C.P. is supported by RO1 DK60729 and P30 DK 41301-26. D.P. is supported by a Crohn&#39;s &#38; Colitis Foundation (CCFA) career development award, CURE: Digestive Diseases Research Center (DDRC) DK41301, and UCLA Clinical and Translational Science Institute (CTSI) UL1TR0001881. The UCLA virology core was funded by the Center of AIDS Research (CFAR) grant 5P30 AI028697. The UCLA Integrated Molecular Technologies core was supported by CURE/P30 grant DK041301. This work was also supported by the UCLA AIDS Institute.

NOTE: It is important to note that this protocol uses replication-deficient lentiviruses. Perform viral handling only after appropriate lab safety training. Bleach all items and surfaces that come in contact with live viruses for a minimum of 10 min after handling. Use a disposable lab coat and face/eye protection, as well as double gloves, at all times. Perform virus work in biosafety level 2+ labs with viral certification. Dedicate tissue culture hoods and incubators to viral work.
1. Vector Design and Generation
NOTE: The best way to identify gRNA sequences is to use online design tools (e.g., http://crispr-era.stanford.edu) (Supplemental Figure 1: gRNA design). For the accompanying representative experiment, a company designed and created the gRNA vectors used in the representative experiment. The dCas9 plasmid was also purchased online.
<ol>
	<li>The gRNA sequence is located upstream of the nucleotide sequence &#8220;NGG&#8221;, where &#8220;N&#8221; is any nucleotide, which also is within 100 base-pairs of the transcriptional start site. Search genetic databases such as BLAT (https://genome.ucsc.edu/cgi-bin/hgBlat?command=start) for the gRNA sequence, to make sure there are no other sites in the genome with similar sequences (Supplemental Figure 2: BLAT). This will ensure that the gRNA sequence is unique to the gene of interest (GOI).</li>
	<li>Store the gRNA and dCas9 plasmids, which come as bacterial stubs, at 4 &#176;C. Streak out Escherichia coli on a Luria broth (LB) agar plate with ampicillin (Supplemental Table 1) and grow the bacteria overnight at 37 &#176;C.</li>
	<li>Pick a colony and grow the bacteria in 5 mL of LB with ampicillin (Supplemental Table 1) overnight, vigorously shaking the plate in a 37 &#176;C incubator. The next day, add 2 mL of bacteria to 200 mL of LB with ampicillin grow in a 2 L flask, vigorously shaking the flask overnight in a 37 &#176;C incubator.</li>
	<li>Spin down the bacteria at 3,724 x g for 20 min. Remove the media and place the tube containing the bacteria on ice.</li>
	<li>Purify bacterial DNA using a plasmid purification kit per the manufacturer&#8217;s protocol. 
	NOTE: The plasmid purification kits contain proprietary resuspension buffer, lysis buffer, wash buffer, equilibration buffer, and elution buffer.
	<ol>
		<li>Add 10 mL of resuspension buffer from the kit to the bacteria and pipet the bacteria into the solution. Then, add 10 mL of lysis buffer from the kit to the resuspended bacteria and mix them by inverting the tube. Wait 5 min to lyse the bacteria; then, add 10 mL of ice-cold neutralization buffer from the kit to the lysed bacteria and mix them by inverting the tube.</li>
		<li>Equilibrate the DNA column from the kit with 10 mL of equilibration buffer for 5 min. Pour the samples into the DNA column filter and let the solution pass through the filter.</li>
		<li>Wash the samples 2x with 30 mL of wash buffer and, then, elute the DNA with 30 mL of elution buffer in a 15 mL conical tube. Slowly layer 10.5 mL of isopropanol at room temperature onto the eluted DNA, invert the tube, and immediately spin it at 16,200 x g for 30 min at 4 &#176;C.</li>
		<li>Remove the supernatant and add 1 mL of 70% ethanol to the DNA pellet. Resuspend the pellet by flicking the tube. Spin it at 16,200 x g for 10 min at 4 &#176;C and use a 200 &#956;L pipet tip to remove most of the ethanol. Air-dry the pellet for 5 min and resuspend it in 200 &#956;L of water, and store the DNA at -20 &#176;C. The expected concentration will be &#62;1 &#956;g/&#956;L.</li>
	</ol>
	</li>
</ol>
2. Virus Generation and Particle Count
<ol>
	<li>When ready to create the dCAS9-containing lentivirus, coat 100 mm tissue culture dishes with 5 mL of 0.01% poly-L-lysine (Supplemental Table 1). Remove the excess liquid thoroughly from the plates and let them air-dry for a few minutes in a biosafety cabinet.</li>
	<li>Plate 5 x 106 HEK 293T cells per dish in 10 mL of complete Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM) (Supplemental Table 1) and incubate them overnight at 37 &#176;C with 5% CO2. The next day, remove the medium from the HEK 293T dishes and add 10 mL of complete DMEM.</li>
	<li>Mix 6.5 &#956;g of plasmid pMDLg/pRRE containing the gag/pol (components of the virus), 3.5 &#956;g of the plasmid pMDG2.G containing the VSV-G (a component of the virus), 2.5 &#181;g of the plasmid pRSV-Rev containing Rev (a component of the virus), 10 &#956;g of an long terminal repeat (LTR)-containing gRNA vector or an LTR-containing dCas9 vector and add water to a total volume of 450 &#956;L. Filter the mixture through a 0.2 &#181;m filter tip attached to a syringe.</li>
	<li>Add 50 &#181;L of 2.5 M CaCl2 (Supplemental Table 1) to each transfection sample of DNA and mix gently. Filter the calcium/DNA mixture through a 0.2 &#181;m filter tip attached to a syringe. Pipet 500 &#181;L of 2x HBS (Supplemental Table 1) into a 5 mL polystyrene tube. Add the 500 &#181;L DNA/CaCl2 mix dropwise and gently vortex. Incubate at room temperature for 3 min.</li>
	<li>Slowly add 1 mL of the DNA/CaCl2/HBS suspension to each dish. Immediately swirl the dishes to distribute the contents evenly. Incubate each dish overnight in a 5% CO2 incubator at 37 &#176;C.</li>
	<li>On day 3, slowly remove and discard the media from the dishes. Carefully wash the cells 1x with phosphate-buffered saline (PBS). Add 6 mL of complete DMEM supplemented with 20 mM HEPES and 10 mM sodium butyrate. Incubate the cells for 5&#8211;6 h in a 5% CO2 incubator at 37 &#176;C.</li>
	<li>Wash the cells 1x with PBS and add 5 mL of complete DMEM with 20 mM HEPES to the HEK 293T cells. Incubate for 12 h overnight in a 5% CO2 incubator at 37 &#176;C.</li>
	<li>On day 4, collect the HEK 293T cell supernatants and filter the supernatant. Freeze 1 mL aliquots at -80 &#176;C.</li>
	<li>When ready to use the virus, thaw an aliquot of the viral particle containing conditioned media (stored as described in step 2.8) on ice. Bring all reagents to room temperature.</li>
	<li>Use a p24 Enzyme-Linked Immunosorbent Assay (ELISA) kit to quantify the number of viral particles per milliliter.
	<ol>
		<li>Dilute the wash concentrate from the kit by adding 19 parts of distilled deionized water. Dilute the positive control from the kit to 200 ng/mL, using RMPI 1640 as the diluent, and make the dilutions for standard curve in 1.5 mL tubes according to the p24 ELISA dilution table (Supplemental Table 2).</li>
		<li>Add 20 &#956;L of 5% Triton X-100 to all wells except the substrate blank. Add 200 &#956;L of RPMI 1640 to the negative control wells. Add 200 &#956;L of each standard (in duplicate) to the designated wells.</li>
		<li>Using a spectrophotometer, measure the concentration of the virus within the samples, using a standard curve. Start the sample dilution at 1:1,000 and modify the volume as necessary in order to be within the range of the standard curve. Dilute the samples with Triton X-100 to a final concentration of 0.5% and add 200 &#956;L of each sample in RPMI 1640 to designated wells. Seal the plate and incubate it for 2 h at 37 &#176;C.</li>
		<li>Wash the plate 6x with 300 &#956;L of 1x wash buffer per well. Remove any excess fluid by inverting the plate and tapping it on a paper towel. Add 100 &#956;L of detector antibody from the kit to all wells except the substrate blank. Seal the plate and incubate it for 1 h at 37 &#176;C. Wash the plate and, then, remove any excess fluid by inverting the plate and tapping it on a paper towel.</li>
		<li>In order to measure the detector antibody, prepare streptavidin-horseradish peroxidase (SA-HRP) within 15 min of use. Dilute the SA-HRP at 1:100 with SA-HRP diluent. Mix the diluted SA-HRP thoroughly and add 100 &#956;L to all wells except the blank. Seal and incubate the plate for 30 min at room temperature.</li>
		<li>Wash the plate with 1x wash buffer and tap away any excess liquid as in step 2.10.4. Use ortho-phenylenediamine (OPD) substrate solution, which provides the peroxidase the necessary substrates to produce chemiluminescence, within 15 min of preparation. Use one OPD tablet to 11 mL of substrate diluent for each plate.</li>
		<li>Vortex the OPD solution vigorously to dissolve it completely and protect it from light. Add 100 &#956;L of OPD substrate solution to all wells, including the blank. Using a spectrophotometer, read absorbance at 450 nm immediately, repeat this 10x at 1 s intervals, and take the average measurement.</li>
	</ol>
	</li>
</ol>
3. dCas9-VP64 Transduction
<ol>
	<li>Culture Jurkat T cells in complete DMEM in a T75 flask with a density of 2 x 106 cells in 15 mL of media. Culture the cells in a 37 &#176;C incubator with 5% CO2.</li>
	<li>Spin down the cells for 5 min at 233 x g and, then, resuspend them in 10 mL of reduced serum media. Count the cells with a hemocytometer or an automated cell counter.</li>
	<li>Resuspend and plate 1 x 106 Jurkat cells in 5 mL of reduced serum media with polybrene (Supplemental Table 1) in a T75 flask. Add HEK 293T-conditioned media containing 1 x 106 dCas9-containing viral particles. The number of viral particles can be calculated roughly from the p24 ELISA because 1 &#956;g/mL p24 equals 1 x 107 viral particles. Put the flasks in 37 &#176;C incubator with 5% CO2.</li>
</ol>
4. Selection and Clone Creation
<ol>
	<li>Three days post-infection, spin down the cells at 233 x g for 5 min and resuspend them in 10 mL of complete DMEM with puromycin (Supplemental Table 1). Plate the cells in T75 flasks and culture them at 37 &#176;C with 5% CO2. Every third day, for a period of 9 days, spin down the cells at 233 x g for 5 min and replace the media with complete DMEM with puromycin.</li>
	<li>Count the cells using a hemocytometer or an automated cell counter. On a 96-well plate treated with tissue culture, plate 10,000 cells in 100 &#956;L of complete DMEM with puromycin in the first well and serially dilute 1:1 the contents of the following wells with complete DMEM with puromycin. Perform 24 dilutions and repeat this 4x per plate in order to ensure that there is an adequate number of cells per well. Incubate the cells at 37 &#176;C with 5% CO2.</li>
	<li>Expand clonal cells into two 24-well plates, then into a 6-well plate, and eventually into a T75 flask. In order to focus on three of the clones, plate 2 x 106 cells per well of a 6-well plate for three of the clones. Plate the other three wells with nontransduced Jurkat cells as controls. Put the cells in a cell culture incubator overnight.</li>
	<li>For RNA extraction, use a commercially available RNA isolation kit. Spin down the cells at 233 x g for 5 min at room temperature and remove the media. Use a 1 mL pipet tip to resuspend the cells in 350 &#956;L of lysis buffer. Add 350 &#956;L of 70% ethanol to the lysed cells, mix thoroughly with a 1 mL pipet, and transfer the sample to the RNA column.</li>
	<li>Spin the lysates at 10,000 x g for 1 min, remove the flow-through, and add 700 &#956;L of low-stringency wash buffer from the kit to the column. Spin the lysates at 10,000 x g for 1 min, remove the flow-through, and add 80 &#181;L of DNase I solution from the kit to the column; let the samples incubate for 15 min at room temperature.</li>
	<li>Spin the lysates at 10,000 x g for 1 min, remove the flow-through, and add 700 &#181;L of high-stringency wash buffer from the kit to the column. Spin the lysates at 10,000 x g for 1 min, remove the flow-through, and add 700 &#181;L of low-stringency wash buffer to the column.</li>
	<li>Remove the column from the collection tube and transfer it to a new collection tube. Spin the lysates at 10,000 x g for 1 min and, then, transfer the RNA column to a 1.5 mL tube. Add 50 &#181;L of water to the column and spin at 10,000 x g for 1 min.</li>
	<li>Use a spectrophotometer to quantify the concentration of RNA. Expect the concentration to be between 100&#8211;500 ng/&#181;L, with a 260/280 absorbance between 1.9&#8211;2.1. Store the RNA at -80 &#176;C.</li>
	<li>In 250 &#181;L tubes, add 1 &#181;g of RNA, 4 &#181;L of complementary DNA (cDNA) synthesis buffer, 1 &#181;L of reverse transcriptase, and water to a final volume of 20 &#181;L. Include no reverse transcriptase controls. In a thermal cycler, synthesize cDNA at 42 &#176;C for 30 min and at 95 &#176;C for 5 min to inactivate the reverse transcriptase. Dilute the cDNA with 60 &#181;L of water after the synthesis.</li>
	<li>Prepare polymerase chain reactions (PCRs) containing 5 &#181;L of SYBR green, 4 &#181;L of cDNA, 0.5 &#181;L of forward primer (10 &#181;M), and 0.5 &#181;L of reverse primer (10 &#181;M). Run the PCR as follows: step 1 = 95 &#176;C for 3 min, step 2 = 95 &#176;C for 10 s, step 3 = 60 &#176;C for 10 s, and then, repeat steps 2 and 3 for 30x. 
	NOTE: The sequence for the dCas9 forward primer is 5&#39;-TCGCCACAGCATAAAGAAGA and the sequence for the dCas9 reverse primer is 5&#39;-CTTTTCATGGTACGCCACCT. The forward primer for Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) is 5&#39;-GACCAGTCAACAGGGGACAT and the reverse primer is 5&#39;-GCTTGCGACCTTGACCATCT.</li>
</ol>
5. gRNA Transduction, Selection, Clone Creation, and Screening
<ol>
	<li>Retransduce the validated Jurkat-dCas9 cells with gRNA-containing viruses as outlined in section 3. Select cells in DMEM with hygromycin (Supplemental Table 1) for 10 days. Spin down the cells and change the media every 3 days.</li>
	<li>Perform a serial dilution of cells (as described in step 4.2) and expand individual colonies (as described in step 4.3). Purify RNA from the colonies exactly as described in step 4.5 and perform cDNA synthesis as described in step 4.9. Perform real-time PCR against the GOI and HPRT1 or an appropriate housekeeping gene, similarly to the PCR described in step 4.10, except in this case, image the wells each cycle after step 3.</li>
	<li>Use the comparative cycle threshold (Ct) method to determine fold change in the GOI8. Briefly, use the following equation to calculate relative transcript levels (RTLs): 2-(average Ct of GOI &#8211; average Ct of housekeeping gene). Then, calculate the average RTL of the controls and divide all RTL values by the average control RTL to generate a fold change compared to the control samples.</li>
</ol>

<ol>
	<li>Miao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trends+of+long+noncoding+RNA+research+from+2007+to+2016:+a+bibliometric+analysis.">Trends of long noncoding RNA research from 2007 to 2016: a bibliometric analysis.</a> Oncotarget. 8 (47), 83114-83127 (2017).</li><li>Derrien, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GENCODE+v7+catalog+of+human+long+noncoding+RNAs:+analysis+of+their+gene+structure,+evolution,+and+expression.">The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression.</a> Genome Research. 22 (9), 1775-1789 (2012).</li><li>Johnsson, P., Lipovich, L., Grander, D., Morris, K. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+conservation+of+long+non-coding+RNAs;+sequence,+structure,+function.">Evolutionary conservation of long non-coding RNAs; sequence, structure, function.</a> Biochimica et Biophysica Acta. 1840 (3), 1063-1071 (2014).</li><li>Perez-Pinera, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+gene+activation+by+CRISPR-Cas9-based+transcription+factors.">RNA-guided gene activation by CRISPR-Cas9-based transcription factors.</a> Nature Methods. 10 (10), 973-976 (2013).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Maeder, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+RNA-guided+activation+of+endogenous+human+genes.">CRISPR RNA-guided activation of endogenous human genes.</a> Nature Methods. 10 (10), 977-979 (2013).</li><li>Konermann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+transcriptional+activation+by+an+engineered+CRISPR-Cas9+complex.">Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.</a> Nature. 517 (7536), 583-588 (2015).</li><li>Schmittgen, T. D., Livak, K. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyzing+real-time+PCR+data+by+the+comparative+C(T)+method.">Analyzing real-time PCR data by the comparative C(T) method.</a> Nature Protocols. 3 (6), 1101-1108 (2008).</li><li>Gomez, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+NeST+long+ncRNA+controls+microbial+susceptibility+and+epigenetic+activation+of+the+interferon-gamma+locus.">The NeST long ncRNA controls microbial susceptibility and epigenetic activation of the interferon-gamma locus.</a> Cell. 152 (4), 743-754 (2013).</li><li>Padua, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+long+noncoding+RNA+signature+for+ulcerative+colitis+identifies+IFNG-AS1+as+an+enhancer+of+inflammation.">A long noncoding RNA signature for ulcerative colitis identifies IFNG-AS1 as an enhancer of inflammation.</a> American Journal of Physiology-Gastrointestinal and Liver Physiology. 311 (3), G446-G457 (2016).</li><li>Collier, S. P., Henderson, M. A., Tossberg, J. T., Aune, T. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+the+Th1+genomic+locus+from+Ifng+through+Tmevpg1+by+T-bet.">Regulation of the Th1 genomic locus from Ifng through Tmevpg1 by T-bet.</a> Journal of Immunology. 193 (8), 3959-3965 (2014).</li><li>Kotake, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+ANRIL+is+required+for+the+PRC2+recruitment+to+and+silencing+of+p15(INK4B)+tumor+suppressor+gene.">Long non-coding RNA ANRIL is required for the PRC2 recruitment to and silencing of p15(INK4B) tumor suppressor gene.</a> Oncogene. 30 (16), 1956-1962 (2011).</li><li>Gilbert, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-Scale+CRISPR-Mediated+Control+of+Gene+Repression+and+Activation.">Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation.</a> Cell. 159 (3), 647-661 (2014).</li><li>Cheng, A. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+activation+of+endogenous+genes+by+CRISPR-on,+an+RNA-guided+transcriptional+activator+system.">Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system.</a> Cell Research. 23 (10), 1163-1171 (2013).</li><li>Matouskova, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reference+genes+for+real-time+PCR+quantification+of+messenger+RNAs+and+microRNAs+in+mouse+model+of+obesity.">Reference genes for real-time PCR quantification of messenger RNAs and microRNAs in mouse model of obesity.</a> PLoS One. 9 (1), e86033 (2014).</li></ol>

The authors have nothing to disclose.

This manuscript presents a protocol for using activating CRISPR to overexpress lncRNAs in vitro. This is an especially important technique when studying long noncoding RNAs as the transcriptomic product is the functional unit. After overexpression, the researcher can, then, use these cells to increase the signal-to-noise ratio when studying binding partners and even measure the cellular consequences of increased levels of lncRNAs. Additionally, as lncRNAs frequently act on cis-genes, this endogenous overexpression techni...

While most biomedical research has focused on protein-coding transcripts, the majority of transcribed genes actually consists of noncoding RNAs (Ensembl release 93).Current research is beginning to explore this field, with the number of publications on lncRNAs in disease processes rising exponentially between 2007 and 20171. These publications demonstrate that many lncRNAs are associated with disease. However, the molecular mechanisms of these lncRNAs are difficult to study due to their diverse functions as compared to mRNAs. Compounding the problem of understanding the role of lncRNAs in disease, lncRNAs are often expressed at lower levels than coding RNAs2. Additionally, lncRNAs are poorly conserved, which limits the functional studies in human-cell-line-based techniques3. One method to study the mechanism of these novel genes is to endogenously overexpress them in cultured cells. Overexpression studies can provide key information as to the function of specific genes and enable researchers to dissect key molecular pathways.
A new method to activate the transcription of lncRNA genes is based on CRISPR technologies developed initially by the Gersbach laboratory4. This protocol has been adapted for use in lncRNA biology and for the expression of these genes in other model systems. In the CRISPR overexpressing technique, a protein called CRISPR-associated protein 9 (Cas9) can be directed toward a DNA sequence via an antisense gRNA that is recognized by Cas9. Normally, Cas9 will induce DNA cleavage; however, mutations in Cas9, previously developed for the overexpression technique, deactivate this step5. When a transcriptional activator is fused to a &#34;dead&#34; Cas9 (dCas9) and transduced into cell lines, the endogenous overexpression of lncRNAs can be achieved4,6. The addition of additional modifications to the gRNA, enabling additional transcriptional factors to bind to the gRNA, increased the efficacy of the dCas9 gene activation system 10-fold7. Importantly, it was demonstrated that transcriptional activation requires close proximity (&#60;200 bp) to the transcriptional start site genes, enabling a specific upregulation in gene-rich areas7. Unlike CRISPR knockout technologies, dCas9 and gRNA cassettes need to be integrated into the genome to allow for cells to retain an overexpression over multiple generations. One method to achieve this is to use lentiviruses to integrate the dCas9- and gRNA-containing cassettes. After integration, the lncRNA gene expression can be determined.
In this article, a protocol for lncRNA overexpression in a Jurkat T-cell model will be demonstrated. A step-by-step procedure is shown and can also be adapted to adherent cells.

<table border="0" cellpadding="0" cellspacing="0" style="width:837px;" width="837">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:245px;">Ampicillin</td>
			<td style="width:195px;">Fisher Scientific</td>
			<td style="width:195px;">BP1760-5</td>
			<td style="width:203px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CaCl2</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">C1016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">cDNA synthesis kit (iScript)</td>
			<td style="width:195px;">BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dCas9 forward primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>5&#39;-TCGCCACAGCATAAAGAAGA&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dCas9 reverse primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>5&#39;-CTTTTCATGGTACGCCACCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dCas9 vector</td>
			<td>Addgene</td>
			<td style="width:195px;">50918</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DMEM</td>
			<td>Corning</td>
			<td style="width:195px;">10013CM</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">Ethanol</td>
			<td style="width:195px;">Acros Organics</td>
			<td style="width:195px;">61509-0010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FBS</td>
			<td>Sigma Aldrich</td>
			<td>F2442</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">gRNA plasmid</td>
			<td>VectorBuilder</td>
			<td style="width:195px;">VB180119-1195qxv</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HEK293T cells</td>
			<td>ATCC</td>
			<td style="width:195px;">&#160;CRL-1573</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">HEPES</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">H3375</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPRT1 forward primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>GACCAGTCAACAGGGGACAT&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPRT1 reverse primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>GCTTGCGACCTTGACCATCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hygromycin B</td>
			<td>Corning</td>
			<td style="width:195px;">MT3024CR</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">Isopropanol</td>
			<td style="width:195px;">Fisher Scientific</td>
			<td style="width:195px;">BP2618-500</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Jurkat cells</td>
			<td>ATCC</td>
			<td style="width:195px;">&#160;TIB-152</td>
			<td style="width:203px;">clone E6-1</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-glutamine</td>
			<td>Corning</td>
			<td style="width:195px;">25005Cl</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB agar</td>
			<td>Fisher Scientific</td>
			<td>BP1425-500</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB broth</td>
			<td>Fisher Scientific</td>
			<td>BP1426-2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Maxi-prep kit (Plasmid Purification Kit)</td>
			<td>Qiagen</td>
			<td style="width:195px;">12362</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">Na2HPO4</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">NIST2186II</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Optimem I reduced serum media&#160;</td>
			<td>Gibco</td>
			<td style="width:195px;">31985070</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">p24 elisa</td>
			<td>Perkin Elmer</td>
			<td style="width:195px;">NEK050B</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">PBS</td>
			<td style="width:195px;">Corning</td>
			<td style="width:195px;">21-040-CMR</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Penicillin and Streptomycin</td>
			<td>Corning</td>
			<td>30-002-Cl</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pMDG2.G</td>
			<td>Addgene &#160;</td>
			<td style="width:195px;">#12259</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pMDLg/pRRE</td>
			<td>Addgene&#160;</td>
			<td style="width:195px;">#60488</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Poly-L-Lysine</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">P-4832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polybrene</td>
			<td>EMD Millipore</td>
			<td style="width:195px;">TR-1003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pRSV-REV</td>
			<td>Addgene</td>
			<td style="width:195px;">#12253</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Puromycin dihydrochloride</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">P8833</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNA purification kit (Aurum RNA mini)</td>
			<td style="width:195px;">BioRad</td>
			<td>7326820</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sodium Butyrate</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">B5887</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SYBR green (iTaq universal)</td>
			<td style="width:195px;">BioRad</td>
			<td>1725122</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Triton X-100</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">X100</td>
			<td></td>
		</tr>
	</tbody>
</table>

overexpressing long noncoding rnas using gene-activating crispr

Long noncoding RNA (lncRNA) biology is a new and exciting field of research, with the number of publications from this field growing exponentially since 2007. These studies have confirmed that lncRNAs are altered in almost all diseases. However, studying the functional roles for lncRNAs in the context of disease remains difficult due to the lack of protein products, tissue-specific expression, low expression levels, complexities in splice forms, and lack of conservation among species. Given the species-specific expression, lncRNA studies are often restricted to human research contexts when studying disease processes. Since lncRNAs function at the molecular level, one way to dissect lncRNA biology is to either remove the lncRNA or overexpress the lncRNA and measure cellular effects. In this article, a written and visualized protocol to overexpress lncRNAs in vitro is presented. As a representative experiment, an lncRNA associated with inflammatory bowel disease, Interferon Gamma Antisense 1 (IFNG-AS1), is shown to be overexpressed in a Jurkat T-cell model. To accomplish this, the activating clustered regularly interspaced short palindromic repeats (CRISPR) technique is used to enable overexpression at the endogenous genomic loci. The activating CRISPR technique targets a set of transcription factors to the transcriptional start site of a gene, enabling a robust overexpression of multiple lncRNA splice forms. This procedure will be broken down into three steps, namely (i) guide RNA (gRNA) design and vector construction, (ii) virus generation and transduction, and (iii) colony screening for overexpression. For this representative experiment, a greater than 20-fold enhancement in IFNG-AS1 in Jurkat T cells was observed.

A dual vector system to overexpress the lncRNA IFNG-AS1 
The example experiment in this manuscript is the overexpression of a Jurkat T-cell model system expressing the lncRNA IFNG-AS19. IFNG-AS1 is an lncRNA associated with inflammatory bowel disease, that has been seen to regulate Interferon Gamma10. The IFNG-AS1 gene contains three splice variants that all use the same transcriptional start site (...

Watch this Scientific Journal Video about Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR at JoVE.com

Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR

Traditional cDNA-based overexpression techniques have a limited applicability for the overexpression of long noncoding RNAs due to their multiple splice forms with potential functionality. This review reports a protocol using CRISPR technology to overexpress multiple splice variants of a long noncoding RNA.

Long noncoding RNA (lncRNA) biology is a new and exciting field of research, with the number of publications from this field growing exponentially since ...

overexpressing-long-noncoding-rnas-using-gene-activating-crispr

Research

JoVE Journal

Genetics

8.8K Views.  University of California, Los Angeles. Traditional cDNA-based overexpression techniques have a limited applicability for the overexpression of long noncoding RNAs due to their multiple splice forms with potential functionality. This review reports a protocol using CRISPR technology to overexpress multiple splice variants of a long noncoding RNA.

Video: Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR

Sequence-specific and Selective Recognition of Double-stranded RNAs over Single-stranded RNAs by Chemically Modified Peptide Nucleic Acids

RNAs are emerging as important biomarkers and therapeutic targets. Thus, there is great potential in developing chemical probes and therapeutic ligands for the recognition of RNA sequence and structure. Chemically modified Peptide Nucleic Acid (PNA) oligomers have been recently developed that can recognize RNA duplexes in a sequence-specific manner. PNAs are chemically stable with a neutral peptide-like backbone. PNAs can be synthesized relatively easily by the manual Boc-chemistry solid-phase peptide synthesis method. PNAs are purified by reverse-phase HPLC, followed by molecular weight characterization by matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF). Non-denaturing polyacrylamide gel electrophoresis (PAGE) technique facilitates the imaging of the triplex formation, because carefully designed free RNA duplex constructs and PNA bound triplexes often show different migration rates. Non-denaturing PAGE with ethidium bromide post staining is often an easy and informative technique for characterizing the binding affinities and specificities of PNA oligomers. Typically, multiple RNA hairpins or duplexes with single base pair mutations can be used to characterize PNA binding properties, such as binding affinities and specificities. 2-Aminopurine is an isomer of adenine (6-aminopurine); the 2-aminopurine fluorescence intensity is sensitive to local structural environment changes, and is suitable for the monitoring of triplex formation with the 2-aminopurine residue incorporated near the PNA binding site. 2-Aminopurine fluorescence titration can also be used to confirm the binding selectivity of modified PNAs towards targeted double-stranded RNAs (dsRNAs) over single-stranded RNAs (ssRNAs). UV-absorbance-detected thermal melting experiments allow the measurement of the thermal stability of PNA-RNA duplexes and PNA&#183;RNA2 triplexes. Here, we describe the synthesis and purification of PNA oligomers incorporating modified residues, and describe biochemical and biophysical methods for characterization of the recognition of RNA duplexes by the modified PNAs.

We report the protocols for the synthesis and purification of Peptide Nucleic Acid (PNA) oligomers incorporating modified residues. The biochemical and biophysical methods for the characterization of the recognition of RNA duplexes by the modified PNAs are described.

RNAs are emerging as important biomarkers and therapeutic targets. Thus, there is great potential in developing chemical probes and therapeutic ligands ...

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration of transgenes. However, due to the low efficiency of homologous recombination (HR) and various indel mutations of non-homologous end joining (NHEJ)-based strategies in non-dividing cells, in vivo genome editing remains a great challenge. Here, we describe a homology-mediated end joining (HMEJ)-based CRISPR/Cas9 system for efficient in vivo precise targeted integration. In this system, the targeted genome and the donor vector containing homology arms (~800 bp) flanked by single guide RNA (sgRNA) target sequences are cleaved by CRISPR/Cas9. This HMEJ-based strategy achieves efficient transgene integration in mouse zygotes, as well as in hepatocytes in vivo. Moreover, a HMEJ-based strategy offers an efficient approach for correction of fumarylacetoacetate hydrolase (Fah) mutation in the hepatocytes and rescues Fah-deficiency induced liver failure mice. Taken together, focusing on targeted integration, this HMEJ-based strategy provides a promising tool for a variety of applications, including generation of genetically modified animal models and targeted gene therapies.

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system provides a promising tool for genetic engineering, and opens up the possibility of targeted integration of transgenes. We describe a homology-mediated end joining (HMEJ)-based strategy for efficient DNA targeted integration in vivo and targeted gene therapies using CRISPR/Cas9.

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

Metabolic Labeling and Profiling of Transfer RNAs Using Macroarrays

Transfer RNAs (tRNA) are abundant short non-coding RNA species that are typically 76 to 90 nucleotides in length. tRNAs are directly responsible for protein synthesis by translating codons in mRNA into amino acid sequences. tRNAs were long considered as house-keeping molecules that lacked regulatory functions. However, a growing body of evidence indicates that cellular tRNA levels fluctuate in correspondence to varying conditions such as cell type, environment, and stress. The fluctuation of tRNA expression directly influences gene translation, favoring or repressing the expression of particular proteins. Ultimately comprehending the dynamic of protein synthesis requires the development of methods able to deliver high-quality tRNA profiles. The method that we present here is named SPOt, which stands for Streamlined Platform for Observing tRNA. SPOt consists of three steps starting with metabolic labeling of cell cultures with radioactive orthophosphate, followed by guanidinium thiocyanate-phenol-chloroform extraction of radioactive total RNAs and finally hybridization on in-house printed macroarrays. tRNA levels are estimated by quantifying the radioactivity intensities at each probe spot. In the protocol presented here we profile tRNAs in Mycobacterium smegmatis mc2155, a nonpathogenic bacterium often used as a model organism to study tuberculosis.

We describe an original transfer RNA analysis platform named SPOt (Streamlined Platform for Observing tRNA). SPOt simultaneously measures cellular levels of all tRNAs in biological samples, in only three steps, and in less than 24 hours.

Transfer RNAs (tRNA) are abundant short non-coding RNA species that are typically 76 to 90 nucleotides in length. tRNAs are directly responsible for ...

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been co-opted as a powerful tool for precise eukaryotic genome engineering. Here, we present a rapid and simple method using chimeric single guide RNAs (sgRNA) and CRISPR-Cas9 Ribonucleoproteins (RNPs) for the efficient and precise generation of genomic point mutations in C. elegans. We describe a pipeline for sgRNA target selection, homology-directed repair (HDR) template design, CRISPR-Cas9-RNP complexing and delivery, and a genotyping strategy that enables the robust and rapid identification of correctly edited animals. Our approach not only permits the facile generation and identification of desired genomic point mutant animals, but also facilitates the detection of other complex indel alleles in approximately 4 - 5 days with high efficiency and a reduced screening workload.

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

Here, we present a method to engineer the genome of C. elegans using CRISPR-Cas9 ribonucleoproteins and homology dependent repair templates.

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been ...

Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines

Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these enhancers combine to produce a transcriptional response. As millions of enhancers have been identified, high-throughput tools are needed to determine enhancer function on a genome-wide scale. Current methods for studying enhancer function include making genetic deletions using nuclease-proficient Cas9, but it is difficult to study the combinatorial effects of multiple enhancers using this technique, as multiple successive clonal cell lines must be generated. Here, we present Enhancer-i, a CRISPR interference-based method that allows for functional interrogation of multiple enhancers simultaneously at their endogenous loci. Enhancer-i makes use of two repressive domains fused to nuclease-deficient Cas9, SID and KRAB, to achieve enhancer deactivation via histone deacetylation at targeted loci. This protocol utilizes transient transfection of guide RNAs to enable transient inactivation of targeted regions and is particularly effective at blocking inducible transcriptional responses to stimuli in tissue culture settings. Enhancer-i is highly specific both in its genomic targeting and its effects on global gene expression. Results obtained from this protocol help to understand whether an enhancer is contributing to gene expression, the magnitude of the contribution, and how the contribution is affected by other nearby enhancers.

This protocol describes the steps needed to design and perform multiplexed targeting of enhancers with the deactivating fusion protein SID4X-dCas9-KRAB, also known as enhancer interference (Enhancer-i). This protocol enables the identification of enhancers that regulate gene expression and facilitates the dissection of relationships between enhancers regulating a common target gene.

Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or C-terminal fluorescent tags. The prokaryotic CRISPR/Cas9 system (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) may be used to introduce large exogenous sequences into genomic loci via homology directed repair (HDR). To achieve the desired knock-in, this protocol employs the ribonucleoprotein (RNP)-based approach where wild type Streptococcus pyogenes Cas9 protein, synthetic 2-part guide RNA (gRNA), and a donor template plasmid are delivered to the cells via electroporation. Putatively edited cells expressing the fluorescently tagged proteins are enriched by fluorescence activated cell sorting (FACS). Clonal lines are then generated and can be analyzed for precise editing outcomes. By introducing the fluorescent tag at the genomic locus of the gene of interest, the resulting subcellular localization and dynamics of the fusion protein can be studied under endogenous regulatory control, a key improvement over conventional overexpression systems. The use of hiPSCs as a model system for gene tagging provides the opportunity to study the tagged proteins in diploid, nontransformed cells. Since hiPSCs can be differentiated into multiple cell types, this approach provides the opportunity to create and study tagged proteins in a variety of isogenic cellular contexts.

Described here is a protocol for tagging endogenously expressed proteins with fluorescent tags in human induced pluripotent stem cells using CRISPR/Cas9. Putatively edited cells are enriched by fluorescence activated cell sorting and clonal cell lines are generated.

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been successfully repurposed for genome engineering in many different living organisms. Most commonly, the wildtype CRISPR associated 9 (Cas9) or Cas12a endonuclease is used to cleave specific sites in the genome, after which the DNA double-stranded break is repaired via the non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway depending on whether a donor template is absent or present respectively. To date, CRISPR systems from different bacterial species have been shown to be capable of performing genome editing in mammalian cells. However, despite the apparent simplicity of the technology, multiple design parameters need to be considered, which often leave users perplexed about how best to carry out their genome editing experiments. Here, we describe a complete workflow from experimental design to identification of cell clones that carry desired DNA modifications, with the goal of facilitating successful execution of genome editing experiments in mammalian cell lines. We highlight key considerations for users to take note of, including the choice of CRISPR system, the spacer length, and the design of a single-stranded oligodeoxynucleotide (ssODN) donor template. We envision that this workflow will be useful for gene knockout studies, disease modeling efforts, or the generation of reporter cell lines.

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target against T. cruzi, it is important to validate the essentiality of the target gene in the mammalian stage of the parasite, the amastigote. Amastigotes of T. cruzi replicate inside the host cell; thus, it is difficult to conduct a knockout experiment without going through other developmental stages. Recently, our group reported a growth condition in which the amastigote can replicate axenically for up to 10 days without losing its amastigote-like properties. By using this temporal axenic amastigote culture, we successfully introduced gRNAs directly into the Cas9-expressing amastigote to cause gene knockouts and analyzed their phenotypes exclusively in the amastigote stage. In this report, we describe a detailed protocol to produce in vitro derived extracellular amastigotes, and to utilize the axenic culture in a CRISPR/Cas9-mediated knockout experiment. The growth phenotype of knockout amastigotes can be evaluated either by cell counts of the axenic culture, or by replication of intracellular amastigote after host cell invasion. This method bypasses the parasite stage differentiation normally involved in producing a transgenic or a knockout amastigote. Utilization of the temporal axenic amastigote culture has the potential to expand the experimental freedom of stage-specific studies in T. cruzi.

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Here, we describe a protocol to introduce a gene knockout into the extracellular amastigote of Trypanosoma cruzi, using the CRISPR/Cas9 system. The growth phenotype can be followed up either by cell counting of axenic amastigote culture or by proliferation of intracellular amastigotes after host cell invasion.

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target ...

Identification of Circular RNAs using RNA Sequencing

Circular RNAs (circRNAs) are a class of non-coding RNAs involved in functions including micro-RNA (miRNA) regulation, mediation of protein-protein interactions, and regulation of parental gene transcription. In classical next generation RNA sequencing (RNA-seq), circRNAs are typically overlooked as a result of poly-A selection during construction of mRNA libraries, or are found at very low abundance, and are therefore difficult to isolate and detect. Here, a circRNA library construction protocol was optimized by comparing library preparation kits, pre-treatment options and various total RNA input amounts. Two commercially available whole transcriptome library preparation kits, with and without RNase R pre-treatment, and using variable amounts of total RNA input (1 to 4 &#181;g), were tested. Lastly, multiple tissue types; including liver, lung, lymph node, and pancreas; as well as multiple brain regions; including the cerebellum, inferior parietal lobe, middle temporal gyrus, occipital cortex, and superior frontal gyrus; were compared to evaluate circRNA abundance across tissue types. Analysis of the generated RNA-seq data using six different circRNA detection tools (find_circ, CIRI, Mapsplice, KNIFE, DCC, and CIRCexplorer) revealed that a stranded total RNA library preparation kit with RNase R pre-treatment and 4 &#181;g RNA input is the optimal method for identifying the highest relative number of circRNAs. Consistent with previous findings, the highest enrichment of circRNAs was observed in brain tissues compared to other tissue types.

Circular RNAs (circRNAs) are non-coding RNAs that may have roles in transcriptional regulation and mediating interactions between proteins. Following assessment of different parameters for construction of circRNA sequencing libraries, a protocol was compiled utilizing stranded total RNA library preparation with RNase R pre-treatment and is presented here.

Circular RNAs (circRNAs) are a class of non-coding RNAs involved in functions including micro-RNA (miRNA) regulation, mediation of protein-protein ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...