Name: overexpressing long noncoding rnas using gene-activating crispr
Uploaded: 2019-03-01T15:00:00
Description: Watch this Scientific Journal Video about Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR at JoVE.com

C.P. is supported by RO1 DK60729 and P30 DK 41301-26. D.P. is supported by a Crohn&#39;s &#38; Colitis Foundation (CCFA) career development award, CURE: Digestive Diseases Research Center (DDRC) DK41301, and UCLA Clinical and Translational Science Institute (CTSI) UL1TR0001881. The UCLA virology core was funded by the Center of AIDS Research (CFAR) grant 5P30 AI028697. The UCLA Integrated Molecular Technologies core was supported by CURE/P30 grant DK041301. This work was also supported by the UCLA AIDS Institute.

NOTE: It is important to note that this protocol uses replication-deficient lentiviruses. Perform viral handling only after appropriate lab safety training. Bleach all items and surfaces that come in contact with live viruses for a minimum of 10 min after handling. Use a disposable lab coat and face/eye protection, as well as double gloves, at all times. Perform virus work in biosafety level 2+ labs with viral certification. Dedicate tissue culture hoods and incubators to viral work.
<p class="jove_t...

<ol>
	<li>Miao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trends+of+long+noncoding+RNA+research+from+2007+to+2016:+a+bibliometric+analysis.">Trends of long noncoding RNA research from 2007 to 2016: a bibliometric analysis.</a> Oncotarget. 8 (47), 83114-83127 (2017).</li><li>Derrien, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GENCODE+v7+catalog+of+human+long+noncoding+RNAs:+analysis+of+their+gene+structure,+evolution,+and+expression.">The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression.</a> Genome Research. 22 (9), 1775-1789 (2012).</li><li>Johnsson, P., Lipovich, L., Grander, D., Morris, K. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+conservation+of+long+non-coding+RNAs;+sequence,+structure,+function.">Evolutionary conservation of long non-coding RNAs; sequence, structure, function.</a> Biochimica et Biophysica Acta. 1840 (3), 1063-1071 (2014).</li><li>Perez-Pinera, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+gene+activation+by+CRISPR-Cas9-based+transcription+factors.">RNA-guided gene activation by CRISPR-Cas9-based transcription factors.</a> Nature Methods. 10 (10), 973-976 (2013).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Maeder, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+RNA-guided+activation+of+endogenous+human+genes.">CRISPR RNA-guided activation of endogenous human genes.</a> Nature Methods. 10 (10), 977-979 (2013).</li><li>Konermann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+transcriptional+activation+by+an+engineered+CRISPR-Cas9+complex.">Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.</a> Nature. 517 (7536), 583-588 (2015).</li><li>Schmittgen, T. D., Livak, K. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyzing+real-time+PCR+data+by+the+comparative+C(T)+method.">Analyzing real-time PCR data by the comparative C(T) method.</a> Nature Protocols. 3 (6), 1101-1108 (2008).</li><li>Gomez, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+NeST+long+ncRNA+controls+microbial+susceptibility+and+epigenetic+activation+of+the+interferon-gamma+locus.">The NeST long ncRNA controls microbial susceptibility and epigenetic activation of the interferon-gamma locus.</a> Cell. 152 (4), 743-754 (2013).</li><li>Padua, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+long+noncoding+RNA+signature+for+ulcerative+colitis+identifies+IFNG-AS1+as+an+enhancer+of+inflammation.">A long noncoding RNA signature for ulcerative colitis identifies IFNG-AS1 as an enhancer of inflammation.</a> American Journal of Physiology-Gastrointestinal and Liver Physiology. 311 (3), G446-G457 (2016).</li><li>Collier, S. P., Henderson, M. A., Tossberg, J. T., Aune, T. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+the+Th1+genomic+locus+from+Ifng+through+Tmevpg1+by+T-bet.">Regulation of the Th1 genomic locus from Ifng through Tmevpg1 by T-bet.</a> Journal of Immunology. 193 (8), 3959-3965 (2014).</li><li>Kotake, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+ANRIL+is+required+for+the+PRC2+recruitment+to+and+silencing+of+p15(INK4B)+tumor+suppressor+gene.">Long non-coding RNA ANRIL is required for the PRC2 recruitment to and silencing of p15(INK4B) tumor suppressor gene.</a> Oncogene. 30 (16), 1956-1962 (2011).</li><li>Gilbert, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-Scale+CRISPR-Mediated+Control+of+Gene+Repression+and+Activation.">Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation.</a> Cell. 159 (3), 647-661 (2014).</li><li>Cheng, A. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+activation+of+endogenous+genes+by+CRISPR-on,+an+RNA-guided+transcriptional+activator+system.">Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system.</a> Cell Research. 23 (10), 1163-1171 (2013).</li><li>Matouskova, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reference+genes+for+real-time+PCR+quantification+of+messenger+RNAs+and+microRNAs+in+mouse+model+of+obesity.">Reference genes for real-time PCR quantification of messenger RNAs and microRNAs in mouse model of obesity.</a> PLoS One. 9 (1), e86033 (2014).</li></ol>

This manuscript presents a protocol for using activating CRISPR to overexpress lncRNAs in vitro. This is an especially important technique when studying long noncoding RNAs as the transcriptomic product is the functional unit. After overexpression, the researcher can, then, use these cells to increase the signal-to-noise ratio when studying binding partners and even measure the cellular consequences of increased levels of lncRNAs. Additionally, as lncRNAs frequently act on cis-genes, this endogenous overexpression techni...

While most biomedical research has focused on protein-coding transcripts, the majority of transcribed genes actually consists of noncoding RNAs (Ensembl release 93).Current research is beginning to explore this field, with the number of publications on lncRNAs in disease processes rising exponentially between 2007 and 20171. These publications demonstrate that many lncRNAs are associated with disease. However, the molecular mechanisms of these lncRNAs are difficult to study due to their diverse functions as compared to mRNAs. Compounding the problem of understanding the role of lncRNAs in disease, lncRNAs are often expressed at lower levels than coding RNAs2. Additionally, lncRNAs are poorly conserved, which limits the functional studies in human-cell-line-based techniques3. One method to study the mechanism of these novel genes is to endogenously overexpress them in cultured cells. Overexpression studies can provide key information as to the function of specific genes and enable researchers to dissect key molecular pathways.
A new method to activate the transcription of lncRNA genes is based on CRISPR technologies developed initially by the Gersbach laboratory4. This protocol has been adapted for use in lncRNA biology and for the expression of these genes in other model systems. In the CRISPR overexpressing technique, a protein called CRISPR-associated protein 9 (Cas9) can be directed toward a DNA sequence via an antisense gRNA that is recognized by Cas9. Normally, Cas9 will induce DNA cleavage; however, mutations in Cas9, previously developed for the overexpression technique, deactivate this step5. When a transcriptional activator is fused to a &#34;dead&#34; Cas9 (dCas9) and transduced into cell lines, the endogenous overexpression of lncRNAs can be achieved4,6. The addition of additional modifications to the gRNA, enabling additional transcriptional factors to bind to the gRNA, increased the efficacy of the dCas9 gene activation system 10-fold7. Importantly, it was demonstrated that transcriptional activation requires close proximity (&#60;200 bp) to the transcriptional start site genes, enabling a specific upregulation in gene-rich areas7. Unlike CRISPR knockout technologies, dCas9 and gRNA cassettes need to be integrated into the genome to allow for cells to retain an overexpression over multiple generations. One method to achieve this is to use lentiviruses to integrate the dCas9- and gRNA-containing cassettes. After integration, the lncRNA gene expression can be determined.
In this article, a protocol for lncRNA overexpression in a Jurkat T-cell model will be demonstrated. A step-by-step procedure is shown and can also be adapted to adherent cells.

<table border="0" cellpadding="0" cellspacing="0" style="width:837px;" width="837">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:245px;">Ampicillin</td>
			<td style="width:195px;">Fisher Scientific</td>
			<td style="width:195px;">BP1760-5</td>
			<td style="width:203px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CaCl2</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">C1016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">cDNA synthesis kit (iScript)</td>
			<td style="width:195px;">BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dCas9 forward primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>5&#39;-TCGCCACAGCATAAAGAAGA&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dCas9 reverse primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>5&#39;-CTTTTCATGGTACGCCACCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dCas9 vector</td>
			<td>Addgene</td>
			<td style="width:195px;">50918</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DMEM</td>
			<td>Corning</td>
			<td style="width:195px;">10013CM</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">Ethanol</td>
			<td style="width:195px;">Acros Organics</td>
			<td style="width:195px;">61509-0010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FBS</td>
			<td>Sigma Aldrich</td>
			<td>F2442</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">gRNA plasmid</td>
			<td>VectorBuilder</td>
			<td style="width:195px;">VB180119-1195qxv</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HEK293T cells</td>
			<td>ATCC</td>
			<td style="width:195px;">&#160;CRL-1573</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">HEPES</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">H3375</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPRT1 forward primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>GACCAGTCAACAGGGGACAT&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPRT1 reverse primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>GCTTGCGACCTTGACCATCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hygromycin B</td>
			<td>Corning</td>
			<td style="width:195px;">MT3024CR</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">Isopropanol</td>
			<td style="width:195px;">Fisher Scientific</td>
			<td style="width:195px;">BP2618-500</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Jurkat cells</td>
			<td>ATCC</td>
			<td style="width:195px;">&#160;TIB-152</td>
			<td style="width:203px;">clone E6-1</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-glutamine</td>
			<td>Corning</td>
			<td style="width:195px;">25005Cl</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB agar</td>
			<td>Fisher Scientific</td>
			<td>BP1425-500</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB broth</td>
			<td>Fisher Scientific</td>
			<td>BP1426-2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Maxi-prep kit (Plasmid Purification Kit)</td>
			<td>Qiagen</td>
			<td style="width:195px;">12362</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">Na2HPO4</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">NIST2186II</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Optimem I reduced serum media&#160;</td>
			<td>Gibco</td>
			<td style="width:195px;">31985070</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">p24 elisa</td>
			<td>Perkin Elmer</td>
			<td style="width:195px;">NEK050B</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">PBS</td>
			<td style="width:195px;">Corning</td>
			<td style="width:195px;">21-040-CMR</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Penicillin and Streptomycin</td>
			<td>Corning</td>
			<td>30-002-Cl</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pMDG2.G</td>
			<td>Addgene &#160;</td>
			<td style="width:195px;">#12259</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pMDLg/pRRE</td>
			<td>Addgene&#160;</td>
			<td style="width:195px;">#60488</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Poly-L-Lysine</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">P-4832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polybrene</td>
			<td>EMD Millipore</td>
			<td style="width:195px;">TR-1003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pRSV-REV</td>
			<td>Addgene</td>
			<td style="width:195px;">#12253</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Puromycin dihydrochloride</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">P8833</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNA purification kit (Aurum RNA mini)</td>
			<td style="width:195px;">BioRad</td>
			<td>7326820</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sodium Butyrate</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">B5887</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SYBR green (iTaq universal)</td>
			<td style="width:195px;">BioRad</td>
			<td>1725122</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Triton X-100</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">X100</td>
			<td></td>
		</tr>
	</tbody>
</table>

overexpressing long noncoding rnas using gene-activating crispr

Long noncoding RNA (lncRNA) biology is a new and exciting field of research, with the number of publications from this field growing exponentially since 2007. These studies have confirmed that lncRNAs are altered in almost all diseases. However, studying the functional roles for lncRNAs in the context of disease remains difficult due to the lack of protein products, tissue-specific expression, low expression levels, complexities in splice forms, and lack of conservation among species. Given the species-specific expression, lncRNA studies are often restricted to human research contexts when studying disease processes. Since lncRNAs function at the molecular level, one way to dissect lncRNA biology is to either remove the lncRNA or overexpress the lncRNA and measure cellular effects. In this article, a written and visualized protocol to overexpress lncRNAs in vitro is presented. As a representative experiment, an lncRNA associated with inflammatory bowel disease, Interferon Gamma Antisense 1 (IFNG-AS1), is shown to be overexpressed in a Jurkat T-cell model. To accomplish this, the activating clustered regularly interspaced short palindromic repeats (CRISPR) technique is used to enable overexpression at the endogenous genomic loci. The activating CRISPR technique targets a set of transcription factors to the transcriptional start site of a gene, enabling a robust overexpression of multiple lncRNA splice forms. This procedure will be broken down into three steps, namely (i) guide RNA (gRNA) design and vector construction, (ii) virus generation and transduction, and (iii) colony screening for overexpression. For this representative experiment, a greater than 20-fold enhancement in IFNG-AS1 in Jurkat T cells was observed.

A dual vector system to overexpress the lncRNA IFNG-AS1 
The example experiment in this manuscript is the overexpression of a Jurkat T-cell model system expressing the lncRNA IFNG-AS19. IFNG-AS1 is an lncRNA associated with inflammatory bowel disease, that has been seen to regulate Interferon Gamma10. The IFNG-AS1 gene contains three splice variants that all use the same transcriptional start site (...

Watch this Scientific Journal Video about Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR at JoVE.com

Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR

Traditional cDNA-based overexpression techniques have a limited applicability for the overexpression of long noncoding RNAs due to their multiple splice forms with potential functionality. This review reports a protocol using CRISPR technology to overexpress multiple splice variants of a long noncoding RNA.

Long noncoding RNA (lncRNA) biology is a new and exciting field of research, with the number of publications from this field growing exponentially since ...

Research

JoVE Journal

Genetics

Sequence-specific and Selective Recognition of Double-stranded RNAs over Single-stranded RNAs by Chemically Modified Peptide Nucleic Acids

RNAs are emerging as important biomarkers and therapeutic targets. Thus, there is great potential in developing chemical probes and therapeutic ligands ...

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

Metabolic Labeling and Profiling of Transfer RNAs Using Macroarrays

Transfer RNAs (tRNA) are abundant short non-coding RNA species that are typically 76 to 90 nucleotides in length. tRNAs are directly responsible for ...

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been ...

Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines

Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these ...

CRISPR Guide RNA Cloning for Mammalian Systems

The outlined protocol describes streamlined methods for the efficient and cost-effective generation of Cas9-associated guide RNAs. Two alternative ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target ...