This work was supported by the following awards to BHS: Human Frontiers Science Program; NIH NIGMS (R01 GM113967); NSF Ideas Lab (1556337). The peptide and antibodies for DmGluRA were designed in the laboratory Dr. Serge Birman (Marseille, Luminy, France) when IS was supported by Programme d&#39;Urgence FRM/Postdocs UFP20060306548 from the Fondation pour la Recherche Medicale. We are thankful for Daniela Junqueira Marosi and Alex Hanter from Integrated DNA Technology (IDT) for the help with the design of RDL guides and qPCR drop-off assays.

<ol>
	<li>Harms, D. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+Genome+Editing+Using+the+CRISPR/Cas+System.">Mouse Genome Editing Using the CRISPR/Cas System.</a> Current Protocols in Human Genetics. 83 (15), 7-27 (2014).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Kouranova, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRs+for+Optimal+Targeting:+Delivery+of+CRISPR+Components+as+DNA,+RNA,+and+Protein+into+Cultured+Cells+and+Single-Cell+Embryos.">CRISPRs for Optimal Targeting: Delivery of CRISPR Components as DNA, RNA, and Protein into Cultured Cells and Single-Cell Embryos.</a> Human Gene Therapy. 27 (6), 464-475 (2016).</li><li>Schubert, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescently+labeled+tracrRNA+provides+efficient+genome+editing+while+allowing+cellular+microscopy+and+FACS+analysis.">Fluorescently labeled tracrRNA provides efficient genome editing while allowing cellular microscopy and FACS analysis.</a> Genome Editing. , 1-3 (2017).</li><li>Kucharski, R., Mitri, C., Grau, Y., Maleszka, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+metabotropic+glutamate+receptor+in+the+honeybee+(Apis+mellifera):+implications+for+memory+formation.">Characterization of a metabotropic glutamate receptor in the honeybee (Apis mellifera): implications for memory formation.</a> Invertebrate Neuroscience. 7 (2), 99-108 (2007).</li><li>Aronstein, K., Auld, V., Ffrench-Constant, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+two+GABA+receptor-like+subunits+in+the+Drosophila+CNS.">Distribution of two GABA receptor-like subunits in the Drosophila CNS.</a> Invertebrate Neuroscience. 2 (2), 115-120 (1996).</li><li>Thompson, M., Steichen, J. C., ffrench-Constant, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservation+of+cyclodiene+insecticide+resistance-associated+mutations+in+insects.">Conservation of cyclodiene insecticide resistance-associated mutations in insects.</a> Insect Molecular Biology. 2 (3), 149-154 (1993).</li><li>Chung, B. Y., Kilman, V. L., Keath, J. R., Pitman, J. L., Allada, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GABA(A)+receptor+RDL+acts+in+peptidergic+PDF+neurons+to+promote+sleep+in+Drosophila.">The GABA(A) receptor RDL acts in peptidergic PDF neurons to promote sleep in Drosophila.</a> Current Biology. 19 (5), 386-390 (2009).</li><li>Taylor-Wells, J., Hawkins, J., Colombo, C., Bermudez, I., Jones, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+functional+expression+of+intracellular+loop+variants+of+the+honeybee+(Apis+mellifera)+RDL+GABA+receptor.">Cloning and functional expression of intracellular loop variants of the honeybee (Apis mellifera) RDL GABA receptor.</a> Neurotoxicology. 60, 207-213 (2017).</li><li>Jones, A. K., Sattelle, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cys-loop+ligand-gated+ion+channel+superfamily+of+the+honeybee,+Apis+mellifera.">The cys-loop ligand-gated ion channel superfamily of the honeybee, Apis mellifera.</a> Invertebrate Neuroscience. 6 (3), 123-132 (2006).</li><li>Dupuis, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homomeric+RDL+and+heteromeric+RDL/LCCH3+GABA+receptors+in+the+honeybee+antennal+lobes:+two+candidates+for+inhibitory+transmission+in+olfactory+processing.">Homomeric RDL and heteromeric RDL/LCCH3 GABA receptors in the honeybee antennal lobes: two candidates for inhibitory transmission in olfactory processing.</a> Journal of Neurophysiology. 103 (1), 458-468 (2010).</li><li>Farooqui, T., Robinson, K., Vaessin, H., Smith, B. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+early+olfactory+processing+by+an+octopaminergic+reinforcement+pathway+in+the+honeybee.">Modulation of early olfactory processing by an octopaminergic reinforcement pathway in the honeybee.</a> Journal of Neuroscience. 23 (12), 5370-5380 (2003).</li><li>Guo, X., Wang, Y., Sinakevitch, I., Lei, H., Smith, B. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+RNAi+knockdown+effect+of+tyramine+receptor+1+induced+by+dsRNA+and+siRNA+in+brains+of+the+honeybee,+Apis+mellifera.">Comparison of RNAi knockdown effect of tyramine receptor 1 induced by dsRNA and siRNA in brains of the honeybee, Apis mellifera.</a> Journal of Insect Physiology. 111, 47-52 (2018).</li><li>Roth, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+switch+for+worker+nutrition-mediated+traits+in+honeybees.">A genetic switch for worker nutrition-mediated traits in honeybees.</a> PLOS Biology. 17 (3), e3000171 (2019).</li><li>Kohno, H., Suenami, S., Takeuchi, H., Sasaki, T., Kubo, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+Knockout+Mutants+by+CRISPR/Cas9+in+the+European+Honeybee,+Apis+mellifera+L.">Production of Knockout Mutants by CRISPR/Cas9 in the European Honeybee, Apis mellifera L.</a> Zoological Science (BIOONE). 33 (5), 505-512 (2016).</li><li>Hu, X. F., Zhang, B., Liao, C. H., Zeng, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-Efficiency+CRISPR/Cas9-Mediated+Gene+Editing+in+Honeybee+Apis+mellifera+Embryos.">High-Efficiency CRISPR/Cas9-Mediated Gene Editing in Honeybee Apis mellifera Embryos.</a> G3: Genes, Genomes, Genetics. 9 (5), 1759-1766 (2019).</li><li>Smith, B. H., Burden, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Proboscis+Extension+Response+Protocol+for+Investigating+Behavioral+Plasticity+in+Insects:+Application+to+Basic,+Biomedical,+and+Agricultural+Research.">A Proboscis Extension Response Protocol for Investigating Behavioral Plasticity in Insects: Application to Basic, Biomedical, and Agricultural Research.</a> Journal of Visualized Experiments. (91), e51057 (2014).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Rodriguez, J., Deinhardt, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+a+semipermanent+mounting+medium+for+fluorescent+antibody+studies.">Preparation of a semipermanent mounting medium for fluorescent antibody studies.</a> Virology. 12, 316-317 (1960).</li><li>. Custom Alt-R&#174; CRISPR-Cas9 guide RNA Available from: <a target="_blank" href="https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM">https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM</a> (2019)</li><li>Bonnafe, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+a+thymol+application+on+olfactory+memory+and+gene+expression+levels+in+the+brain+of+the+honeybee+Apis+mellifera.">Effect of a thymol application on olfactory memory and gene expression levels in the brain of the honeybee Apis mellifera.</a> Environmental Science and Pollutant Research (International). 22 (11), 8022-8030 (2015).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+behaviorally+associated+gene+networks+in+worker+honeybee+ovaries.">Regulation of behaviorally associated gene networks in worker honeybee ovaries.</a> Journal of Experimental Biology. 215 (Pt 1), 124-134 (2012).</li></ol>

The authors have nothing to disclose.

Characterization of the anti-RDL and anti-mGlutR1 
First, we characterized the anti-RDL and anti-mGlutR1 antibodies by immunoblot and pre-adsorption on the slices of fixed honeybee brains. Each antibody was made to recognize all its known isoforms, and Western analysis show they recognize bands that correspond to their predicted molecular weights. Next, both antibodies were blocked by the conjugated peptide against which they were produced on honeybee brain sections.
One of the first aims in our study was to establish that the antibodies produced against the specific conjugated peptide are specific to its protein in fixed brain tissue. For that purpose, we took advantage of the CRISPR-Cas9 system. We designed specific guides for honeybee RDL and mGlutR1 and used each of them to make CRISPR-Cas9 labeled with the fluorescent probe ATTO550. For each receptor, we injected a mixture of three different CRISPR-Cas9 ribonucleoproteins in the ocelli to reduce the amount of the targeted protein in the adult honeybee brain by eliminating the corresponding gene in cells that took up our designed Cas9 system. In our study, we accomplished this step.
One of the first crucial steps for the success of these experiments is designing the appropriate guide RNAs. We recommend designing up to five guide RNAs, located at the beginning, middle, and the end of the gene sequence. In our preliminary work, we tested them in various combinations on three to five bees. We also tried different concentrations of injections, as well as times after injection, and various mixtures of RNP in the injections. We dissected out brains and processed them using anti-RDL and anti-mGlutR1 antibodies. In these initial tests, we established the appropriate combination, post-injection time, as well as the concentration and amount of CRISPR-Cas9 for injection. These initial tests were the basis for setting up the experiments that we described in detail here.
The aim was two-fold: 1) to demonstrate in a bee that our antibody staining was reduced after treatment with CRISPR-Cas9 and 2) to work through the best experimental conditions for behavioral studies. Thus, we show that if many cell nuclei contain CRISPR-Cas9 48 h after injection, the reduction of the anti-RDL and anti-mGlutR1 staining is significant. Additionally, that demonstrates that the tested antibodies specifically recognize the mGlut1 and RDL protein in the honeybee brain preparation and that they can be used for localization studies in the honeybee brain.
Experimental setting CRISPR-Cas9 for behavioral study 
Next, we set up the experiments so that CRISPR-Cas9 could be used in behavioral studies. Eight or nine honeybees were collected for control and experimental treatments. They were behaviorally tested before and after injection, and then their brains were processed for ATTO550 and/or immunocytochemistry to determine the brain regions that showed reduction of the target protein. Here it is essential to note that the number of bees taken for one set of experiments was limited to no more than 8-9 bees for the control and experimental conditions. This way both conditions could be tested on the same day. Also, once we prepared the CRISPR-Cas9 mixtures for injection, we never froze them. The CRISPR-Cas9 mixture did not change in potency when used 3 days in a row and kept at 4-8 &#176;C. However, we did not test it after 3 days.
As we described in the Results section for both sets of experimental injections and for both antibodies, only three bees from 16 tested showed a large distribution ATTO550 in the mushroom body, protocerebrum, and antennal lobes. In all other bees, the distribution of CRISPR-Cas9 was limited to the mushroom body, central complex, and/or posterior protocerebrum. It is essential to understand for any behavioral studies that using this injection method the reduction of target protein will be restricted only to the mushroom body in most of the bees. It will not extend to the antennal lobe or subesophageal ganglion. Thus, the injection technique that we use is suitable to study the effect of the reduction of receptors in the mushroom body and central complex in behavioral experiments, while a different method of introducing CRISPR-Cas9 will be more appropriate for studying other brain regions.
In conclusion, our study demonstrated the successful application of CRISPR-Cas9 as a control for antibody staining in the brain. For both antibodies (anti-RDL and anti-mGlutR1), when the uptake of mGlutR1-CRISPR-Cas9 or RDL-CRISPR-Cas9 was successful, the level of corresponding antibody staining was also reduced significantly. Also, it is essential to note that injection in the ocelli led to a distribution of CRISPR-Cas9 in the brain that was not homogenous. The distribution varied from a minimal area surrounding the ocelli and mushroom body to many cells in the whole brain. The variability of the mGlutR1-or RDL-CRISPR-Cas9 uptake by the cells was likely due to variation in the injections. Our data show that the CRISPR-Cas9 system works in honeybees, but the method of injection needs to be improved to reduce the variability of CRISPR-Cas9 uptake across individual bee brains. Within these restrictions, it is now possible to employ this technique to manipulate genes in adult bees for behavioral experiments.

The recently discovered CRISPR/Cas9 system is a powerful tool that has been used to alter genomic DNA in various model systems and organisms. It has accelerated biomedical research and major technological breakthroughs by making genome modification more efficient and robust than previous methods1. Native to S. pyogenes bacteria, the system relies on a Cas9 endonuclease, whose activity leads to double-stranded breaks (DSBs) in DNA, and a guide RNA (gRNA) that directs the Cas9 protein to a specific, sequence-dependent location2. Double-stranded breaks generated by CRISPR/Cas9 can be repaired via non-homologous end-joining (NHEJ), an error-prone process that can lead to frameshifts, or homology direct repair when a donor template is present. The gRNA itself consists of a target-specific CRISPR RNA (crRNA) and a universal trans-activating crRNA (tracrRNA) which can be chemically synthesized and delivered with purified Cas9 nuclease as a ribonucleoprotein complex (RNP)2,3. Fluorescent labeling of the gRNA or Cas9 nuclease can allow for the detection and intracellular visualization of molecular components via fluorescent microscopy4.
In our present work, we take advantage of the CRISPR-Cas9 system to reduce the protein levels in adult honeybee brains. We studied the metabotropic glutamate receptor (mGluR) and anti-mGlutR1 receptor antibodies and the GABAA receptor subunit RDL and anti-RDL antibodies. We developed a simple method to reduce the amount of protein in the brain of the adult honeybee and used it to drive additional tests of the antibodies developed against the corresponding proteins. Monitoring the fluorescence of CRISPR-Cas9 allowed us to estimate the areas and cells involved in the reduction of the protein.
Using this method, we also characterized the anti-mGlutR1 antibodies that were made in rabbits against the conjugated peptide. The honeybee genome encodes a highly conserved AmGluRA (named mGlutR1 according to NCBI nomenclature) metabotropic glutamate receptor5. The honeybee mGlutR1 gene has four predicted splice variants according to the NCBI database. It has been reported that it is expressed in the central nervous system (CNS) of both pupal and adult bee stages and it is involved in long-term memory formation5. Antibodies developed against mGlutR1 can be an essential tool for studying of the glutamatergic system in the learning and memory process in honeybees.
In our studies, we also characterized anti-RDL antibodies developed in rabbits immunized with conjugated peptides from the Apis mellifera RDL receptor subunit. The honeybee Rdl gene, AmRdl (XM_006565102.3, NCBI database), has 14 predicted splice variants. A partially cloned fragment has been reported in the NCBI database AF094822.1. The RDL receptor function and its physiology is well studied in insects6,7,8, including honeybees9,10,11. Antibodies developed against anti-RDL can be an essential tool for studying the GABAergic system in the learning and memory process in honeybees.
An earlier study on the role of octopamine and tyramine receptors used RNAi injected into the brain with a subsequent test of the amount of protein by Western blot12,13. However, RNAi has some significant limitations. There is only a short time window after RNAi injection within which a reduction of protein occurs13. CRISPR-Cas9 was used very recently in honeybee embryos to delete or modify genes in the entire animal14,15,16. We reported the use of CRISPR-Cas9 to reduce the amount of the protein in the adult honeybee. We developed this approach for honeybees because of the ability to couple it to behavioral studies of learning and memory under controlled laboratory conditions17.
In the present work, we developed antibodies against two receptors and tested them on the adult honeybee brain sections after the protein was reduced by CRISPR-Cas9 injection. At the same time, we established an experimental design that allows use of the method for behavioral experiments.

<table><tbody><tr><td>Acetic Acid</td><td>Sigma-Aldrich</td><td>A6283_100 mL</td><td>western blotting</td></tr><tr><td>Acrylamide-bis Acrylamide</td><td>Bio-Rad</td><td>500 mL 1610156</td><td>western blotting</td></tr><tr><td>Agarose</td><td>Sigma-Aldrich</td><td>A0169-250g</td><td>used with distilled water to fix honey bee brain in blocks</td></tr><tr><td>Alexa Fluor 488 AffiniPure F(ab&#039;)&lt;sub&gt;2&lt;/sub&gt; Fragment Donkey Anti-Rabbit IgG (H+L)</td><td>Jackson Research Laboratories</td><td>711-546-152</td><td>secondary antibody to reveal the primary antibodies from rabbit</td></tr><tr><td>Alt-R CRISPR-cas9 tracrRNA-5&#039;ATTO</td><td>IDT</td><td>1075934</td><td>with desinged guide RNA, it creates gRNA</td></tr><tr><td>Alt-R S.p. Cas9 nuclease V3</td><td>IDT</td><td>1081058</td><td>enzyme used to make ribonucleoprotein for CRISPR system</td></tr><tr><td>Ammonium Persulfate</td><td>Bio-RAD</td><td>10 g 1610700</td><td>western blotting</td></tr><tr><td>Anti-mGlutR1 antibodies</td><td>Covalab (FRANCE)/21st Century Biochemical</td><td>characterized by authors in present paper</td><td>Used for primary incubation of mGlut 1 in honey bees</td></tr><tr><td>Anti-RDL antibodies</td><td>21st Century Biochemical</td><td>characterized by authors in present paper</td><td>Used for primary incubation of RDL in honey bees</td></tr><tr><td>Aprotinin</td><td>Sigma-Aldrich</td><td>Y0001154</td><td>protease inhibitor</td></tr><tr><td>Barraquer Iris Scissors 7mm Blade Sharp point</td><td>World Precision Instruments</td><td>14128-G</td><td>used for dissection honey bee brain</td></tr><tr><td>Benzamidine</td><td>Sigma-Aldrich</td><td>12072</td><td>protease inhibitor</td></tr><tr><td>Blade (breakable) for blade holder</td><td>Fine Science Tool</td><td>10050-00</td><td>dissection for western blotting</td></tr><tr><td>Blade holder and breaker</td><td>Fine Science Tool</td><td>15309</td><td>dissection for western blotting</td></tr><tr><td>Borosilicate glass capillaries</td><td>World Precision Instruments</td><td>1B100 F</td><td>for injection procedure</td></tr><tr><td>Chemiluminescent western blot detection substrate</td><td>Bio-Rad</td><td>1705062</td><td>western blotting</td></tr><tr><td>Chloroform</td><td>Sigma-Aldrich</td><td>472476-50mL</td><td>RNA isolation</td></tr><tr><td>Dithiothreitol</td><td>Bio-Rad</td><td>1610611</td><td>western blotting</td></tr><tr><td>DNA easy kit</td><td>QIAGEN</td><td>69504</td><td>DNA extractionuj</td></tr><tr><td>DNA-free kit</td><td>INVITROGEN</td><td>AM1907</td><td>Used to remove DNA</td></tr><tr><td>Eppendorf Research plus pipette, 3-pack</td><td>Sigma-Aldrich</td><td>Z683884</td><td></td></tr><tr><td>Falcon 24 Well Polystyrene Multiwell</td><td>Falcon</td><td>351147</td><td>Multiwell</td></tr><tr><td>Flat Bottom Embedding Capsules, Polyethylene</td><td>Electron Microscopy Science</td><td>70021</td><td>basket for brain sections</td></tr><tr><td>Forceps Dumont #5 (pair)</td><td>Fine Science Tool</td><td>11254-20</td><td>for dissection of honey bee brain from the head</td></tr><tr><td>Forceps Dumont #5S (pair)</td><td>Fine Science Tool</td><td>11252-00</td><td>to clean up the brain from trachea befor dissection</td></tr><tr><td>Gene Expression Master Mix</td><td>Integrated DNA Technologies</td><td>1055770</td><td>qPCR drop off assay</td></tr><tr><td>Glutaraldehyde</td><td>EMS</td><td>16220</td><td>used for preparation of peptide conjugates for control peabsorption</td></tr><tr><td>Glycerol</td><td>Sigma-Aldrich</td><td>G5516-500 mL</td><td>western blotting, embedding media</td></tr><tr><td>Glycine</td><td>Bio-Rad</td><td>1610718</td><td>western blotting</td></tr><tr><td>Hydrophobic filtered nylonmesh</td><td>Spectrum Labs</td><td>145910</td><td>for bottom of basket for brain sections</td></tr><tr><td>Isopropyl alcohol</td><td>Sigma-Aldrich</td><td>I9030-50mL</td><td>RNA isolation</td></tr><tr><td>Keyhole limpet hemocyanin</td><td>Sigma-Aldrich</td><td>H7017</td><td>used for preparation of conjugates for control</td></tr><tr><td>LSM800 cofocal microscope</td><td>Zeiss</td><td></td><td></td></tr><tr><td>mGlu_Guide 1</td><td>IDT</td><td></td><td>designed guide RNA for CRISPR-Cas 9. Target mGlutR1 genome sequences</td></tr><tr><td>mGlu_Guide 2</td><td>IDT</td><td></td><td>designed guide RNA for CRISPR-Cas 9. Target mGlutR1 genome sequences</td></tr><tr><td>mGlu_Guide 3</td><td>IDT</td><td></td><td>designed guide RNA for CRISPR. Target mGlutR1 genome sequences</td></tr><tr><td>methanol</td><td>Sigma-Aldrich</td><td>34860</td><td>western blotting</td></tr><tr><td>96-well PCR microplate</td><td>Applied biosystem</td><td>4346907</td><td>qPCR drop off assay and qRT-PCR</td></tr><tr><td>384-well PCR microplate</td><td>Sigma-Aldrich</td><td>Z374911</td><td>qRT-PCR</td></tr><tr><td>Mineral oil</td><td>Sigma-Aldrich</td><td>M5904_500mL</td><td>for injection procedure</td></tr><tr><td>Model p87 Flaming Brown Micropipette Puller</td><td>Sutter Instrument Co.</td><td></td><td>Capillary Preparation</td></tr><tr><td>Mowiol 4-88</td><td>Sigma-Aldrich</td><td>81381</td><td>for embedding solution</td></tr><tr><td>Nanoliter 2000</td><td>World Precision Instruments Nanoliter</td><td></td><td>Injection Apparatus</td></tr><tr><td>Normal Donkey Serum</td><td>Jackson Research Laboratories</td><td>AB_2337258</td><td>blocking agent for immunocytochemistry</td></tr><tr><td>Non-immune Goat Serum</td><td>Invitrogen</td><td>50-062Z 100 mL</td><td>blocking agent for immunoblotting</td></tr><tr><td>Nuclease-free buffer</td><td>IDT</td><td>1072570</td><td>Nuclease-free buffer that is used in the preparation of CRISPR-Cas9 injection</td></tr><tr><td>Nuclease-free water</td><td>IDT</td><td>AM9337</td><td>nuclease -free water that is used in preparation of CRISPR-Cas 9 system</td></tr><tr><td>OrbitalShaker Mp4</td><td>Genemate</td><td></td><td></td></tr><tr><td>Paraformaldehyde</td><td>Sigma-Aldrich</td><td>158127-500 g</td><td>used with PBS to make fixative for bee brains</td></tr><tr><td>Phenylmethylsulphonyl fluoride (PMSF)</td><td>Sigma-Aldrich</td><td>P7626-250 mg</td><td>protease inhibitor</td></tr><tr><td>Phosphate Buffer Saline</td><td>Sigma-Aldrich</td><td>P4417-100TAB</td><td>Used with Paraformaldehyde as fixative; buffer for antibodies</td></tr></tbody></table>

anti-rdl and anti-mglutr1 receptors antibody testing in honeybee brain sections using crispr-cas9

Cluster Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) is a gene editing technique widely used in studies of gene function. We use this method in this study to check for the specificity of antibodies developed against the insect GABAA receptor subunit Resistance to Dieldrin (RDL) and a metabotropic glutamate receptor mGlutR1 (mGluRA). The antibodies were generated in rabbits against the conjugated peptides specific to fruit flies (Drosophila melanogaster) as well to honeybees (Apis mellifera). We used these antibodies in honeybee brain sections to study the distribution of the receptors in honeybee brains. The antibodies were affinity purified against the peptide and tested with immunoblotting and the classical method of preadsorption with peptide conjugates to show that the antibodies are specific to the corresponding peptide conjugates against which they were raised. Here we developed the CRISPR-Cas9 technique to test for the reduction of protein targets in the brain 48 h after CRISPR-Cas9 injection with guide RNAs designed for the corresponding receptor. The CRISPR-Cas9 method can also be used in behavioral analyses in the adult bees when one or multiple genes need to be modified.

Anti-RDL antibody tests 
The antibodies were produced against the RDL peptide conjugates as shown in Figure 1A. The first step in characterizing the anti-RDL antibodies is to check the homogenate of the protein extracted from the bee brain using a Western blot with anti-RDL antibodies and a HRP-labeled goat anti-rabbit IgG secondary antibody (Figure 1A, insert). Both anti-RDL antibodies recognized the band located at ~50-60 kD (arrow), corresponding to the estimated weight of the RDL subunit isoform proteins. To demonstrate that anti-RDL antibodies recognized the peptide in the brain slices, we used a preadsorption control (Figure 1B,C). When antibodies were preincubated with conjugated peptides, the staining on the section was absent. This demonstrated that the anti-RDL antibodies recognized the conjugated peptide against which they were raised. In order to demonstrate that the anti-RDL antibodies recognize the protein in the fixed brain tissue, we used CRISPR-Cas9 to knock out the RDL gene that produces the RDL protein in the cells. Figure 1D1-3, shows control frontal bee brain sections that were labeled with anti-RDL antibodies. This bee was not injected with RDL-CRISPR-Cas9 RNP. In Figure 1D1, anti-RDL labels neuropils in the frontal section of the bee brain. The same frontal section in Figure 1D2 shows the absence of fluorescence from ATTO550, because the RDL-CRISPR-Cas9 complex was not injected.
Figure 1E1-E3 shows a brain section from a bee injected with RDL-CRISPR-Cas 9 and then processed with the same amount of antibodies as the control brain in Figure 1D1-D3. The anti-RDL staining was significantly reduced in the whole brain 48 h after the injection, and the distribution of the ATTO550 staining in the brain (Figure 1E2) shows the success of the RDL-CRISPR-Cas 9 injections in the bee median ocelli. The multiple scattered cells of the brain exhibit ATTO550. The successful injection of RDL-CRISPR-Cas 9 reduced the protein expression compared with the control (Figure 1E1-3). From eight immunostained bee brains, only one brain had a high level of distribution of the RDL-CRISPR-Cas9 in the cells of mushroom body, protocerebrum, and antennal lobe, whereas other brains had cell staining with ATTO550 in the mushroom body calyx, central complex, but not antennal lobe. It is important to note that in these bees, reduction anti-RDL immunostaining was not as dramatic as in the brain shown in Figure 1E1.
Next, to estimate the level of the modified RDL gDNA in the bees 48 h after RDL-CRISPR-Cas9 injection, we performed a qPCR drop-off test, where the drop-off probe was designed to match the area of one of the RDL gRNAs. In these experiments, in the bee brains injected with RDL-CRISPR-Cas 9, the relative reduction of the fluorescence corresponded to the number of the modified gDNA in the samples. In our tests the area corresponding to this guide in gDNA in 12 bees injected with RDL-CRISPR-Cas9 were 64 % &#177; (mean &#177; 30 %SD) compared with gDNA in noninjected bees (Figure 3A).
Next, to estimate the level of the RDL RNA in the bees 48 h after injection, we performed qRT-PCR in a separate group of bees (Figure 3B). We compared the level of RDL RNA of RDL-CRISPR-Cas 9 injected bees (n = 19) with the level of RNA in bees that were not injected (n = 12). In these experiments, the relative reduction of the mRNA RDL was 59% &#177; (mean &#177; 15% SE) compared with the level of RNA in non-injected bees. When we examined the level of RDL RNA in each bee individually, only 13 bees out of 19 bees showed a significant reduction of the RNA. These data indicate that injection of RDL-CRISPR-Cas9 through the ocelli might not always reach a large number of brain cells, which confirms the data with RDL immune-stained RDL-CRISPR-Cas9 injected bees. In these preparations, only one bee out of 8 had RDL CRISP-Cas9 in many brain cells (mushroom body, protocerebrum, and antennal lobe) compared with other bee brains, where the distribution of the RDL-CRISPR-Cas9 was concentrated in cells in the protocerebrum (mushroom body calyx and central complex) but not the antennal lobe (Figure 4A-D).
Anti-mGlutR1 antibodies tests 
We used the anti-mGlutR1 antibodies produced in rabbit against conjugated peptides specific to Drosophila melanogaster (Figure 2A). The sequence of this peptide shows a 94% identity with the bee peptide (CLSDKTRFDYFARTVPPD) Figure 2A. First, we checked the antibodies against the bee brain protein using immunoblotting. The bee brain homogenate was separated by 10% SDS-PAGE and electrophoretically transferred from to a nitrocellulose membrane and stained with anti-mGlutR1. The insert in Figure 2A shows two bands with estimated weights (103 and 83 kD) corresponding to two isoforms. When we tested this antibody on honeybee brains, we found that they label neuropilar profiles and cells in the bee brain sections as illustrated in Figure 2B,D. After preadsorption of the anti-mGlutR1 antibody with conjugated-mGlutR1 peptide, the specific staining disappeared in the bee brain slice (Figure 2C). This confirms that anti-mGlutR1 antibodies recognize the peptide (Figure 2C). Next, we injected a mix of mGlutR1-CRISPR-Cas9 in the median ocelli and used the control noguideRNA. In control bees (n = 7), the fluorescence from ATTO550 was not concentrated in the cells. Some brains had scattered fluorescence ATTO550 labeling. Thus, the control preparation in Figure 2D1-3 shows anti-mGlutR1 staining in the brain but not the ATTO550 fluorescence. When mGlutR1-CRISPR-Cas9 was injected into the ocelli and taken up by many cells, the level of fluorescence of the secondary antibodies was significantly reduced in the area that uptakes the functional mGlutR1RNP (Figure 2E1-3). The bees were monitored for 48 h, and one bee from each experimental condition was found dead. Thus, in this experiment, we checked seven control bees and eight CRISPR-Cas9 bees. All the bees injected with CRISPR-Cas9 had cells that took in mGlutR1-CRISPR-Cas9. Most of these cells were in the mushroom body calyx, central complex, and posterior protocerebrum. Only two bees out of seven showed ATTO550 labeling in many cells in the mushroom body, central complex, and the antennal lobe. An example of one of these bees is shown in Figure 2E. The reduction of the level of mGlutR1 staining in these preparations was significant. The other five bees have ATTO550 labeling corresponding to the successful delivery of the mGlutR1 CRISPR-Cas9 in the mushroom body and posterior protocerebrum but not in the antennal lobes.
Next, to estimate the level of the modified mGlutR1 gDNA in the bees 48 h after injection, we performed a qPCR-based drop-off test, where the drop-off probe was designed to be in the area near the mGlutR1 guide. In these experiments, in the bee brains injected with mGlutR1-CRISPR-Cas 9, the relative modification of gDNA in 12 bees were 59% &#177; (mean &#177; 33 %SD) compared with gDNA in noninjected bees (Figure 3A).
These results were also confirmed by qRT-PCR tests in a different group of bees, where we estimated the mGlutR1 RNA levels using qRT-PCR in the bees 48 h after injections with RNPmGlutR1mix (Figure 3B). We compared the level of mGlutR1 RNA of the mGlutR1-CRISPR-Cas9 injected bees (n = 6) with the RNA levels in bees that were not injected (n = 6). In these experiments, the relative reduction of the mRNA mGlutR1 in injected bees was 53% &#177; (mean &#177; 18% SE) compared with uninjected bees (Figure 3B).
The section from four different bees that expressed the RNP RDL-CRISPR-Cas9 in Kenyon cell of mushroom body is shown in Figure 4A-D. The example bee with ATTO550 fluorescence in the mushroom body and the antennal lobe is shown in Figure 4E,F.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Guides</td>
			<td>Sequences</td>
			<td>gRNA</td>
			<td>RNP</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>[guideRNA:tracrRNA]</td>
			<td>[gRNA:Cas9 Nuclease]</td>
		</tr>
		<tr>
			<td>RDL_Guide1</td>
			<td>ACCGTAACGCGACCCCCGCT</td>
			<td>GRDL1</td>
			<td>RRDL1</td>
		</tr>
		<tr>
			<td>RDL_Guide2</td>
			<td>AACGTCGATCGACTTGACGT</td>
			<td>GRDL2</td>
			<td>RRDL2</td>
		</tr>
		<tr>
			<td>RDL_Guide3</td>
			<td>CCATGACGAAACACGTGCCC</td>
			<td>GRDL3</td>
			<td>RRDL3</td>
		</tr>
		<tr>
			<td>mGlu_Guide 1</td>
			<td>CGAAAGTTATCTGACGGTGT</td>
			<td>GMGL1</td>
			<td>RMGL1</td>
		</tr>
		<tr>
			<td>mGlu_Guide 2</td>
			<td>TTCAACGAGAGCAAGTTCAT</td>
			<td>GMGL2</td>
			<td>RMGL2</td>
		</tr>
		<tr>
			<td>mGlu_Guide 3</td>
			<td>GCAAACGTCGGTAGGAGTGA</td>
			<td>GMGL3</td>
			<td>RMGL3</td>
		</tr>
	</tbody>
</table>
Table 1: Nucleotide sequences of guides designed for RDL and mGlutR1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59993/59993fig1a.jpg" /> 
Figure 1: Characterization of anti-RDL antibodies. (A) Schematic of the RDL subunit, where the pink circles indicate the localization of peptide 2 (extracellular CVNEKQSYFHIATTSNEFIRI-amide) in the N-terminus and peptide 1 (intracellular CVRFKVHDPKAHSKGGTL-amide) in the C-terminus. The insert in A shows the bands in the Western blot of honeybee brain extracts processed with corresponding anti-RDL antibodies (one with anti-RDL pep1 and anti-RDL pep2). Each immunoblot shows the apparent size of the protein ~50-60 kD, corresponding to the estimated weights of the various isoform of the RDL subunits. (B,C) Preadsorption of the anti-RDL antibodies with conjugated peptide 1. The image in C shows a reduction in staining in the section when the antibodies were preincubated with conjugated peptide 1. The fan-shaped body (Fb) and Ellipsoid body (eb) are central complex structures in the brain. M = medial lobe of mushroom body. (D1-3) Anti-RDL staining of a control, uninjected bee brain section after 48 h. Green indicates the anti-RDL positive profile in the brain. (D2) This bee was not injected and does not contain ATTO550 fluorescence. (D3) Merged images from D1 and D3. (E1-3) The injection of RDL-CRISPR-Cas9 reduced anti-RDL staining after 48 h. (E2) ATTO550 fluorescence in the cell nuclei indicated successful RDL-CRISPR-Cas9 delivery. (E3) The merged image of anti-RDL (green) and ATTO550 (red). Scale bar = 100 &#956;m (B-E). <a href="https://www.jove.com/files/ftp_upload/59993/59993fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59993/59993fig2a.jpg" /> 
Figure 2: Characterization of anti-mGlutR1 antibodies. (A) Schematic of GCPR mGluR that shows the Drosophila melanogaster peptide used for immunization. For comparison, the Apis mellifera peptide is shown below. The circle indicates the localization of the peptide in the N-terminus of the mGlutR1 receptor extracellular domain. The insert in A shows that the anti-mGlutR1 antibodies recognized two bands in the Western blot of bee brains ~103 kD and ~83 kD that correspond to the estimated weights of known isoforms. (B,C) Preadsorption control of the anti-mGlutR1 antibody in two consecutive sections of the antennal lobe glomeruli. Image of anti-mGlutR1 in the antennal glomeruli section in C shows the reduction of the staining as a result of preincubation of the anti-mGlutR1 peptide with the anti-mGlutR1 antibody. This procedure causes the antibody to precipitate out of solution, which abolishes staining in comparison with B (control, absence of the peptide in the preincubation). (D1) shows staining of anti-mGlutR1 in a bee brain slice after a control injection in the median ocellus. This injection lacked the mGlutR1 gRNA that enables the knock down of mGlutR1 receptors by CRISPR-Cas9, and thus the staining of the anti-mGlutR1 antibody was not reduced (green). (D2) The Absence of ATTO550 fluorescence indicates the absence of functional CRISPR-Cas9 in the brain. (D3) Merged images of anti-mGlutR1 and ATTO550. (E1-E3) show the staining of anti-mGlutR1 in a brain section where mGlutR1 has been permanently knocked down 48 h after injection with mGlutR1-CRISPR-Cas 9 in the median ocellus. Thus, the staining in this brain is greatly reduced due to the successful knockout of the mGlutR1 in many cells. (E2) ATTO550 staining in many cell nuclei in the bee brains indicates that injection of mGlut1-CRISPR-Cas 9 was successful. (E3) Merged image of ATTO550 (red) and anti-mGlutR1 (green). Scale bar = 10 &#956;m (B,C); 100 &#956;m (D,E). <a href="https://www.jove.com/files/ftp_upload/59993/59993fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59993/59993fig3.jpg" /> 
Figure 3: Evaluation of modified gDNA and expression of mRNA of RDL and mGlutR1 mRNA in bee brains 48 h after injection with 345 nL of corresponding RPN CRISPR-Cas9. (A) The qPCR-based drop-off assay test to evaluate the amount of gDNA with a modify area were calculated using 2-&#916;&#916;Ct method and normalized against control, uninjected brains. The data are expressed as mean + SD. (B) TheqRT-PCR test was used to evaluate the amount of mRNA in CRISPR-Cas9 injected and uninjected bees. AmActin was used as a reference gene. The relative gene expression was calculated using 2-&#916;&#916;Ct methods and normalized against control, uninjected brains. The data are expressed as mean + SE. <a href="https://www.jove.com/files/ftp_upload/59993/59993fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59993/59993fig4a.jpg" /> 
Figure 4: Example of the distribution of RNP CRISPR-Cas9 in bee brains via ATTO550 fluorescence. (A-D) The brain sections from four different bees that expressed the RNP RDL-CRISPR-Cas9 in the Kenyon cell of the mushroom body. (E,F) Example of two brains 48 h after injection with RNPmGlutR1 CRISPR-Cas9. Scale bar = 150 &#956;m (A-F). <a href="https://www.jove.com/files/ftp_upload/59993/59993fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Anti-RDL and Anti-mGlutR1 Receptors Antibody Testing in Honeybee Brain Sections using CRISPR-Cas9 at JoVE.com

Anti-RDL and Anti-mGlutR1 Receptors Antibody Testing in Honeybee Brain Sections using CRISPR-Cas9

Presented here is a protocol to use the CRISPR-Cas9 system for reducing the production of a protein in the adult honeybee brain to test antibody specificity.

Cluster Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) is a gene editing technique widely used in studies of ...

anti-rdl-anti-mglutr1-receptors-antibody-testing-honeybee-brain

Research

JoVE Journal

Neuroscience

8.0K Views.  University of Arizona. Presented here is a protocol to use the CRISPR-Cas9 system for reducing the production of a protein in the adult honeybee brain to test antibody specificity.

Video: Anti-RDL and Anti-mGlutR1 Receptors Antibody Testing in Honeybee Brain Sections using CRISPR-Cas9

Detection of Phospholipase C Activity in the Brain Homogenate from the Honeybee

The honeybee is a model organism for evaluating complex behaviors and higher brain function, such as learning, memory, and division of labor. The mushroom body (MB) is a higher brain center proposed to be the neural substrate of complex honeybee behaviors. Although previous studies identified genes and proteins that are differentially expressed in the MBs and other brain regions, the activities of the proteins in each region are not yet fully understood. To reveal the functions of these proteins in the brain, pharmacologic analysis is a feasible approach, but it is first necessary to confirm that pharmacologic manipulations indeed alter the protein activity in these brain regions.
We previously identified a higher expression of genes encoding phospholipase C (PLC) in the MBs than in other brain regions, and pharmacologically assessed the involvement of PLC in honeybee behavior. In that study, we biochemically tested two pharmacologic agents and confirmed that they decreased PLC activity in the MBs and other brain regions. Here, we present a detailed description of how to detect PLC activity in honeybee brain homogenate. In this assay system, homogenates derived from different brain regions are reacted with a synthetic fluorogenic substrate, and fluorescence resulting from PLC activity is quantified and compared between brain regions. We also describe our evaluation of the inhibitory effects of certain drugs on PLC activity using the same system. Although this system is likely affected by other endogenous fluorescence compounds and/or the absorbance of the assay components and tissues, the measurement of PLC activity using this system is safer and easier than that using the traditional assay, which requires radiolabeled substrates. The simple procedure and manipulations allow us to examine PLC activity in the brains and other tissues of honeybees involved in different social tasks.

To test the inhibitory effects of pharmacologic agents on phospholipase C (PLC) in different regions of the honeybee brain, we present a biochemical assay to measure PLC activity in those regions. This assay could be useful for comparing PLC activity among tissues, as well as among bees exhibiting different behaviors.

The honeybee is a model organism for evaluating complex behaviors and higher brain function, such as learning, memory, and division of labor. The mushroom ...

Biochemistry

Embryo Injections for CRISPR-Mediated Mutagenesis in the Ant Harpegnathos saltator

The unique traits of eusocial insects, such as social behavior and reproductive division of labor, are controlled by their genetic system. To address how genes regulate social traits, we have developed mutant ants via delivery of CRISPR complex into young embryos during their syncytial stage. Here, we provide a protocol of CRISPR-mediated mutagenesis in Harpegnathos saltator, a ponerine ant species that displays striking phenotypic plasticity. H. saltator ants are readily reared in a laboratory setting. Embryos are collected for microinjection with Cas9 proteins and in vitro synthesized small guide RNAs (sgRNAs) using home-made quartz needles. Post-injection embryos are reared outside the colony. Following emergence of the first larva, all embryos and larvae are transported to a nest box with a few nursing workers for further development. This protocol is suitable for inducing mutagenesis for analysis of caste-specific physiology and social behavior in ants, but may also be applied to a broader spectrum of hymenopterans and other insects.

Embryo Injections for CRISPR-Mediated Mutagenesis in the Ant Harpegnathos saltator

Many characteristics of insect eusociality rely on within-colony communication and division of labor. Genetic manipulation of key regulatory genes in ant embryos via microinjection and CRISPR-mediated mutagenesis provides insights into the nature of altruistic behavior in eusocial insects.

The unique traits of eusocial insects, such as social behavior and reproductive division of labor, are controlled by their genetic system. To address how ...

Genetics

RNAi-mediated Double Gene Knockdown and Gustatory Perception Measurement in Honey Bees (Apis mellifera)

This video demonstrates novel techniques of RNA interference (RNAi) which downregulate two genes simultaneously in honey bees using double-stranded RNA (dsRNA) injections. It also presents a protocol of proboscis extension response (PER) assay for measuring gustatory perception.	
	RNAi-mediated gene knockdown is an effective technique downregulating target gene expression. This technique is usually used for single gene manipulation, but it has limitations to detect interactions and joint effects between genes. In the first part of this video, we present two strategies to simultaneously knock down two genes (called double gene knockdown). We show both strategies are able to effectively suppress two genes, vitellogenin (vg) and ultraspiracle (usp), which are in a regulatory feedback loop. This double gene knockdown approach can be used to dissect interrelationships between genes and can be readily applied in different insect species.	
	The second part of this video is a demonstration of proboscis extension response (PER) assay in honey bees after the treatment of double gene knockdown. The PER assay is a standard test for measuring gustatory perception in honey bees, which is a key predictor for how fast a honey bee's behavioral maturation is. Greater gustatory perception of nest bees indicates increased behavioral development which is often associated with an earlier age at onset of foraging and foraging specialization in pollen. In addition, PER assay can be applied to identify metabolic states of satiation or hunger in honey bees. Finally, PER assay combined with pairing different odor stimuli for conditioning the bees is also widely used for learning and memory studies in honey bees.

RNAi-mediated Double Gene Knockdown and Gustatory Perception Measurement in Honey Bees Apis mellifera

In this protocol, we describe two strategies that simultaneously suppress two genes (double gene knockdown) in honey bees. Then we present how to use the proboscis extension response (PER) assay to study the effect of double gene knockdown on honey bee gustatory perception.

This video demonstrates novel techniques of RNA  interference (RNAi) which downregulate two genes simultaneously in honey bees  using double-stranded RNA ...

Embryo Microinjection and Knockout Mutant Identification of CRISPR/Cas9 Genome-Edited Helicoverpa Armigera (H&#252;bner)

The cotton bollworm, Helicoverpa armigera, is one of the most destructive pests in the world. A combination of molecular genetics, physiology, functional genomics, and behavioral studies has made H. armigera a model species in Lepidoptera Noctuidae. To study the in vivo functions of and interactions between different genes, clustered regularly interspaced short palindromic repeats (CRISPR)/ associated protein 9 (Cas9) genome editing technology is a convenient and effective method used for performing functional genomic studies. In this study, we provide a step-by-step systematic method to complete gene knockout in H. armigera using the CRISPR/Cas9 system. The design and synthesis of guide RNA (gRNA) are described in detail. Then, the subsequent steps consisting of gene-specific primer design for guide RNA (gRNA) creation, embryo collection, microinjection, insect rearing, and mutant detection are summarized. Finally, troubleshooting advice and notes are provided to improve the efficiency of gene editing. Our method will serve as a reference for the application of CRISPR/Cas9 genome editing in H. armigera as well as other Lepidopteran moths.

Embryo Microinjection and Knockout Mutant Identification of CRISPR/Cas9 Genome-Edited Helicoverpa Armigera H&#252;bner

Presented here is a protocol of Helicoverpa armigera (H&#252;bner) embryo microinjection and knockout mutant identification created by CRISPR/Cas9 genome editing. Mutant insects enable further research of gene function and interaction among different genes in vivo.

The cotton bollworm, Helicoverpa armigera, is one of the most destructive pests in the world. A combination of molecular genetics, physiology, functional ...

Behavior

Neuropharmacological Manipulation of Restrained and Free-flying Honey Bees, Apis mellifera

Honey bees demonstrate astonishing learning abilities and advanced social behavior and communication. In addition, their brain is small, easy to visualize and to study. Therefore, bees have long been a favored model amongst neurobiologists and neuroethologists for studying the neural basis of social and natural behavior. It is important, however, that the experimental techniques used to study bees do not interfere with the behaviors being studied. Because of this, it has been necessary to develop a range of techniques for pharmacological manipulation of honey bees. In this paper we demonstrate methods for treating restrained or free-flying honey bees with a wide range of pharmacological agents. These include both noninvasive methods such as oral and topical treatments, as well as more invasive methods that allow for precise drug delivery in either systemic or localized fashion. Finally, we discuss the advantages and disadvantages of each method and&#160;describe common hurdles and how to best overcome them. We conclude with a discussion on the importance of adapting the experimental method to the biological questions rather than the other way around.

Neuropharmacological Manipulation of Restrained and Free-flying Honey Bees, Apis mellifera

This manuscript describes several protocols for administering pharmacological agents to honey bees, including simple noninvasive methods for free-flying bees, as well as more invasive variants that allow precise localized treatment of restrained bees.

Honey bees demonstrate astonishing learning abilities and advanced social behavior and communication. In addition, their brain is small, easy to visualize ...

Non-invasive Strategies for Chronic Manipulation of DREADD-controlled Neuronal Activity

Chemogenetic strategies have emerged as reliable tools for remote control of neuronal activity. Among these, designer receptors exclusively activated by designer drugs (DREADDs) have become the most popular chemogenetic approach used in modern neuroscience. Most studies deliver the ligand clozapine-N-oxide (CNO) using a single intraperitoneal injection, which is suitable for the acute activation/inhibition of the targeted neuronal population. There are, however, only a few examples of strategies for chronic modulation of DREADD-controlled neurons, the majority of which rely on the use of delivery systems that require surgical intervention. Here, we expand on two non-invasive strategies for delivering the ligand CNO to chronically manipulate neural population in mice. CNO was administered either by using repetitive (daily) eye-drops, or chronically through the animal&#39;s drinking water. These non-invasive paradigms result in robust activation of the designer receptors that persisted throughout the CNO treatments. The methods described here offer alternatives for the chronic DREADD-mediated control of neuronal activity and may be useful for experiments designed to evaluate behavior in freely moving animals, focusing on less-invasive CNO delivery methods.

Here we describe two non-invasive methods to chronically control neuronal activity using chemogenetics in mice. Eye-drops were used to deliver clozapine-N-oxide (CNO) daily. We also describe two methods for prolonged administration of CNO in drinking water. These strategies for chronic neuronal control require minimal intervention reducing animals&#8217; stress.

Chemogenetic strategies have emerged as reliable tools for remote control of neuronal activity. Among these, designer receptors exclusively activated by ...

Ubiquitous and Tissue-specific RNA Targeting in Drosophila Melanogaster using CRISPR/CasRx

CasRx, a member of the RNA-targeting Cas13 family, is a promising new addition of the CRISPR/Cas technologies in efficient gene transcript reduction with an attractive off-target profile at both cellular and organismal levels. It is recently reported that the CRISPR/CasRx system can be used to achieve ubiquitous and tissue-specific gene transcript reduction in Drosophila melanogaster. This paper details the methods from the recent work, consisting of three parts: 1) ubiquitous&#160;in vivo endogenous RNA targeting using a two-component CasRx system; 2) ubiquitous in vivo exogenous RNA targeting using a three-component CasRx system; and 3) tissue-specific in vivo RNA targeting using a three-component CasRx system. The effects of RNA targeting observed include targeted gene specific phenotypic changes, targeted RNA transcript reduction, and occasional lethality phenotypes associated with high expression of CasRx protein and collateral activity. Overall, these results showed that the CasRx system is capable of target RNA transcript reduction at the organismal level in a programmable and efficient manner, demonstrating that in vivo transcriptome targeting, and engineering is feasible and lays the foundation for future in vivo CRISPR-based RNA targeting technologies.

Ubiquitous and Tissue-specific RNA Targeting in Drosophila Melanogaster using CRISPR/CasRx

This article outlines a detailed protocol for using the RNA-targeting Cas13D enzyme (RfxCas13D) in flies.

CasRx, a member of the RNA-targeting Cas13 family, is a promising new addition of the CRISPR/Cas technologies in efficient gene transcript reduction with ...

Immunology and Infection

Retroviral Transduction of Guide RNA for Gene Editing in Th17 Differentiation

Retroviral CRISPR/Cas9-Mediated Gene Targeting for the Study of Th17 Differentiation in Vitro

T helper cells that produce IL-17A, known as Th17 cells, play a critical role in immune defense and are implicated in autoimmune disorders. CD4 T cells can be stimulated with antigens and well-defined cytokine cocktails in vitro to mimic Th17 cell differentiation in vivo. Research has been conducted extensively on the Th17 differentiation regulation mechanisms using the in vitro Th17 polarization assay.
Conventional Th17 polarization methods typically involve obtaining na&#239;ve CD4 T cells from genetically modified mice to study the effects of specific genes on Th17 differentiation and function. These methods can be time-consuming and costly and may be influenced by cell-extrinsic factors from the knockout animals. Thus, a protocol using retroviral transduction of guide RNA to introduce gene knockout in CRISPR/Cas9 knockin primary mouse T cells serves as a very useful alternative approach. This paper presents a protocol to differentiate na&#239;ve primary T cells into Th17 cells following retroviral-mediated gene targeting, as well as the subsequent flow cytometry analysis methods for assaying infection and differentiation efficiency.

We present a protocol for retroviral transduction of guide RNA into primary T cells from Cas9 transgenic mice, providing an efficient alternative for gene editing in studying Th17 differentiation.

T helper cells that produce IL-17A, known as Th17 cells, play a critical role in immune defense and are implicated in autoimmune disorders. CD4 T cells ...

Pupal and Adult Injections for RNAi and CRISPR Gene Editing in Nasonia vitripennis

The jewel wasp, Nasonia vitripennis, has become an efficient model system to study epigenetics of haplo-diploid sex determination, B-chromosome biology, host-symbiont interactions, speciation, and venom synthesis. Despite the availability of several molecular tools, including CRISPR/Cas9, functional genetic studies are still limited in this organism. The major limitation of applying CRISPR/Cas9 technology in N. vitripennis stems from the challenges of embryonic microinjections. Injections of embryos are particularly difficult in this organism and in general in many parasitoid wasps, due to small embryo size and the requirement of a host pupa for embryonic development. To address these challenges, Cas9 ribonucleoprotein complex delivery into female&#160;ovaries by adult injection, rather than embryonic microinjection, was optimized, resulting in both somatic and heritable germline edits. The injection procedures were optimized in pupae and female wasps using either ReMOT Control (Receptor-Mediated Ovary Transduction of Cargo) or BAPC (Branched Amphiphilic Peptide Capsules). These methods are shown to be effective alternatives to embryo injection, enabling site-specific and heritable germline mutations.

Pupal and Adult Injections for RNAi and CRISPR Gene Editing in Nasonia vitripennis

Here, we describe methods for efficient pupal and adult injections in Nasonia vitripennis as accessible alternatives to embryo microinjection, enabling functional analysis of genes of interest using either RNA-silencing via RNA interference (RNAi) or gene knockout via CRISPR/Cas9 genome editing.

The jewel wasp, Nasonia vitripennis, has become an efficient model system to study epigenetics of haplo-diploid sex determination, B-chromosome biology, ...

Biology

Construction of Homozygous Mutants of Migratory Locust Using CRISPR/Cas9 Technology

The migratory locust, Locusta migratoria, is not only one of the worldwide plague locusts that caused huge economic losses to human beings but also an important research model for insect metamorphosis. The CRISPR/Cas9 system can accurately locate at a specific DNA locus and cleave within the target site, efficiently introducing double-strand breaks to induce target gene knockout or integrate new gene fragments into the specific locus. CRISPR/Cas9-mediated genome editing is a powerful tool for addressing questions encountered in locust research as well as a promising technology for locust control. This study provides a systematic protocol for CRISPR/Cas9-mediated gene knockout with the complex of Cas9 protein and single guide RNAs (sgRNAs) in migratory locusts. The selection of target sites and design of sgRNA are described in detail, followed by in vitro synthesis and verification of the sgRNAs. Subsequent procedures include egg raft collection and tanned-egg separation to achieve successful microinjection with low mortality rate, egg culture,&#160;preliminary estimation of the mutation rate, locust breeding as well as detection, preservation, and passage of the mutants to ensure population stability of the edited locusts. This method can be used as a reference for CRISPR/Cas9 based gene editing applications in migratory locusts as well as in other insects.

This study provides a systematically optimized procedure of CRISPR/Cas9 ribonuclease-based construction of homozygous locust mutants as well as a detailed method for cryopreservation and resuscitation of the locust eggs.

The migratory locust, Locusta migratoria, is not only one of the worldwide plague locusts that caused huge economic losses to human beings but also an ...

Anti-RDL and Anti-mGlutR1 Receptors Antibody Testing in Honeybee Brain Sections using CRISPR-Cas9

Summary

Explore More Videos

Chapters in this video

Detection of Phospholipase C Activity in the Brain Homogenate from the Honeybee

Embryo Injections for CRISPR-Mediated Mutagenesis in the Ant Harpegnathos saltator

RNAi-mediated Double Gene Knockdown and Gustatory Perception Measurement in Honey Bees (Apis mellifera)

Embryo Microinjection and Knockout Mutant Identification of CRISPR/Cas9 Genome-Edited Helicoverpa Armigera (Hübner)

Neuropharmacological Manipulation of Restrained and Free-flying Honey Bees, Apis mellifera

Non-invasive Strategies for Chronic Manipulation of DREADD-controlled Neuronal Activity

Ubiquitous and Tissue-specific RNA Targeting in Drosophila Melanogaster using CRISPR/CasRx

Retroviral CRISPR/Cas9-Mediated Gene Targeting for the Study of Th17 Differentiation in Vitro

Pupal and Adult Injections for RNAi and CRISPR Gene Editing in Nasonia vitripennis

Construction of Homozygous Mutants of Migratory Locust Using CRISPR/Cas9 Technology