+contributing+to+dengue+virus+inhibition+in+Aedes+aegypti.">Wolbachia uses a host microRNA to regulate transcripts of a methyltransferase, contributing to dengue virus inhibition in Aedes aegypti.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (25), 10276-10281 (2013).</li><li>Tortosa, P., Courtiol, A., Moutailler, S., Failloux, A. B., Weill, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chikungunya-Wolbachia+interplay+in+Aedes+albopictus.">Chikungunya-Wolbachia interplay in Aedes albopictus.</a> Insect Molecular Biology. 16 (7), 677-684 (2008).</li><li>Lu, P., Bian, G., Pan, X., Xi, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+induces+density-dependent+inhibition+to+dengue+virus+in+mosquito+cells.">Wolbachia induces density-dependent inhibition to dengue virus in mosquito cells.</a> PLoS Neglected Tropical Diseases. 6 (7), 1754 (2012).</li><li>Ghosh, A., Jasperson, D., Cohnstaedt, L. W., Brelsfoard, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+of+Culicoides+sonorensis+biting+midge+cell+lines+with+Wolbachia+pipientis.">Transfection of Culicoides sonorensis biting midge cell lines with Wolbachia pipientis.</a> Parasite Vectors. 12 (1), 483 (2019).</li><li>Zhou, W., Rousset, F., O'Neill, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phylogeny+and+PCR-based+classification+of+Wolbachia+strains+using+wsp+gene+sequences.">Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences.</a> The Royal Society Publishing. Proceedings B. 265 (1395), 509-515 (1998).</li><li>Park, M. S., Takeda, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+of+PaAtg8+and+roles+of+autophagy+in+adaptation+to+starvation+with+respect+to+the+fat+body+and+midgut+of+the+Americana+cockroach,+Periplaneta+americana.">Cloning of PaAtg8 and roles of autophagy in adaptation to starvation with respect to the fat body and midgut of the Americana cockroach, Periplaneta americana.</a> Cell Tissue Research. 356 (2), 405-416 (2014).</li><li>Geng, S. C., Li, X. L., Fang, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Porcine+circovirus+3+capsid+protein+induces+autophagy+in+HEK293T+cells+by+inhibiting+phosphorylation+of+the+mammalian+target+of+rapamycin.">Porcine circovirus 3 capsid protein induces autophagy in HEK293T cells by inhibiting phosphorylation of the mammalian target of rapamycin.</a> Journal of Zhejiang University Science B. 21 (7), 560-570 (2020).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Scientific Reports. 7 (1), 2409 (2017).</li><li>Kosea, H., Karr, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organization+of+Wolbachia+pipientis+in+the+Drosophila+fertilized+egg+and+embryo+revealed+by+an+anti-Wolbachia+monoclonal+antibody.">Organization of Wolbachia pipientis in the Drosophila fertilized egg and embryo revealed by an anti-Wolbachia monoclonal antibody.</a> Mechanisms of Development. 51 (2-3), 275-288 (1995).</li><li>Ye, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+reduces+the+transmission+potential+of+dengue-infected+Aedes+aegypti.">Wolbachia reduces the transmission potential of dengue-infected Aedes aegypti.</a> PLoS Neglected Tropical Diseases. 9 (6), (2015).</li><li>Jensenius, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+immunofluorescence,+Western+blotting,+and+cross-adsorption+assays+for+diagnosis+of+African+tick+bite+fever.">Comparison of immunofluorescence, Western blotting, and cross-adsorption assays for diagnosis of African tick bite fever.</a> Clinical and Diagnostic Laboratory Immunology. 11 (4), 786-788 (2004).</li></ol>

The authors have no conflicts of interest to declare.

Detection of intracellular Wolbachia infection is essential for the study of Wolbachia-host interactions and the confirmation of successful transfection of cells with novel strains. In this protocol, four methods were used to successfully detect intracellular Wolbachia infection at the nucleic acid and protein levels. These four experimental methods corroborated and improved the detection accuracy of Wolbachia infection of cells. 
PCR was used to detect the ...

The Asian tiger mosquito Aedes albopictus (Skuse) (Diptera: Culicidae), which is a key vector of dengue virus (DENV) in Asia and other parts of the world1, is a natural host of two types of the intracellular bacteria, Wolbachia (wAlbA and wAlbB), which are distributed throughout the germ line and somatic tissue2,3. The Aa23 cell line derived from A. albopictus embryos&#160;consists of at least two morphological cell types, both of which support infection4 and may be cured of native Wolbachia infection using antibiotics (Aa23-T). Given that Aa23 retains only wAlbB, it is a useful model for the study of host-endosymbiont interactions4,5,6.
Wolbachia is maternally transmitted and infects an estimated 65% of insect species8,9 and 28% of mosquito species10. It infects a variety of tissues and forms an intimate symbiotic relationship with the host, usually inducing cytoplasmic incompatibility (CI)11 and population replacement by manipulating the host reproductive system12,13. These host responses have been observed in natural populations of Drosophila simulans14 and in A. aegypti in a laboratory cage and field trial15. An important nonreproductive manipulation elicited by Wolbachia is induced host resistance to a variety of pathogens, including DENV, Chikungunya virus (CHIKV), and West Nile virus (WNV)16,17, that may be mediated by an improved innate immune system of the symbiont18,19, competition between Wolbachia and viruses for essential host resources20, and manipulation of host viral defense pathways21.
This protocol has been developed for studying these underlying mechanisms of Wolbachia-induced host antiviral responses. It uses four methods of detection of intracellular Wolbachia infection of Aa23 cells. These methods provide a strong theoretical basis for studies of intracellular Wolbachia infection of other host species. The first method, PCR-a powerful technique allowing the enzymatic amplification of specific regions of DNA without utilizing conventional cloning procedures-was used to detect Wolbachia DNA and determine the presence/absence of Wolbachia infection22. The second method measures Wolbachia DNA copy density using quantitative PCR (qPCR) for reliable detection and measurement of products generated during each PCR cycle that is directly proportionate to the amount of template before PCR23. The third method detects the presence of intracellular Wolbachia proteins, using western blot-one of the most powerful tools for detecting specific proteins in complex mixtures by combining the high separation power of electrophoresis, the specificity of antibodies, and the sensitivity of chromogenic enzymatic reactions. The final method is an immunofluorescence assay (IFA) that combines immunology, biochemistry, and microscopy to detect the Wolbachia surface protein (wsp) through an antigen-antibody reaction to confirm the cellular uptake of Wolbachia and determine its cellular localization.
This paper describes the four methods listed above to verify the existence of Wolbachia in the cells, which can be used to detect whether the exogenous Wolbachia was successfully transfected and the Wolbachia in the cell was cleared. After determining whether Wolbachia is present in the cells or not, a variety of different analyses can be performed, including genomics, proteomics, or metabolomics. This protocol demonstrates the detection of Wolbachia through Aa23 cells but can also be used in other cells.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Microscope</td>
			<td>Zeiss</td>
			<td></td>
			<td>SteREO Discovery V8</td>
		</tr>
		<tr>
			<td>Petri dish</td>
			<td>Fisher Scietific</td>
			<td>FB0875713</td>
			<td></td>
		</tr>
		<tr>
			<td>Pipette</td>
			<td>Pipetman</td>
			<td>F167380</td>
			<td>P10</td>
		</tr>
		<tr>
			<td>inSituX platform</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Analysis software</td>
			<td>In-house developed</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cerium doped yttrium aluminum garnet</td>
			<td>MSE Supplies</td>
			<td></td>
			<td>Ce:Y3Al5O12, YAG single crystal substrates</td>
		</tr>
		<tr>
			<td>Chip holder</td>
			<td>In-house developed</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Control software</td>
			<td>In-house developed</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Immersion oil</td>
			<td>Cargille Laboratories</td>
			<td>16482</td>
			<td>Type A low viscosity 150 cSt</td>
		</tr>
		<tr>
			<td>inSituX platform</td>
			<td>In-house developed</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>IR light source&#160;</td>
			<td>Thorlabs Incorporated</td>
			<td>LED1085L</td>
			<td>LED with a Glass Lens, 1085 nm, 5 mW, TO-18</td>
		</tr>
		<tr>
			<td>Outer ring&#160;</td>
			<td>In-house developed</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Pump lasers&#160;</td>
			<td>Thorlabs Incorporated</td>
			<td>LD785-SE400</td>
			<td>785 nm, 400 mW, &#216;9 mm, E Pin Code, Laser Diode</td>
		</tr>
		<tr>
			<td>Raspberry Pi</td>
			<td>Raspberry Pi Fundation</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Retaining ring</td>
			<td>Thorlabs Incorporated</td>
			<td>SM1RR</td>
			<td>SM1 retaining ring for &#216;1&#34; lens tubes and mounts</td>
		</tr>
		<tr>
			<td>Seedless quartz crystal</td>
			<td>University Wafers, Inc.</td>
			<td>U01-W2-L-190514</td>
			<td>25.4 mm diameter Z-cut 0.05 mm thickness double side polish 8 mm on -X</td>
		</tr>
		<tr>
			<td>Shim</td>
			<td>In-house developed</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>X-ray beam stop</td>
			<td>In-house developed</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

detecting wolbachia strain walbb in aedes albopictus cell lines

As a maternally harbored endosymbiont, Wolbachia infects large proportions of insect populations. Studies have recently reported the successful regulation of RNA virus transmission using Wolbachia-transfected mosquitoes. Key strategies to control viruses include the manipulation of host reproduction via cytoplasmic incompatibility and the inhibition of viral transcripts via immune priming and competition for host-derived resources. However, the underlying mechanisms of the responses of Wolbachia-transfected mosquitoes to viral infection are poorly understood. This paper presents a protocol for the in vitro identification of Wolbachia infection at the nucleic acid and protein levels in Aedes albopictus (Diptera: Culicidae) Aa23 cells to enhance the understanding of the interactions between Wolbachia and its insect vectors. Through the combined use of polymerase chain reaction (PCR), quantitative PCR, western blot, and immunological analytical methods, a standard morphologic protocol has been described for the detection of Wolbachia-infected cells that is more accurate than the use of a single method. This approach may also be applied to the detection of Wolbachia infection in other insect taxa.

Before Wolbachia was detected, Aa23 and Aa23-T cells were observed under a light microscope to determine any morphological differences between the two cell lines. Aa23 and Aa23-T cells have at least two cell morphologies but no obvious morphological difference between the two cell types (Figure 1). Here, Aa23 cells were used as a model system to detect Wolbachia infection using four methods. Positive amplification of the Wolbachiawsp gene using the...

Watch this Scientific Journal Video about Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines at JoVE.com

Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines

Four methods were used to detect intracellular Wolbachia, which complemented each other and improved the detection accuracy of Wolbachia infection of Aedes albopictus-derived Aa23 and Aa23-T&#160;cured of native Wolbachia infection using antibiotics.

Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines

As a maternally harbored endosymbiont, Wolbachia infects large proportions of insect populations. Studies have recently reported the successful regulation ...

detecting-wolbachia-strain-walbb-in-aedes-albopictus-cell-lines

Research

JoVE Journal

Immunology and Infection

1.9K Views.  Guizhou Medical University. Four methods were used to detect intracellular Wolbachia, which complemented each other and improved the detection accuracy of Wolbachia infection of Aedes albopictus-derived Aa23 and Aa23-T cured of native Wolbachia infection using antibiotics.

Video: Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines

Derivation of Thymic Lymphoma T-cell Lines from Atm-/- and p53-/- Mice

Established cell lines are a critical research tool that can reduce the use of laboratory animals in research. Certain strains of genetically modified mice, such as Atm-/- and p53-/- consistently develop thymic lymphoma early in life 1,2, and thus, can serve as a reliable source for derivation of murine T-cell lines. Here we present a detailed protocol for the development of established murine thymic lymphoma T-cell lines without the need to add interleukins as described in previous protocols 1,3. Tumors were harvested from mice aged three to six months, at the earliest indication of visible tumors based on the observation of hunched posture, labored breathing, poor grooming and wasting in a susceptible strain 1,4. We have successfully established several T-cell lines using this protocol and inbred strains ofAtm-/- [FVB/N-Atmtm1Led/J] 2 and p53-/- [129/S6-Trp53tm1Tyj/J] 5 mice. We further demonstrate that more than 90% of the established T-cell population expresses CD3, CD4 and CD8. Consistent with stably established cell lines, the T-cells generated by using the present protocol have been passaged for over a year.

Derivation of Thymic Lymphoma T-cell Lines from Atm-/- and p53-/- Mice

In this video we demonstrate a protocol to establish mouse thymic lymphoma cell lines. By following this protocol, we have successfully established several T-cell lines from Atm-/- and p53-/- mice with thymic lymphoma.

Established cell lines are a critical research tool that can reduce the use of laboratory animals in research. Certain strains of genetically modified ...

Establishment of Epstein-Barr Virus Growth-transformed Lymphoblastoid Cell Lines

Infection of B cells with Epstein-Barr virus (EBV) leads to proliferation and subsequent immortalization, resulting in establishment of lymphoblastoid cell lines (LCL) in vitro. Since LCL are latently infected with EBV, they provide a model system to investigate EBV latency and virus-driven B cell proliferation and tumorigenesis1. LCL have been used to present antigens in a variety of immunologic assays2, 3. In addition, LCL can be used to generate human monoclonal antibodies4, 5 and provide a potentially unlimited source when access to primary biologic materials is limited6, 7.
A variety of methods have been described to generate LCL. Earlier methods have included the use of mitogens such as phytohemagglutinin, lipopolysaccharide8, and pokeweed mitogen9 to increase the efficiency of EBV-mediated immortalization. More recently, others have used immunosuppressive agents such as cyclosporin A to inhibit T cell-mediated killing of infected B cells7, 10-12.
The considerable length of time from EBV infection to establishment of cell lines drives the requirement for quicker and more reliable methods for EBV-driven B cell growth transformation. Using a combination of high titer EBV and an immunosuppressive agent, we are able to consistently infect, transform, and generate LCL from B cells in peripheral blood. This method uses a small amount of peripheral blood mononuclear cells that are infected in vitroclusters of cells can be demonstrated. The presence of CD23 with EBV in the presence of FK506, a T cell immunosuppressant. Traditionally, outgrowth of proliferating B cells is monitored by visualization of microscopic clusters of cells about a week after infection with EBV. Clumps of LCL can be seen by the naked eye after several weeks. We describe an assay to determine early if EBV-mediated growth transformation is successful even before microscopic clusters of cells can be demonstrated. The presence of CD23hiCD58+ cells observed as early as three days post-infection indicates a successful outcome.

We describe a method for generating transformed B cell lines using Epstein-Barr virus. We also illustrate a novel assay that can identify B cells destined to undergo transformation as early as three days after infection.

Infection of B cells with Epstein-Barr virus (EBV) leads to proliferation and subsequent immortalization, resulting in establishment of lymphoblastoid ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. Polysaccharides such as glycogen, glycoproteins, and glycolipids stain bright magenta making it easy to enumerate positive and negative cells within the tissue. In muscle cells PAS staining is used to determine the glycogen content in different types of muscle cells, while in blood cell samples PAS staining has been explored as a diagnostic tool for a variety of conditions. Blood contains a proportion of white blood cells that belong to the immune system. The notion that cells of the immune system possess glycogen and use it as an energy source has not been widely explored. Here, we describe an adapted version of the PAS staining protocol that can be applied on peripheral blood mononuclear immune cells from human venous blood. Small cells with PAS-positive granules and larger cells with diffuse PAS staining were observed. Treatment of samples with amylase abrogates these patterns confirming the specificity of the stain. An alternate technique based on enzymatic digestion confirmed the presence and amount of glycogen in the samples. This protocol is useful for hematologists or immunologists studying polysaccharide content in blood-derived lymphocytes.

Periodic acid Schiff staining is a technique that visualizes the polysaccharide content of tissues. This article demonstrates periodic acid Schiff staining protocol adapted for use on peripheral blood mononuclear cells purified from human venous blood. Such samples are enriched for lymphocytes and other white blood cells of the immune system.

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Prevention of Heat Stress Adverse Effects in Rats by Bacillus subtilis Strain

This study was designed to evaluate the protective effect of the Bacillus subtilis strain against complications related to heat stress. Thirty-two Sprague-Dawley rats were used in this study. Animals were orally treated twice a day for two days with B. subtilis BSB3 strain or PBS. The next day after the last treatment, each group was divided and two experimental groups (one treated with PBS and one treated with B. subtilis) were placed at 45 oC for 25 min. Two control groups stayed for 25 min at room temperature. All rats were euthanized and different parameters were analyzed in all groups. Adverse effects of heat stress are registered by the decrease of villi height and total mucosal thickness in the intestinal epithelium; translocation of bacteria from the lumen; increased vesiculation of erythrocytes and elevation of the lipopolysaccharides (LPS) level in the blood. The protective efficacy of treatment is evaluated by prevention of these side effects. The protocol was set up for the oral treatment of rats with bacteria for prevention of heat stress complications, but this protocol can be modified and used for other routes of administration and for analysis of different compounds.

Prevention of Heat Stress Adverse Effects in Rats by Bacillus subtilis Strain

We described a protocol for prevention of heat stress effects in rats by oral pre-treatment with beneficial bacteria. This protocol can be modified and used for various routes of administration and for analysis of different compounds.

This study was designed to evaluate the protective effect of the Bacillus subtilis strain against complications related to heat stress. Thirty-two ...

Detecting Cortex Fragments During Bacterial Spore Germination

The process of endospore germination in Clostridium difficile, and other Clostridia, increasingly is being found to differ from the model spore-forming bacterium, Bacillus subtilis. Germination is triggered by small molecule germinants and occurs without the need for macromolecular synthesis. Though differences exist between the mechanisms of spore germination in species of Bacillus and Clostridium, a common requirement is the hydrolysis of the peptidoglycan-like cortex which allows the spore core to swell and rehydrate. After rehydration, metabolism can begin and this, eventually, leads to outgrowth of a vegetative cell. The detection of hydrolyzed cortex fragments during spore germination can be difficult and the modifications to the previously described assays can be confusing or difficult to reproduce. Thus, based on our recent report using this assay, we detail a step-by-step protocol for the colorimetric detection of cortex fragments during bacterial spore germination.

Herein, we describe a colorimetric assay to detect the presence of reducing sugars during bacterial spore germination.

The process of endospore germination in Clostridium difficile, and other Clostridia, increasingly is being found to differ from the model spore-forming ...

A Simple Red Blood Cell Lysis Method for the Establishment of B Lymphoblastoid Cell Lines

A number of methods exist for the transformation of B lymphocytes by the Epstein Barr virus in vitro into immortalized cell lines. We have developed a new method with a powerful and simple strategy for the establishment of B-LCLs, the red blood cell lysis method. This method simplified the PBMC separation procedure with red blood cell removal, and used as little as 0.5 mL of whole blood for establishing EBV-immortalized cell lines, which can proliferate to large cell numbers in a relatively short amount time with a 100% success rate. The method is simple, reliable, time saving, and applicable to treating a large number of the clinical samples.

A simple red blood cell lysis method for establishing B-LCLs was developed with high immortalization efficiency, requiring a small amount of blood and saving time from initiation to cryopreservation.

A number of methods exist for the transformation of B lymphocytes by the Epstein Barr virus in vitro into immortalized cell lines. We have developed a new ...

An Efficient and Simple Method to Establish NK and T Cell Lines from Patients with Chronic Active Epstein-Barr Virus Infection

A number of methods have been described to establish NK/T cell lines from patients with lymphoma or lymphoproliferative syndrome. These methods employed feeder cells, purified NK or T cells with as much as 10 mL of blood, or a high-dose of IL-2. This study presents a new method with a powerful and simple strategy to establish NK and T cell lines by culturing the peripheral blood mononuclear cells (PBMC) with the addition of recombinant human IL-2 (rhIL-2), and uses as little as 2 mL of whole blood. The cells can proliferate quickly in two weeks and be maintained for more than 3 months. With this method, 7 NK or T cell lines have been established with a high success rate. This method is simple, reliable, and applicable to establishing cell lines from more cases of CAEBV or NK/T cell lymphoma.

A simple method for obtaining NK and T cell clones from CAEBV patients was developed with high efficiency, a small amount of peripheral blood, and a low-dose of IL-2.

A number of methods have been described to establish NK/T cell lines from patients with lymphoma or lymphoproliferative syndrome. These methods employed ...

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary tissue during pneumonia results in the production of long-lived cytotoxins that can lead to subsequent end organ failure. We have developed in vitro assays to test the hypothesis that cytotoxins are produced during pulmonary infection. Isolated rat pulmonary endothelial cells and the bacterium Pseudomonas aeruginosa are used as model systems, and the production of cytoxins following infection of the endothelial cells by the bacteria is demonstrated using cell culture followed by direct quantitation using lactate dehydrogenase assays and a novel microscopic method utilizing ImageJ technology. The amyloid nature of these cytotoxins was demonstrated by thioflavin T binding assays and by immunoblotting and immunodepletion using A11 anti-amyloid antibody. Further analyses using immunoblotting demonstrated that oligomeric tau and A&#946; were produced and released by endothelial cells following infection by P. aeruginosa. These methods should be readily adaptable to analyses of human clinical samples.

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Simple methods are described for demonstrating the production of cytotoxic amyloids following infection of pulmonary endothelium by Pseudomonas aeruginosa.

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary ...

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine the rate of infection, disseminated infection, and potential transmission of the virus in the mosquito population in question. These procedures are widely utilized with various modifications in vector competence evaluations globally. They are important in determining the potential role that a given mosquito (i.e., species, population, individual) may play in the transmission of a given agent.

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The presented protocol can determine the vector competence of Aedes aegypti mosquito populations for a given virus, such as Zika, in a containment setting.

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine ...

Propagation of the Microsporidian Parasite Edhazardia aedis in Aedes aegypti Mosquitoes

Edhazardia aedis is a microsporidian parasite of Aedes aegypti mosquitoes, a disease vector that transmits multiple arboviruses which cause millions of disease cases each year. E. aedis causes mortality and reduced reproductive fitness in the mosquito vector and has been explored for its potential as a biocontrol agent. The protocol we present for culturing E. aedis is based on its natural infection cycle, which involves both horizontal and vertical transmission at different life stages of the mosquito host. Ae. aegypti mosquitoes are exposed to spores in the larval stage. These infected larvae then mature into adults and transmit the parasite vertically to their offspring. Infected offspring are then used as a source of spores for future horizontal transmission. Culturing E. aedis can be challenging to the uninitiated given the complexities of the parasite&#8217;s life cycle, and this protocol provides detailed guidance and visual aids for clarification.

Propagation of the Microsporidian Parasite Edhazardia aedis in Aedes aegypti Mosquitoes

A protocol to culture the microsporidian parasite Edhazardia aedis. The parasite is passaged from one generation of Aedes aegypti mosquitoes to the next via horizontal transfer at the larval stage followed by vertical transmission at the adult stage. Live sporoplasms survive long-term in infected eggs.

Edhazardia aedis is a microsporidian parasite of Aedes aegypti mosquitoes, a disease vector that transmits multiple arboviruses which cause millions of ...