Name: detecting wolbachia strain walbb in aedes albopictus cell lines
Uploaded: 2022-06-01T15:00:00.000+00:00
Duration: 8 min 8 s
Description: Watch this Scientific Journal Video about Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines at JoVE.com

We thank Dr. Xin-Ru Wang from the University of Minnesota for insightful suggestions and guidance. This work was supported by a grant from the National Natural Science Foundation of China (No.81760374).

1. Materials and reagents
<ol>
	<li>Use pyrogen-free solutions and media for cell culture (see the Table of Materials).</li>
	<li>Use ultrapure water to prepare all solutions.</li>
	<li>Be careful in selecting fetal bovine serum (FBS) for cell culture, following a lot-check process. 
	NOTE: As FBS lots are subject to regular change, it is impossible to state the relevant catalog and lot numbers in this protocol.</li>
	<li>Select Aa23 cell strains derived from A. albopictus eggs, corresponding to Wolbachia-free Aa23-T.</li>
</ol>
2. Cell culture
<ol>
	<li>Prepare 25 cm2 cell culture flasks with 4 mL of Schneider&#39;s medium with 10% FBS.</li>
	<li>Incubate the flasks at 28 &#176;C under a 5% CO2 atmosphere for 5 to 7 days7,24.</li>
	<li>Observe unstained Aa23 and Aa23-T cells in the flasks using light microscopy at 100x magnification (Figure 1).</li>
</ol>
3. DNA extraction
<ol>
	<li>Culture the cells for 5-7 days until 70-80% confluence per flask (step 2). Harvest the cells with manual pipetting from 1 mL of resuspended culture medium by centrifugation for 5 min at 100 &#215; g in a microcentrifuge.</li>
	<li>Remove the supernatant by aspiration and store the resulting cell pellet at -20 &#176;C.</li>
	<li>Resuspend the pellets in 0.40 mL of phosphate-buffered saline (PBS), place 50 &#181;L of the solution in a microcentrifuge tube, add 5 &#181;L of proteinase K (20 mg/mL), and incubate at 55 &#176;C for 1 h. Finally, heat these tubes at 99 &#176;C for 15 min to obtain the crude DNA and store it at -20 &#176;C.</li>
</ol>
4. Detection of Wolbachia nucleic acid
<ol>
	<li>PCR analysis
	<ol>
		<li>Perform PCR in a total reaction volume of 20 &#181;L, containing 8 &#181;L of ddH2O, 10 &#181;L of Taq polymerase (see the Table of Materials), 1 &#181;L of DNA template (from step 3), 0.5 &#181;L of forward and reverse primers (10 &#181;M): wsp81F (5&#39; TGG TCC AAT AAG TGATGA AGAAAC 3&#39;) and wsp691R (5&#39; AAA AAT TAA ACG CTA CTC CA 3&#39;)25, respectively.</li>
		<li>Use the following PCR conditions: initial denaturation at 95 &#176;C for 5 min, followed by 35 cycles of denaturation at 94 &#176;C, annealing at 55 &#176;C, and extension at 72 &#176;C; then, a final extension at 72 &#176;C for 7 min.</li>
		<li>Detect the DNA on a 1% agarose gel (1% w/v agarose in PBS) using a gel imager.</li>
	</ol>
	</li>
	<li>qPCR analysis
	<ol>
		<li>Analyze the Wolbachia genome copy for three biological replicates (n = 6) from the extracted DNA (step 3) using wsp primers 183 F (5&#39; AAGGAACCGAAGTTCATG 3&#39;) and QBrev R (5&#39; AGTTGAGAGTAAAGTCCC 3&#39;)22, normalized with ribosomal protein S6 (RPS6) forward and reverse primers (5&#39; GAAGTTGAACGTATCGTTTC 3&#39; and 5&#39; GAGATGGTCAGCGGTGATTT 3&#39;, respectively)3.</li>
		<li>Generate a standard curve for wAlbB and RPS6.
		<ol>
			<li>Extract DNA from PMD-18T (a special vector for efficient cloning of PCR products (TA cloning)) recombinant plasmid containing wsp and rps6 gene fragments (Supplemental File) and measure the plasmid DNA concentration (see the Table of Materials).</li>
			<li>Convert the plasmid DNA concentration to copy number concentration using Eq (1). 
			Plasmid copy number = <img alt="Equation 1" src="/files/ftp_upload/63662/63662eq01v3.jpg" /> (1)</li>
			<li>Dilute the plasmid copy number from 101 to 108 with ultrapure water, and set 3 replicates for each concentration gradient.</li>
			<li>Perform qPCR amplification using TB Green and a real-time PCR system (see the Table of Materials), and record the results of each reaction. Use the Ct value to develop a standard curve. Analyze the DNA in a total reaction volume of 20 &#181;L, comprising 7 &#181;L of ddH2O, 10.4 &#181;L of TB Green (see the Table of Materials), 1 &#181;L of DNA template (provided by Step 3), and 0.8 &#181;L of forward and reverse primers (10 &#181;M). Use the following reaction conditions: initial denaturation at 95 &#176;C for 5 min, followed by 40 cycles of denaturation at 95 &#176;C for 10 s, and annealing at 60 &#176;C for 35 s.</li>
			<li>Calculate the WSP and&#8203; RPS6 gene copy numbers in the cells according to the established standard curve and the Wolbachia relative density by the copy number of wsp/RPS6. Analyze the data using an independent samples t-test.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Western blot analysis of Wolbachia protein
	<ol>
		<li>Protein extraction
		<ol>
			<li>Collect 2 &#215; 107 Aa23 and Aa23-T cells from the six-well plate (from step 2) in a microcentrifuge tube, wash them three times with PBS, and centrifuge them at 100 &#215; g for 5 min at 4 &#176;C.</li>
			<li>Prepare 1 mL lysates with RIPA lysis buffer (50 mM Tris (pH 7.4), 150 mM NaCl, 1%Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS], 2 mM sodium pyrophosphate, 25 mM &#946;-glycerophosphate, 1 mM EDTA, 1 mM Na3VO4, 0.5 &#181;g/mL leupeptin) and PMSF (final concentration 1 mM).</li>
			<li>Add 200 &#181;L of lysis buffer to the cell pellet and maintain for 30 min on ice. Centrifuge the lysates at 12,000 &#215; g for 10 min at 4 &#176;C and remove the supernatant.</li>
		</ol>
		</li>
		<li>Assay the wsp concentration of the supernatant using a bicinchoninic acid (BCA) protein assay kit (see the Table of Materials) following the manufacturer&#39;s instructions.</li>
		<li>Load equal amounts of protein on a 15% SDS-PAGE gel [10% distilled water; 50% (30% Acr-Bis (29:1), 38% 1 M Tris, pH 8.8; 1% (10% SDS), 1% (10% ammonium persulfate), 0.04% TEMED].</li>
		<li>Transfer the protein to nitrocellulose membranes, block the membranes with 5% skimmed milk for 2 h26,27 at room temperature, and then wash the membranes three times with TBST (1 mL of Tween 20 in 1 L of TBS) (see the Table of Materials).</li>
		<li>Incubate the membranes overnight at 4 &#176;C with 100 &#181;L of anti-wsp polyclonal antibody (prepared in-house, see Supplemental File)), prepared by diluting the primary antibody with 5% skimmed milk (1:12,000).</li>
		<li>Wash the primary antibody three times with TBST.</li>
		<li>Incubate the membranes in 100 &#181;L of horseradish peroxidase (HRP)-conjugated secondary antibody on a shaker for 1 h at room temperature.</li>
		<li>Wash the membranes three times with TBST, and mix 20 &#181;L of solution A (HRP Substrate Luminol Reagent) and 20 &#181;L of solution B (HRP Substrate Peroxide Reagent) in the chemiluminescence detection kit at a ratio of 1:1. Immerse the entire membrane into the luminescence solution at the same time, and observe the signals using a multifunctional imaging system.</li>
	</ol>
	</li>
	<li>Immunofluorescence localization of Wolbachia protein
	<ol>
		<li>Incubate 5 &#215; 105 Aa23 and Aa23-T cells at 28 &#176;C on a Laser confocal Petri dish with a thickness of 0.17 mm at the bottom, under a 5% CO2 atmosphere for 3 to 4 days7,24. Wait until the cell is 60%-70% confluence and wash the cells three times with PBS.</li>
		<li>Fix the cells for 20 min at 4 &#176;C in 1 mL of 4% (w/v) paraformaldehyde in PBS.</li>
		<li>Wash the fixed cells using PBST (0.2% v/v Triton X-100 in PBS) for 5 min and wash the cells again twice with PBS.</li>
		<li>Incubate the slides for 1 h at 37 &#176;C in 1 mL of 3% (w/v) bovine serum albumin in PBS.</li>
		<li>Incubate the slides overnight in 100 &#181;L of mouse anti-wsp polyclonal antibody (prepared in-house) and mouse serum (1:1,000 dilution in PBS) in a wet box (it can maintain humidity and prevent moisture from evaporating) at 4 &#176;C.</li>
		<li>Remove the slides from the wet box and return them to room temperature; wash them three times with PBS and remove the PBS. 
		NOTE: From step 4.4.7 onward, all operations must be protected from light.</li>
		<li>Incubate the slides with 100 &#181;L of an Alexa Fluor 488-conjugated goat anti-mouse antibody (1:2,000 dilution in PBS) at 37 &#176;C for 30 min.</li>
		<li>Incubate the sample slides with 50 &#181;L of 4&#39;,6-diamidino-2-phenylindole (DAPI diluted in PBS to 10 &#181;g/mL, binds strongly to DNA) at 37 &#176;C for 5 min and then wash them three times with PBS.</li>
		<li>Observe the immunostaining under a confocal microscope.
		<ol>
			<li>Turn on the power and the laser.</li>
			<li>Turn on the normal and mercury lamps of the microscope.</li>
			<li>Start the system and run the operation software. Put a drop of cedar oil on the sample slides, place the sample slides on the microscope stage, and move the stage to the appropriate position.</li>
			<li>Click the mercury lamp observation button in the software, open the mercury lamp shutter, and observe the sample under an inverted microscope to focus.</li>
			<li>Use the manual control panel to select green and blue fluorescence to take fluorescence photos under 100x magnification.</li>
			<li>Turn off the mercury lamp observation button and start acquiring images.</li>
			<li>To ensure good image quality, prescan by scan size (512 pixels x 512 pixels). Adjust the scan size to get clear images (1,024 pixels x 1,024 pixels).</li>
			<li>Carry out noise reduction if the background noise is too high.</li>
			<li>Stop scanning and save the images.</li>
			<li>Turn off the mercury lamp and lasers.</li>
			<li>Wipe the objective with 75% alcohol and lower the objective to the lowest position.</li>
			<li>Turn off the shutter and microscope power.</li>
			<li>After the instrument has cooled, cover it with the dust cover.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Wiwatanaratanabutr, I., Kittayapong, P. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+crowding+and+temperature+on+Wolbachia+infection+density+among+life+cycle+stages+of+Aedes+albopictus.">Effects of crowding and temperature on Wolbachia infection density among life cycle stages of Aedes albopictus.</a> Journal of Invertebrate Patholology. 102 (3), 220-224 (2009).</li><li>Sinkins, S. P., Braig, H. R., O'Neill, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+superinfections+and+the+expression+of+cytoplasmic+incompatibility.">Wolbachia superinfections and the expression of cytoplasmic incompatibility.</a> Proceedings of Biologial Sciences. 261 (1362), 325-330 (1995).</li><li>Dobson, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+infections+are+distributed+throughout+insect+somatic+and+germ+line+tissues.">Wolbachia infections are distributed throughout insect somatic and germ line tissues.</a> Insect Biochemistry and Molecular Biology. 29 (2), 153-160 (1999).</li><li>O'Neill, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+cultivation+of+Wolbachia+pipientis+in+an+Aedes+albopictus+cell+line.">In vitro cultivation of Wolbachia pipientis in an Aedes albopictus cell line.</a> Insect Molecular Biology. 6 (1), 33-39 (1997).</li><li>Sinha, A., Li, Z., Sun, L., Carlow, C. K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+genome+sequence+of+the+Wolbachia+wAlbB+endosymbiont+of+Aedes+albopictus.">Complete genome sequence of the Wolbachia wAlbB endosymbiont of Aedes albopictus.</a> Genome Biology and Evoution. 11 (3), 706-720 (2019).</li><li>Sinkins, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+and+cytoplasmic+incompatibility+in+mosquitoes.">Wolbachia and cytoplasmic incompatibility in mosquitoes.</a> Insect Biochemistry and Molecular Biology. 34 (7), 723-729 (2004).</li><li>Fallon, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytological+properties+of+an+Aedes+albopictus+mosquito+cell+line+infected+with+Wolbachia+strain+wAlbB.">Cytological properties of an Aedes albopictus mosquito cell line infected with Wolbachia strain wAlbB.</a> In Vitro Cellular Developmental Biology - Animals. 44 (5-6), 154-161 (2008).</li><li>Hilgenboecker, K., Hammerstein, P., Schlattmann, P., Telschow, A., Werren, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+many+species+are+infected+with+Wolbachia?-A+statistical+analysis+of+current+data.">How many species are infected with Wolbachia?-A statistical analysis of current data.</a> Microbiology Letters. 281 (2), 215-220 (2008).</li><li>Werren, J. H., Baldo, L., Clark, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia:+master+manipulators+of+invertebrate+biology.">Wolbachia: master manipulators of invertebrate biology.</a> National Review of Microbiology. 6 (10), 741-751 (2008).</li><li>Kittayapong, P., Baisley, K. J., Baimai, V., O'Neill, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+and+diversity+of+Wolbachia+infections+in+Southeast+Asian+mosquitoes+(Diptera:+Culicidae).">Distribution and diversity of Wolbachia infections in Southeast Asian mosquitoes (Diptera: Culicidae).</a> Journal of Medical Entomology. 37 (3), 340-345 (2000).</li><li>O'Neill, S. L., Hoffmann, A., Werren, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Influential passengers: inherited microorganisms and arthropod reproduction. , (1997).</li><li>McGraw, E. A., O'Neill, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beyond+insecticides:+new+thinking+on+an+ancient+problem.">Beyond insecticides: new thinking on an ancient problem.</a> National Review of Microbiology. 11 (3), 181-193 (2013).</li><li>Bourtzis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Harnessing+mosquito-Wolbachia+symbiosis+for+vector+and+disease+control.">Harnessing mosquito-Wolbachia symbiosis for vector and disease control.</a> Acta Tropica. 132, 150-163 (2014).</li><li>Turelli, M., Hoffmann, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+spread+of+an+inherited+incompatibility+factor+in+California+Drosophila.">Rapid spread of an inherited incompatibility factor in California Drosophila.</a> Nature. 353 (6343), 440-442 (1991).</li><li>Hoffmann, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+establishment+of+Wolbachia+in+Aedes+populations+to+suppress+dengue+transmission.">Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission.</a> Nature. 476 (7361), 454-457 (2011).</li><li>Walker, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+wMel+Wolbachia+strain+blocks+dengue+and+invades+caged+Aedes+aegypti+populations.">The wMel Wolbachia strain blocks dengue and invades caged Aedes aegypti populations.</a> Nature. 476 (7361), 450-453 (2011).</li><li>Hughes, G. L., Koga, R., Xue, P., Fukatsu, T., Rasgon, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+infections+are+virulent+and+inhibit+the+human+malaria+parasite+Plasmodium+falciparum+in+Anopheles+gambiae.">Wolbachia infections are virulent and inhibit the human malaria parasite Plasmodium falciparum in Anopheles gambiae.</a> PLoS Pathogens. 7 (5), 1002043 (2011).</li><li>Bian, G., Xu, Y., Lu, P., Xie, Y., Xi, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+endosymbiotic+bacterium+Wolbachia+induces+resistance+to+dengue+virus+in+Aedes+aegypti.">The endosymbiotic bacterium Wolbachia induces resistance to dengue virus in Aedes aegypti.</a> PLoS Pathogens. 6 (4), 1000833 (2010).</li><li>Moreira, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Wolbachia+symbiont+in+Aedes+aegypti+limits+infection+with+dengue,+Chikungunya,+and+Plasmodium.">A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium.</a> Cell. 139 (7), 1268-1278 (2009).</li><li>Caragata, E. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dietary+cholesterol+modulates+pathogen+blocking+by+Wolbachia.">Dietary cholesterol modulates pathogen blocking by Wolbachia.</a> PLoS Pathogens. 9 (6), 1003459 (2013).</li><li>Zhang, G., Hussain, M., O'Neill, S. L., Asgari, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+uses+a+host+microRNA+to+regulate+transcripts+of+a+methyltransferase,+contributing+to+dengue+virus+inhibition+in+Aedes+aegypti.">Wolbachia uses a host microRNA to regulate transcripts of a methyltransferase, contributing to dengue virus inhibition in Aedes aegypti.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (25), 10276-10281 (2013).</li><li>Tortosa, P., Courtiol, A., Moutailler, S., Failloux, A. B., Weill, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chikungunya-Wolbachia+interplay+in+Aedes+albopictus.">Chikungunya-Wolbachia interplay in Aedes albopictus.</a> Insect Molecular Biology. 16 (7), 677-684 (2008).</li><li>Lu, P., Bian, G., Pan, X., Xi, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+induces+density-dependent+inhibition+to+dengue+virus+in+mosquito+cells.">Wolbachia induces density-dependent inhibition to dengue virus in mosquito cells.</a> PLoS Neglected Tropical Diseases. 6 (7), 1754 (2012).</li><li>Ghosh, A., Jasperson, D., Cohnstaedt, L. W., Brelsfoard, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+of+Culicoides+sonorensis+biting+midge+cell+lines+with+Wolbachia+pipientis.">Transfection of Culicoides sonorensis biting midge cell lines with Wolbachia pipientis.</a> Parasite Vectors. 12 (1), 483 (2019).</li><li>Zhou, W., Rousset, F., O'Neill, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phylogeny+and+PCR-based+classification+of+Wolbachia+strains+using+wsp+gene+sequences.">Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences.</a> The Royal Society Publishing. Proceedings B. 265 (1395), 509-515 (1998).</li><li>Park, M. S., Takeda, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+of+PaAtg8+and+roles+of+autophagy+in+adaptation+to+starvation+with+respect+to+the+fat+body+and+midgut+of+the+Americana+cockroach,+Periplaneta+americana.">Cloning of PaAtg8 and roles of autophagy in adaptation to starvation with respect to the fat body and midgut of the Americana cockroach, Periplaneta americana.</a> Cell Tissue Research. 356 (2), 405-416 (2014).</li><li>Geng, S. C., Li, X. L., Fang, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Porcine+circovirus+3+capsid+protein+induces+autophagy+in+HEK293T+cells+by+inhibiting+phosphorylation+of+the+mammalian+target+of+rapamycin.">Porcine circovirus 3 capsid protein induces autophagy in HEK293T cells by inhibiting phosphorylation of the mammalian target of rapamycin.</a> Journal of Zhejiang University Science B. 21 (7), 560-570 (2020).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Scientific Reports. 7 (1), 2409 (2017).</li><li>Kosea, H., Karr, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organization+of+Wolbachia+pipientis+in+the+Drosophila+fertilized+egg+and+embryo+revealed+by+an+anti-Wolbachia+monoclonal+antibody.">Organization of Wolbachia pipientis in the Drosophila fertilized egg and embryo revealed by an anti-Wolbachia monoclonal antibody.</a> Mechanisms of Development. 51 (2-3), 275-288 (1995).</li><li>Ye, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+reduces+the+transmission+potential+of+dengue-infected+Aedes+aegypti.">Wolbachia reduces the transmission potential of dengue-infected Aedes aegypti.</a> PLoS Neglected Tropical Diseases. 9 (6), (2015).</li><li>Jensenius, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+immunofluorescence,+Western+blotting,+and+cross-adsorption+assays+for+diagnosis+of+African+tick+bite+fever.">Comparison of immunofluorescence, Western blotting, and cross-adsorption assays for diagnosis of African tick bite fever.</a> Clinical and Diagnostic Laboratory Immunology. 11 (4), 786-788 (2004).</li></ol>

The authors have no conflicts of interest to declare.

Detection of intracellular Wolbachia infection is essential for the study of Wolbachia-host interactions and the confirmation of successful transfection of cells with novel strains. In this protocol, four methods were used to successfully detect intracellular Wolbachia infection at the nucleic acid and protein levels. These four experimental methods corroborated and improved the detection accuracy of Wolbachia infection of cells. 
PCR was used to detect the ...

The Asian tiger mosquito Aedes albopictus (Skuse) (Diptera: Culicidae), which is a key vector of dengue virus (DENV) in Asia and other parts of the world1, is a natural host of two types of the intracellular bacteria, Wolbachia (wAlbA and wAlbB), which are distributed throughout the germ line and somatic tissue2,3. The Aa23 cell line derived from A. albopictus embryos&#160;consists of at least two morphological cell types, both of which support infection4 and may be cured of native Wolbachia infection using antibiotics (Aa23-T). Given that Aa23 retains only wAlbB, it is a useful model for the study of host-endosymbiont interactions4,5,6.
Wolbachia is maternally transmitted and infects an estimated 65% of insect species8,9 and 28% of mosquito species10. It infects a variety of tissues and forms an intimate symbiotic relationship with the host, usually inducing cytoplasmic incompatibility (CI)11 and population replacement by manipulating the host reproductive system12,13. These host responses have been observed in natural populations of Drosophila simulans14 and in A. aegypti in a laboratory cage and field trial15. An important nonreproductive manipulation elicited by Wolbachia is induced host resistance to a variety of pathogens, including DENV, Chikungunya virus (CHIKV), and West Nile virus (WNV)16,17, that may be mediated by an improved innate immune system of the symbiont18,19, competition between Wolbachia and viruses for essential host resources20, and manipulation of host viral defense pathways21.
This protocol has been developed for studying these underlying mechanisms of Wolbachia-induced host antiviral responses. It uses four methods of detection of intracellular Wolbachia infection of Aa23 cells. These methods provide a strong theoretical basis for studies of intracellular Wolbachia infection of other host species. The first method, PCR-a powerful technique allowing the enzymatic amplification of specific regions of DNA without utilizing conventional cloning procedures-was used to detect Wolbachia DNA and determine the presence/absence of Wolbachia infection22. The second method measures Wolbachia DNA copy density using quantitative PCR (qPCR) for reliable detection and measurement of products generated during each PCR cycle that is directly proportionate to the amount of template before PCR23. The third method detects the presence of intracellular Wolbachia proteins, using western blot-one of the most powerful tools for detecting specific proteins in complex mixtures by combining the high separation power of electrophoresis, the specificity of antibodies, and the sensitivity of chromogenic enzymatic reactions. The final method is an immunofluorescence assay (IFA) that combines immunology, biochemistry, and microscopy to detect the Wolbachia surface protein (wsp) through an antigen-antibody reaction to confirm the cellular uptake of Wolbachia and determine its cellular localization.
This paper describes the four methods listed above to verify the existence of Wolbachia in the cells, which can be used to detect whether the exogenous Wolbachia was successfully transfected and the Wolbachia in the cell was cleared. After determining whether Wolbachia is present in the cells or not, a variety of different analyses can be performed, including genomics, proteomics, or metabolomics. This protocol demonstrates the detection of Wolbachia through Aa23 cells but can also be used in other cells.

<table><tbody><tr><td>Microscope</td><td>Zeiss</td><td></td><td>SteREO Discovery V8</td></tr><tr><td>Petri dish</td><td>Fisher Scietific</td><td>FB0875713</td><td></td></tr><tr><td>Pipette</td><td>Pipetman</td><td>F167380</td><td>P10</td></tr><tr><td>&lt;strong&gt;inSituX platform&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Analysis software</td><td>In-house developed</td><td></td><td></td></tr><tr><td>Cerium doped yttrium aluminum garnet</td><td>MSE Supplies</td><td></td><td>Ce:Y3Al5O12, YAG single crystal substrates</td></tr><tr><td>Chip holder</td><td>In-house developed</td><td></td><td></td></tr><tr><td>Control software</td><td>In-house developed</td><td></td><td></td></tr><tr><td>Immersion oil</td><td>Cargille Laboratories</td><td>16482</td><td>Type A low viscosity 150 cSt</td></tr><tr><td>inSituX platform</td><td>In-house developed</td><td></td><td></td></tr><tr><td>IR light source&amp;nbsp;</td><td>Thorlabs Incorporated</td><td>LED1085L</td><td>LED with a Glass Lens, 1085 nm, 5 mW, TO-18</td></tr><tr><td>Outer ring&amp;nbsp;</td><td>In-house developed</td><td></td><td></td></tr><tr><td>Pump lasers&amp;nbsp;</td><td>Thorlabs Incorporated</td><td>LD785-SE400</td><td>785 nm, 400 mW, &amp;Oslash;9 mm, E Pin Code, Laser Diode</td></tr><tr><td>Raspberry Pi</td><td>Raspberry Pi Fundation</td><td></td><td></td></tr><tr><td>Retaining ring</td><td>Thorlabs Incorporated</td><td>SM1RR</td><td>SM1 retaining ring for &amp;Oslash;1&quot; lens tubes and mounts</td></tr><tr><td>Seedless quartz crystal</td><td>University Wafers, Inc.</td><td>U01-W2-L-190514</td><td>25.4 mm diameter Z-cut 0.05 mm thickness double side polish 8 mm on -X</td></tr><tr><td>Shim</td><td>In-house developed</td><td></td><td></td></tr><tr><td>X-ray beam stop</td><td>In-house developed</td><td></td><td></td></tr></tbody></table>

detecting wolbachia strain walbb in aedes albopictus cell lines

As a maternally harbored endosymbiont, Wolbachia infects large proportions of insect populations. Studies have recently reported the successful regulation of RNA virus transmission using Wolbachia-transfected mosquitoes. Key strategies to control viruses include the manipulation of host reproduction via cytoplasmic incompatibility and the inhibition of viral transcripts via immune priming and competition for host-derived resources. However, the underlying mechanisms of the responses of Wolbachia-transfected mosquitoes to viral infection are poorly understood. This paper presents a protocol for the in vitro identification of Wolbachia infection at the nucleic acid and protein levels in Aedes albopictus (Diptera: Culicidae) Aa23 cells to enhance the understanding of the interactions between Wolbachia and its insect vectors. Through the combined use of polymerase chain reaction (PCR), quantitative PCR, western blot, and immunological analytical methods, a standard morphologic protocol has been described for the detection of Wolbachia-infected cells that is more accurate than the use of a single method. This approach may also be applied to the detection of Wolbachia infection in other insect taxa.

Before Wolbachia was detected, Aa23 and Aa23-T cells were observed under a light microscope to determine any morphological differences between the two cell lines. Aa23 and Aa23-T cells have at least two cell morphologies but no obvious morphological difference between the two cell types (Figure 1). Here, Aa23 cells were used as a model system to detect Wolbachia infection using four methods. Positive amplification of the Wolbachiawsp gene using the...

Watch this Scientific Journal Video about Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines at JoVE.com

Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines

Four methods were used to detect intracellular Wolbachia, which complemented each other and improved the detection accuracy of Wolbachia infection of Aedes albopictus-derived Aa23 and Aa23-T&#160;cured of native Wolbachia infection using antibiotics.

Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines

As a maternally harbored endosymbiont, Wolbachia infects large proportions of insect populations. Studies have recently reported the successful regulation ...

detecting-wolbachia-strain-walbb-in-aedes-albopictus-cell-lines

Research

JoVE Journal

Immunology and Infection

2.0K Views.  Guizhou Medical University. Four methods were used to detect intracellular Wolbachia, which complemented each other and improved the detection accuracy of Wolbachia infection of Aedes albopictus-derived Aa23 and Aa23-T cured of native Wolbachia infection using antibiotics.

Video: Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines

Wolbachia Bacterial Infection in Drosophila

My name is Voia Friedman. I am associate researcher at Princeton University. And today I'm going to tell you about a few protocols that I developed to trans infect, to I initially to isolate, to go back from the heli of infected flies, and later on help to inject the heli feed to unaffected flights.So basically, this is a very simple protocol to isolate him oly for basics. And you will use this device from, from mepo that contains a filter that goes on top of an E.So you basically needs to put you, we start from around a hundred flies. You anize the flies, you put them into the filter device, you can just use a funnel and that will add our other fit very easily on this device and wash it with 70%ethanol.You just take the, take the future away, you can throw away the ethanol, and then after three times your last wash you do with molecule water because you don't want have the bacteria from the, with traces of ethanol. Well, and then you just go to a new weapon door and, and then you spin down on a micro, real micro for two minutes And later on how you can inject that. He only feed do unaffected flies.So basically take a double stick tape and usually these double stick tapes have two side, one side is a sticker than the other. So leave the sticker side up because that's the side that you're gonna glue that flies on top of it. And basically you'll, the gas apparatus, if you have this light on top of it, you'll be no gas flow and the flies you wake up if they're on top of the slide.So you can just direct the flow, making a little hood, a little chamber using tape. Then you direct the gas over the flies. So then you put your, this light here with the tape and you, you have your flies.Stick the flies on the top of the tape, all of them the same orientation, and put their head towards the direction that you'll be bringing the needle from. Because then you can just over the, the wing, you make sure since they fly, you don't want to fly. If they woke up during the procedure, don't want them to go away.So make sure that you take a little tip and pressure against the, the, the wings of the fly on the tail. And it's okay if they wings get damaged. And when you get rid, when you take the flies up the injection, most likely they'll lose their wings anyway, so they'll survive.That can, that can be useful because you're not gonna lose the flies that, so he puts a mineral oil on the micrometer for the back of the needle, then the needle injection polar, and then the, you can just adjust the pressure to bring the material up to the tip of the needle. I, I did to inject Somewhere between 10 to 15 nanoliters, but as, as long, as long as I'm consistents. Okay, so one important detail there is a cushion of this experiment is that the, the fly, once the apply is being injected when you saw the needle needs to come as far as you can through the upper part of the abdomen.Because here, basically when the needle penetrates, you have a, a, a, a, a bigger space to go up and down. And basically if it's close, closer to the cuticle, it's less likely they're gonna penetrate vital organs in the flight. You, it is very likely unlikely that you're gonna punch a hole in your gut, for instance, if that is gonna kill the flight that you are performing the surgery.My name is Voia Friedman. I am associate researcher at Princeton University in the lab of Eric Hels. And today I would like to tell you about this protocol that you just saw, the demonstration.So this protocol was done because we wanted to prove that UBA is capable of crossing tissues. So UBA is one of the most successful intracellular paras on the face of the earth. Infects from 20 to 70%of insects and many particles.And also is, is very important in terms of human diseases because also infect nematodes that transmit diseases like river blindness or s and ssis. And so, and CCA is our obligatory endo in, in these worms. And there's a great, a very big interest in using CCA also as means to control parasitic diseases transmitter by mosquito and Danny and this and by mosquito such as malaria and dengue.So this, this, this protocol basically was developed to show that once CCA inside the abdominal cavity of a fly, they can cross tissues and reach the germ. So basically what you can see here is the oph of the drosophila ovary and go back once present in the he leaf it, it can cross a pink peronial. She that is around the ovary.And then they cross a muscle layer. And actually one of the first places that they, they go inside the ovary is the somatic stem cell image. And then they can reach the germline.And this bacteria is transmitted the same way that mitochondria is transmitted is through, is through the mother transmitted, through the mother cyop plants present in the egg. So of course they needs to be present into the germline. So that's why this protocol is developed.And this protocol is, can be very useful to basically traditionally the way that people would try to trans infect wbaa basically take wbaa and introduce a new insect species. It would be through doing micro injections into the, into the embryo. But those are much more complicated.And basically here we are just taking advantage of the o biology since they are capable to cross tissues and moving into the stem cell tissues from, they can pass to the, through to the germline. So that's make easier taking UBA from certain, from, from certain species of insects that are infected and they can be transmitted to uninfected species. Prob I think it's the injection itself.Basically you need to be careful to mobilize the fly as well as you can. We are using double sided stick tape and you need to penetrate the needle basically as close to the, as parallel to the fly as possible so you don't go to deep. And it's less likely that we're gonna kill the fly after they're performing the surgery.

Biology

Alphavirus Transducing System:  Tools for Visualizing Infection in Mosquito Vectors

Alphavirus transducing systems (ATSs) are important tools for expressing genes of interest (GOI) during infection. ATSs are derived from cDNA clones of mosquito-borne RNA viruses (genus Alphavirus; family Togaviridae). The Alphavirus genus contains about 30 different mosquito-borne virus species. Alphaviruses are enveloped viruses and contain single-stranded RNA genomes (~11.7 Kb). Alphaviruses transcribe a subgenomic mRNA that encodes the structural proteins of the virus required for encapsidation of the genome and maturation of the virus. Alphaviruses are usually highly lytic in vertebrate cells, but persistently infect susceptible mosquito cells with minimal cytopathology. These attributes make them excellent tools for gene expression in mosquito vectors. The most common ATSs in use are derived from Sindbis virus (SINV). The broad species tropism of SINV allows for infection of insect, avian, and mammalian cells8. However, ATSs have been derived from other alphaviruses as well9,10,20. Foreign gene expression is made possible by the insertion of an additional viral subgenomic RNA initiation site or promoter. ATSs in which an exogenous gene sequence is positioned 5' to the viral structural genes is used for stable protein expression in insects. ATSs, in which a gene sequence is positioned 3' to the structural genes, is used to trigger RNAi and silence expression of that gene in the insect.
ATSs have proven to be valuable tools for understanding vector-pathogen interactions, molecular details of viral replication and maintenance infectious cycles3,4,11,19,21. In particular, the expression of fluorescent and bioluminescent reporters has been instrumental tracking the viral infection in the vector and virus transmission5,14-16,18. Additionally, the vector immune response has been described using two strains of SINV engineered to express GFP2,9.
Here, we present a method for the production of SINV containing a fluorescent reporter (GFP) from the cDNA infectious clone. Infectious, full-length RNA is transcribed from the linearized cDNA clone. Infectious RNA is introduced into permissive target cells by electroporation. Transfected cells generate infectious virus particles expressing the GOI. Harvested virus is used to infect mosquitoes, as described here, or other host species (not shown herein). Vector competence is assessed by detecting fluorescence outside the midgut or by monitoring virus transmission7. Use of a fluorescent reporter as the GOI allows for convenient estimation of virus spread throughout a cell culture, for determination of rate of infection, dissemination in exposed mosquitoes, virus transmission from the mosquito and provides a rapid gauge of vector competence.

Methods for using alphavirus transducing systems to express fluorescent reporters in vitro and in adult mosquitoes are described. This technique may be adapted to express any protein of interest in lieu of or in addition to a reporter.

Alphavirus transducing systems (ATSs) are important tools for expressing genes of interest (GOI) during infection.  ATSs are derived from cDNA clones of ...

Maintaining Wolbachia in Cell-free Medium

In this video protocol, procedures are demonstrated to (1) purify Wolbachia symbionts out of cultured mosquito cells, (2) use a fluorescent assay to ascertain the viability of the purified Wolbachia and (3) maintain the now extracellular Wolbachia in cell-free medium.  Purified Wolbachia remain alive in the extracellular phase but do not replicate until re-inoculated into eukaryotic cells.  Extracellular Wolbachia purified in this manner will remain viable for at least a week at room temperature, and possibly longer.  Purified Wolbachia are suitable for micro-injection, DNA extraction and other applications. 


This video describes a method for purifying Wolbachia pipientis from an Anopheles gambiae cell line and then culturing the endosymbiont in cell-free medium. An assay for viability of the bacterium is demonstrated.

In this video protocol, procedures are demonstrated to (1) purify Wolbachia symbionts out of cultured mosquito cells, (2) use a fluorescent assay to ...

Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti

Mosquito gene editing has become routine in several laboratories with the establishment of systems such as transcription-activator-like effector nucleases (TALENs), zinc-finger nucleases (ZFNs), and homing endonucleases (HEs). More recently, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) technology has offered an easier and cheaper alternative for precision genome engineering. Following nuclease action, DNA repair pathways will fix the broken DNA ends, often introducing indels. These out-of-frame mutations are then used for understanding gene function in the target organisms. A drawback, however, is that mutant individuals carry no dominant marker, making identification and tracking of mutant alleles challenging, especially at scales needed for many experiments. 
High-resolution melt analysis (HRMA) is a simple method to identify variations in nucleic acid sequences and utilizes PCR melting curves to detect such variations. This post-PCR analysis method uses fluorescent double-stranded DNA-binding dyes with instrumentation that has temperature ramp control data capture capability and is easily scaled to 96-well plate formats. Described here is a simple workflow using HRMA for the rapid detection of CRISPR/Cas9-induced indels and the establishment of mutant lines in the mosquito Ae. aegypti. Critically, all steps can be performed with a small amount of leg tissue and do not require sacrificing the organism, allowing genetic crosses or phenotyping assays to be performed after genotyping.

Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti

This article details a protocol for rapid identification of indels induced by CRISPR/Cas9 and selection of mutant lines in the mosquito Aedes aegypti using high-resolution melt analysis.

Mosquito gene editing has become routine in several laboratories with the establishment of systems such as transcription-activator-like effector nucleases ...

Genetics

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine the rate of infection, disseminated infection, and potential transmission of the virus in the mosquito population in question. These procedures are widely utilized with various modifications in vector competence evaluations globally. They are important in determining the potential role that a given mosquito (i.e., species, population, individual) may play in the transmission of a given agent.

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The presented protocol can determine the vector competence of Aedes aegypti mosquito populations for a given virus, such as Zika, in a containment setting.

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine ...

An Experimental and Bioinformatics Protocol for RNA-seq Analyses of Photoperiodic Diapause in the Asian Tiger Mosquito, Aedes albopictus

Photoperiodic diapause is an important adaptation that allows individuals to escape harsh seasonal environments via a series of physiological changes, most notably developmental arrest and reduced metabolism. Global gene expression profiling via RNA-Seq can provide important insights into the transcriptional mechanisms of photoperiodic diapause. The Asian tiger mosquito, Aedes albopictus, is an outstanding organism for studying the transcriptional bases of diapause due to its ease of rearing, easily induced diapause, and the genomic resources available. This manuscript presents a general experimental workflow for identifying diapause-induced transcriptional differences in A. albopictus. Rearing techniques, conditions necessary to induce diapause and non-diapause development, methods to estimate percent diapause in a population, and RNA extraction and integrity assessment for mosquitoes are documented. A workflow to process RNA-Seq data from Illumina sequencers culminates in a list of differentially expressed genes. The representative results demonstrate that this protocol can be used to effectively identify genes differentially regulated at the transcriptional level in A. albopictus due to photoperiodic differences. With modest adjustments, this workflow can be readily adapted to study the transcriptional bases of diapause or other important life history traits in other mosquitoes.

An Experimental and Bioinformatics Protocol for RNA-seq Analyses of Photoperiodic Diapause in the Asian Tiger Mosquito, Aedes albopictus

RNA-Seq analyses are becoming increasingly important for identifying the molecular underpinnings of adaptive traits in non-model organisms. Here, a protocol to identify differentially expressed genes between diapause and non-diapause Aedes albopictus mosquitoes is described, from mosquito rearing, to RNA sequencing and bioinformatics analyses of RNA-Seq data.

Photoperiodic diapause is an important adaptation that allows individuals to escape harsh seasonal environments via a series of physiological changes, ...

Maintaining Aedes aegypti Mosquitoes Infected with Wolbachia

Aedes aegypti mosquitoes experimentally infected with Wolbachia are being utilized in programs to control the spread of arboviruses such as dengue, chikungunya and Zika. Wolbachia-infected mosquitoes can be released into the field to either reduce population sizes through incompatible matings or to transform populations with mosquitoes that are refractory to virus transmission. For these strategies to succeed, the mosquitoes released into the field from the laboratory must be competitive with native mosquitoes. However, maintaining mosquitoes in the laboratory can result in inbreeding, genetic drift and laboratory adaptation which can reduce their fitness in the field and may confound the results of experiments. To test the suitability of different Wolbachia infections for deployment in the field, it is necessary to maintain mosquitoes in a controlled laboratory environment across multiple generations. We describe a simple protocol for maintaining Ae. aegypti mosquitoes in the laboratory, which is suitable for both Wolbachia-infected and wild-type mosquitoes. The methods minimize laboratory adaptation and implement outcrossing to increase the relevance of experiments to field mosquitoes. Additionally, colonies are maintained under optimal conditions to maximize their fitness for open field releases.

Maintaining Aedes aegypti Mosquitoes Infected with Wolbachia

Aedes aegypti mosquitoes infected with Wolbachia are being released into natural populations to suppress the transmission of arboviruses. We describe methods to rear Ae. aegypti with Wolbachia infections in the laboratory for experiments and field release, taking precautions to minimize laboratory adaptation and selection.

Aedes aegypti mosquitoes experimentally infected with Wolbachia are being utilized in programs to control the spread of arboviruses such as dengue, ...

Using the Fluorescent Dye, Rhodamine B, to Study Mating Competitiveness in Male Aedes aegypti Mosquitoes

The success of sterile or incompatible insect technique-based population suppression programs depends on the ability of released males to compete for wild-type females and induce sterility in the target population. Hence, laboratory assessment of male mating competitiveness is essential for evaluating the release strain&#8217;s fitness before field release. Conventionally, such an assay is performed by determining the proportion of viable eggs produced by the females after being simultaneously exposed to two sets of males (wild-type and release strains) for copulation. However, this process is time-consuming and laborious due to the need to first blood-feed the females for egg production and then hatch and enumerate the hatched eggs to determine egg viability.&#160;
Moreover, this method cannot discern the degree of competitiveness between two sterile or Wolbachia-infected mosquito lines as wild-type female mosquitoes will only produce non-viable eggs upon mating with both. To circumvent these limitations, this paper describes a more direct method of measuring male mosquito mating competitiveness in laboratory settings using the fluorescent dye, rhodamine B (RhB), which can be used to mark males by feeding them in sucrose solution containing RhB. After the mating assay, the presence of fluorescing sperms in the spermathecae of a female can be used to determine her mating partner. This method is cost-effective, reduces the experimental time by 90% and allows comparison of mating fitness between two sterile or Wolbachia-infected lines.&#160;

Using the Fluorescent Dye, Rhodamine B, to Study Mating Competitiveness in Male Aedes aegypti Mosquitoes

Here, we present a protocol for studying mating competitiveness of male Aedes aegypti using fluorescent dye as a marker. Female mosquitoes are exposed to both marked and unmarked males for copulation. Post mating, their spermathecae are examined under a fluorescence microscope to determine their mating partner.

The success of sterile or incompatible insect technique-based population suppression programs depends on the ability of released males to compete for ...

Mosquito-Associated Virus Isolation from Field-Collected Mosquitoes

With the broad application of sequencing technologies, many novel virus-like sequences have been discovered in arthropods, including mosquitoes. The two main categories of these new mosquito-associated viruses are &#34;mosquito-borne viruses (MBVs)&#34; and &#34;mosquito-specific viruses (MSVs)&#34;. These novel viruses might be pathogenic to both vertebrates and mosquitoes, or they could just be symbiotic with mosquitoes. Entity viruses are essential to confirm the biological characters of these viruses. Thus, a detailed protocol has been described here for virus isolation and amplification from field-collected mosquitoes. First, the mosquito samples were prepared as supernatants of mosquito homogenates. After centrifugation twice, the supernatants were then inoculated into either mosquito cell line C6/36 or vertebrate cell line BHK-21 for virus amplification. After 7 days, the supernatants were collected as the P1 supernatants and stored at -80 &#176;C. Next, P1 supernatants were passaged twice more in C6/36 or BHK-21 cells while the cell status was being checked daily. When cytopathogenic effect (CPE) on the cells was discovered, these supernatants were collected and used to identify viruses. This protocol serves as the foundation for future research on mosquito-associated viruses, including MBVs and MSVs.

Numerous novel virus-like sequences have been found in mosquitoes due to the extensive use of sequencing technologies. We provide an effective procedure for isolating and amplifying viruses using vertebrate and mosquito cell lines, which might serve as the basis for future studies on mosquito-associated viruses, including mosquito-borne and mosquito-specific viruses.

With the broad application of sequencing technologies, many novel virus-like sequences have been discovered in arthropods, including mosquitoes. The two ...

Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines

Summary

Explore More Videos

Chapters in this video

Wolbachia Bacterial Infection in Drosophila

Alphavirus Transducing System: Tools for Visualizing Infection in Mosquito Vectors

Maintaining Wolbachia in Cell-free Medium

Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

An Experimental and Bioinformatics Protocol for RNA-seq Analyses of Photoperiodic Diapause in the Asian Tiger Mosquito, Aedes albopictus

Maintaining Aedes aegypti Mosquitoes Infected with Wolbachia

Using the Fluorescent Dye, Rhodamine B, to Study Mating Competitiveness in Male Aedes aegypti Mosquitoes

Mosquito-Associated Virus Isolation from Field-Collected Mosquitoes