This work was supported by the following awards to BHS: Human Frontiers Science Program; NIH NIGMS (R01 GM113967); NSF Ideas Lab (1556337). The peptide and antibodies for DmGluRA were designed in the laboratory Dr. Serge Birman (Marseille, Luminy, France) when IS was supported by Programme d&#39;Urgence FRM/Postdocs UFP20060306548 from the Fondation pour la Recherche Medicale. We are thankful for Daniela Junqueira Marosi and Alex Hanter from Integrated DNA Technology (IDT) for the help with the design of RDL guides and qPCR drop-off assays.

<ol>
	<li>Harms, D. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+Genome+Editing+Using+the+CRISPR/Cas+System.">Mouse Genome Editing Using the CRISPR/Cas System.</a> Current Protocols in Human Genetics. 83 (15), 7-27 (2014).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Kouranova, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRs+for+Optimal+Targeting:+Delivery+of+CRISPR+Components+as+DNA,+RNA,+and+Protein+into+Cultured+Cells+and+Single-Cell+Embryos.">CRISPRs for Optimal Targeting: Delivery of CRISPR Components as DNA, RNA, and Protein into Cultured Cells and Single-Cell Embryos.</a> Human Gene Therapy. 27 (6), 464-475 (2016).</li><li>Schubert, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescently+labeled+tracrRNA+provides+efficient+genome+editing+while+allowing+cellular+microscopy+and+FACS+analysis.">Fluorescently labeled tracrRNA provides efficient genome editing while allowing cellular microscopy and FACS analysis.</a> Genome Editing. , 1-3 (2017).</li><li>Kucharski, R., Mitri, C., Grau, Y., Maleszka, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+metabotropic+glutamate+receptor+in+the+honeybee+(Apis+mellifera):+implications+for+memory+formation.">Characterization of a metabotropic glutamate receptor in the honeybee (Apis mellifera): implications for memory formation.</a> Invertebrate Neuroscience. 7 (2), 99-108 (2007).</li><li>Aronstein, K., Auld, V., Ffrench-Constant, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+two+GABA+receptor-like+subunits+in+the+Drosophila+CNS.">Distribution of two GABA receptor-like subunits in the Drosophila CNS.</a> Invertebrate Neuroscience. 2 (2), 115-120 (1996).</li><li>Thompson, M., Steichen, J. C., ffrench-Constant, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservation+of+cyclodiene+insecticide+resistance-associated+mutations+in+insects.">Conservation of cyclodiene insecticide resistance-associated mutations in insects.</a> Insect Molecular Biology. 2 (3), 149-154 (1993).</li><li>Chung, B. Y., Kilman, V. L., Keath, J. R., Pitman, J. L., Allada, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GABA(A)+receptor+RDL+acts+in+peptidergic+PDF+neurons+to+promote+sleep+in+Drosophila.">The GABA(A) receptor RDL acts in peptidergic PDF neurons to promote sleep in Drosophila.</a> Current Biology. 19 (5), 386-390 (2009).</li><li>Taylor-Wells, J., Hawkins, J., Colombo, C., Bermudez, I., Jones, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+functional+expression+of+intracellular+loop+variants+of+the+honeybee+(Apis+mellifera)+RDL+GABA+receptor.">Cloning and functional expression of intracellular loop variants of the honeybee (Apis mellifera) RDL GABA receptor.</a> Neurotoxicology. 60, 207-213 (2017).</li><li>Jones, A. K., Sattelle, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cys-loop+ligand-gated+ion+channel+superfamily+of+the+honeybee,+Apis+mellifera.">The cys-loop ligand-gated ion channel superfamily of the honeybee, Apis mellifera.</a> Invertebrate Neuroscience. 6 (3), 123-132 (2006).</li><li>Dupuis, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homomeric+RDL+and+heteromeric+RDL/LCCH3+GABA+receptors+in+the+honeybee+antennal+lobes:+two+candidates+for+inhibitory+transmission+in+olfactory+processing.">Homomeric RDL and heteromeric RDL/LCCH3 GABA receptors in the honeybee antennal lobes: two candidates for inhibitory transmission in olfactory processing.</a> Journal of Neurophysiology. 103 (1), 458-468 (2010).</li><li>Farooqui, T., Robinson, K., Vaessin, H., Smith, B. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+early+olfactory+processing+by+an+octopaminergic+reinforcement+pathway+in+the+honeybee.">Modulation of early olfactory processing by an octopaminergic reinforcement pathway in the honeybee.</a> Journal of Neuroscience. 23 (12), 5370-5380 (2003).</li><li>Guo, X., Wang, Y., Sinakevitch, I., Lei, H., Smith, B. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+RNAi+knockdown+effect+of+tyramine+receptor+1+induced+by+dsRNA+and+siRNA+in+brains+of+the+honeybee,+Apis+mellifera.">Comparison of RNAi knockdown effect of tyramine receptor 1 induced by dsRNA and siRNA in brains of the honeybee, Apis mellifera.</a> Journal of Insect Physiology. 111, 47-52 (2018).</li><li>Roth, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+switch+for+worker+nutrition-mediated+traits+in+honeybees.">A genetic switch for worker nutrition-mediated traits in honeybees.</a> PLOS Biology. 17 (3), e3000171 (2019).</li><li>Kohno, H., Suenami, S., Takeuchi, H., Sasaki, T., Kubo, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+Knockout+Mutants+by+CRISPR/Cas9+in+the+European+Honeybee,+Apis+mellifera+L.">Production of Knockout Mutants by CRISPR/Cas9 in the European Honeybee, Apis mellifera L.</a> Zoological Science (BIOONE). 33 (5), 505-512 (2016).</li><li>Hu, X. F., Zhang, B., Liao, C. H., Zeng, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-Efficiency+CRISPR/Cas9-Mediated+Gene+Editing+in+Honeybee+Apis+mellifera+Embryos.">High-Efficiency CRISPR/Cas9-Mediated Gene Editing in Honeybee Apis mellifera Embryos.</a> G3: Genes, Genomes, Genetics. 9 (5), 1759-1766 (2019).</li><li>Smith, B. H., Burden, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Proboscis+Extension+Response+Protocol+for+Investigating+Behavioral+Plasticity+in+Insects:+Application+to+Basic,+Biomedical,+and+Agricultural+Research.">A Proboscis Extension Response Protocol for Investigating Behavioral Plasticity in Insects: Application to Basic, Biomedical, and Agricultural Research.</a> Journal of Visualized Experiments. (91), e51057 (2014).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Rodriguez, J., Deinhardt, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+a+semipermanent+mounting+medium+for+fluorescent+antibody+studies.">Preparation of a semipermanent mounting medium for fluorescent antibody studies.</a> Virology. 12, 316-317 (1960).</li><li>. Custom Alt-R&#174; CRISPR-Cas9 guide RNA Available from: <a target="_blank" href="https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM">https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM</a> (2019)</li><li>Bonnafe, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+a+thymol+application+on+olfactory+memory+and+gene+expression+levels+in+the+brain+of+the+honeybee+Apis+mellifera.">Effect of a thymol application on olfactory memory and gene expression levels in the brain of the honeybee Apis mellifera.</a> Environmental Science and Pollutant Research (International). 22 (11), 8022-8030 (2015).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+behaviorally+associated+gene+networks+in+worker+honeybee+ovaries.">Regulation of behaviorally associated gene networks in worker honeybee ovaries.</a> Journal of Experimental Biology. 215 (Pt 1), 124-134 (2012).</li></ol>

The authors have nothing to disclose.

Characterization of the anti-RDL and anti-mGlutR1 
First, we characterized the anti-RDL and anti-mGlutR1 antibodies by immunoblot and pre-adsorption on the slices of fixed honeybee brains. Each antibody was made to recognize all its known isoforms, and Western analysis show they recognize bands that correspond to their predicted molecular weights. Next, both antibodies were blocked by the conjugated peptide against which they were produced on honeybee brain sections.
One of the first aims in our study was to establish that the antibodies produced against the specific conjugated peptide are specific to its protein in fixed brain tissue. For that purpose, we took advantage of the CRISPR-Cas9 system. We designed specific guides for honeybee RDL and mGlutR1 and used each of them to make CRISPR-Cas9 labeled with the fluorescent probe ATTO550. For each receptor, we injected a mixture of three different CRISPR-Cas9 ribonucleoproteins in the ocelli to reduce the amount of the targeted protein in the adult honeybee brain by eliminating the corresponding gene in cells that took up our designed Cas9 system. In our study, we accomplished this step.
One of the first crucial steps for the success of these experiments is designing the appropriate guide RNAs. We recommend designing up to five guide RNAs, located at the beginning, middle, and the end of the gene sequence. In our preliminary work, we tested them in various combinations on three to five bees. We also tried different concentrations of injections, as well as times after injection, and various mixtures of RNP in the injections. We dissected out brains and processed them using anti-RDL and anti-mGlutR1 antibodies. In these initial tests, we established the appropriate combination, post-injection time, as well as the concentration and amount of CRISPR-Cas9 for injection. These initial tests were the basis for setting up the experiments that we described in detail here.
The aim was two-fold: 1) to demonstrate in a bee that our antibody staining was reduced after treatment with CRISPR-Cas9 and 2) to work through the best experimental conditions for behavioral studies. Thus, we show that if many cell nuclei contain CRISPR-Cas9 48 h after injection, the reduction of the anti-RDL and anti-mGlutR1 staining is significant. Additionally, that demonstrates that the tested antibodies specifically recognize the mGlut1 and RDL protein in the honeybee brain preparation and that they can be used for localization studies in the honeybee brain.
Experimental setting CRISPR-Cas9 for behavioral study 
Next, we set up the experiments so that CRISPR-Cas9 could be used in behavioral studies. Eight or nine honeybees were collected for control and experimental treatments. They were behaviorally tested before and after injection, and then their brains were processed for ATTO550 and/or immunocytochemistry to determine the brain regions that showed reduction of the target protein. Here it is essential to note that the number of bees taken for one set of experiments was limited to no more than 8-9 bees for the control and experimental conditions. This way both conditions could be tested on the same day. Also, once we prepared the CRISPR-Cas9 mixtures for injection, we never froze them. The CRISPR-Cas9 mixture did not change in potency when used 3 days in a row and kept at 4-8 &#176;C. However, we did not test it after 3 days.
As we described in the Results section for both sets of experimental injections and for both antibodies, only three bees from 16 tested showed a large distribution ATTO550 in the mushroom body, protocerebrum, and antennal lobes. In all other bees, the distribution of CRISPR-Cas9 was limited to the mushroom body, central complex, and/or posterior protocerebrum. It is essential to understand for any behavioral studies that using this injection method the reduction of target protein will be restricted only to the mushroom body in most of the bees. It will not extend to the antennal lobe or subesophageal ganglion. Thus, the injection technique that we use is suitable to study the effect of the reduction of receptors in the mushroom body and central complex in behavioral experiments, while a different method of introducing CRISPR-Cas9 will be more appropriate for studying other brain regions.
In conclusion, our study demonstrated the successful application of CRISPR-Cas9 as a control for antibody staining in the brain. For both antibodies (anti-RDL and anti-mGlutR1), when the uptake of mGlutR1-CRISPR-Cas9 or RDL-CRISPR-Cas9 was successful, the level of corresponding antibody staining was also reduced significantly. Also, it is essential to note that injection in the ocelli led to a distribution of CRISPR-Cas9 in the brain that was not homogenous. The distribution varied from a minimal area surrounding the ocelli and mushroom body to many cells in the whole brain. The variability of the mGlutR1-or RDL-CRISPR-Cas9 uptake by the cells was likely due to variation in the injections. Our data show that the CRISPR-Cas9 system works in honeybees, but the method of injection needs to be improved to reduce the variability of CRISPR-Cas9 uptake across individual bee brains. Within these restrictions, it is now possible to employ this technique to manipulate genes in adult bees for behavioral experiments.

The recently discovered CRISPR/Cas9 system is a powerful tool that has been used to alter genomic DNA in various model systems and organisms. It has accelerated biomedical research and major technological breakthroughs by making genome modification more efficient and robust than previous methods1. Native to S. pyogenes bacteria, the system relies on a Cas9 endonuclease, whose activity leads to double-stranded breaks (DSBs) in DNA, and a guide RNA (gRNA) that directs the Cas9 protein to a specific, sequence-dependent location2. Double-stranded breaks generated by CRISPR/Cas9 can be repaired via non-homologous end-joining (NHEJ), an error-prone process that can lead to frameshifts, or homology direct repair when a donor template is present. The gRNA itself consists of a target-specific CRISPR RNA (crRNA) and a universal trans-activating crRNA (tracrRNA) which can be chemically synthesized and delivered with purified Cas9 nuclease as a ribonucleoprotein complex (RNP)2,3. Fluorescent labeling of the gRNA or Cas9 nuclease can allow for the detection and intracellular visualization of molecular components via fluorescent microscopy4.
In our present work, we take advantage of the CRISPR-Cas9 system to reduce the protein levels in adult honeybee brains. We studied the metabotropic glutamate receptor (mGluR) and anti-mGlutR1 receptor antibodies and the GABAA receptor subunit RDL and anti-RDL antibodies. We developed a simple method to reduce the amount of protein in the brain of the adult honeybee and used it to drive additional tests of the antibodies developed against the corresponding proteins. Monitoring the fluorescence of CRISPR-Cas9 allowed us to estimate the areas and cells involved in the reduction of the protein.
Using this method, we also characterized the anti-mGlutR1 antibodies that were made in rabbits against the conjugated peptide. The honeybee genome encodes a highly conserved AmGluRA (named mGlutR1 according to NCBI nomenclature) metabotropic glutamate receptor5. The honeybee mGlutR1 gene has four predicted splice variants according to the NCBI database. It has been reported that it is expressed in the central nervous system (CNS) of both pupal and adult bee stages and it is involved in long-term memory formation5. Antibodies developed against mGlutR1 can be an essential tool for studying of the glutamatergic system in the learning and memory process in honeybees.
In our studies, we also characterized anti-RDL antibodies developed in rabbits immunized with conjugated peptides from the Apis mellifera RDL receptor subunit. The honeybee Rdl gene, AmRdl (XM_006565102.3, NCBI database), has 14 predicted splice variants. A partially cloned fragment has been reported in the NCBI database AF094822.1. The RDL receptor function and its physiology is well studied in insects6,7,8, including honeybees9,10,11. Antibodies developed against anti-RDL can be an essential tool for studying the GABAergic system in the learning and memory process in honeybees.
An earlier study on the role of octopamine and tyramine receptors used RNAi injected into the brain with a subsequent test of the amount of protein by Western blot12,13. However, RNAi has some significant limitations. There is only a short time window after RNAi injection within which a reduction of protein occurs13. CRISPR-Cas9 was used very recently in honeybee embryos to delete or modify genes in the entire animal14,15,16. We reported the use of CRISPR-Cas9 to reduce the amount of the protein in the adult honeybee. We developed this approach for honeybees because of the ability to couple it to behavioral studies of learning and memory under controlled laboratory conditions17.
In the present work, we developed antibodies against two receptors and tested them on the adult honeybee brain sections after the protein was reduced by CRISPR-Cas9 injection. At the same time, we established an experimental design that allows use of the method for behavioral experiments.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Acetic Acid</td>
			<td>Sigma-Aldrich</td>
			<td>A6283_100 mL</td>
			<td>western blotting</td>
		</tr>
		<tr>
			<td>Acrylamide-bis Acrylamide</td>
			<td>Bio-Rad</td>
			<td>500 mL 1610156</td>
			<td>western blotting</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma-Aldrich</td>
			<td>A0169-250g</td>
			<td>used with distilled water to fix honey bee brain in blocks</td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 AffiniPure F(ab&#39;)2 Fragment Donkey Anti-Rabbit IgG (H+L)</td>
			<td>Jackson Research Laboratories</td>
			<td>711-546-152</td>
			<td>secondary antibody to reveal the primary antibodies from rabbit</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-cas9 tracrRNA-5&#39;ATTO</td>
			<td>IDT</td>
			<td>1075934</td>
			<td>with desinged guide RNA, it creates gRNA</td>
		</tr>
		<tr>
			<td>Alt-R S.p. Cas9 nuclease V3</td>
			<td>IDT</td>
			<td>1081058</td>
			<td>enzyme used to make ribonucleoprotein for CRISPR system</td>
		</tr>
		<tr>
			<td>Ammonium Persulfate</td>
			<td>Bio-RAD</td>
			<td>10 g 1610700</td>
			<td>western blotting</td>
		</tr>
		<tr>
			<td>Anti-mGlutR1 antibodies</td>
			<td>Covalab (FRANCE)/21st Century Biochemical</td>
			<td>characterized by authors in present paper</td>
			<td>Used for primary incubation of mGlut 1 in honey bees</td>
		</tr>
		<tr>
			<td>Anti-RDL antibodies</td>
			<td>21st Century Biochemical</td>
			<td>characterized by authors in present paper</td>
			<td>Used for primary incubation of RDL in honey bees</td>
		</tr>
		<tr>
			<td>Aprotinin</td>
			<td>Sigma-Aldrich</td>
			<td>Y0001154</td>
			<td>protease inhibitor</td>
		</tr>
		<tr>
			<td>Barraquer Iris Scissors 7mm Blade Sharp point</td>
			<td>World Precision Instruments</td>
			<td>14128-G</td>
			<td>used for dissection honey bee brain</td>
		</tr>
		<tr>
			<td>Benzamidine</td>
			<td>Sigma-Aldrich</td>
			<td>12072</td>
			<td>protease inhibitor</td>
		</tr>
		<tr>
			<td>Blade (breakable) for blade holder</td>
			<td>Fine Science Tool</td>
			<td>10050-00</td>
			<td>dissection for western blotting</td>
		</tr>
		<tr>
			<td>Blade holder and breaker</td>
			<td>Fine Science Tool</td>
			<td>15309</td>
			<td>dissection for western blotting</td>
		</tr>
		<tr>
			<td>Borosilicate glass capillaries</td>
			<td>World Precision Instruments</td>
			<td>1B100 F</td>
			<td>for injection procedure</td>
		</tr>
		<tr>
			<td>Chemiluminescent western blot detection substrate</td>
			<td>Bio-Rad</td>
			<td>1705062</td>
			<td>western blotting</td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Sigma-Aldrich</td>
			<td>472476-50mL</td>
			<td>RNA isolation</td>
		</tr>
		<tr>
			<td>Dithiothreitol</td>
			<td>Bio-Rad</td>
			<td>1610611</td>
			<td>western blotting</td>
		</tr>
		<tr>
			<td>DNA easy kit</td>
			<td>QIAGEN</td>
			<td>69504</td>
			<td>DNA extractionuj</td>
		</tr>
		<tr>
			<td>DNA-free kit</td>
			<td>INVITROGEN</td>
			<td>AM1907</td>
			<td>Used to remove DNA</td>
		</tr>
		<tr>
			<td>Eppendorf Research plus pipette, 3-pack</td>
			<td>Sigma-Aldrich</td>
			<td>Z683884</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon 24 Well Polystyrene Multiwell</td>
			<td>Falcon</td>
			<td>351147</td>
			<td>Multiwell</td>
		</tr>
		<tr>
			<td>Flat Bottom Embedding Capsules, Polyethylene</td>
			<td>Electron Microscopy Science</td>
			<td>70021</td>
			<td>basket for brain sections</td>
		</tr>
		<tr>
			<td>Forceps Dumont #5 (pair)</td>
			<td>Fine Science Tool</td>
			<td>11254-20</td>
			<td>for dissection of honey bee brain from the head</td>
		</tr>
		<tr>
			<td>Forceps Dumont #5S (pair)</td>
			<td>Fine Science Tool</td>
			<td>11252-00</td>
			<td>to clean up the brain from trachea befor dissection</td>
		</tr>
		<tr>
			<td>Gene Expression Master Mix</td>
			<td>Integrated DNA Technologies</td>
			<td>1055770</td>
			<td>qPCR drop off assay</td>
		</tr>
		<tr>
			<td>Glutaraldehyde</td>
			<td>EMS</td>
			<td>16220</td>
			<td>used for preparation of peptide conjugates for control peabsorption</td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Sigma-Aldrich</td>
			<td>G5516-500 mL</td>
			<td>western blotting, embedding media</td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Bio-Rad</td>
			<td>1610718</td>
			<td>western blotting</td>
		</tr>
		<tr>
			<td>Hydrophobic filtered nylonmesh</td>
			<td>Spectrum Labs</td>
			<td>145910</td>
			<td>for bottom of basket for brain sections</td>
		</tr>
		<tr>
			<td>Isopropyl alcohol</td>
			<td>Sigma-Aldrich</td>
			<td>I9030-50mL</td>
			<td>RNA isolation</td>
		</tr>
		<tr>
			<td>Keyhole limpet hemocyanin</td>
			<td>Sigma-Aldrich</td>
			<td>H7017</td>
			<td>used for preparation of conjugates for control</td>
		</tr>
		<tr>
			<td>LSM800 cofocal microscope</td>
			<td>Zeiss</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>mGlu_Guide 1</td>
			<td>IDT</td>
			<td></td>
			<td>designed guide RNA for CRISPR-Cas 9. Target mGlutR1 genome sequences</td>
		</tr>
		<tr>
			<td>mGlu_Guide 2</td>
			<td>IDT</td>
			<td></td>
			<td>designed guide RNA for CRISPR-Cas 9. Target mGlutR1 genome sequences</td>
		</tr>
		<tr>
			<td>mGlu_Guide 3</td>
			<td>IDT</td>
			<td></td>
			<td>designed guide RNA for CRISPR. Target mGlutR1 genome sequences</td>
		</tr>
		<tr>
			<td>methanol</td>
			<td>Sigma-Aldrich</td>
			<td>34860</td>
			<td>western blotting</td>
		</tr>
		<tr>
			<td>96-well PCR microplate</td>
			<td>Applied biosystem</td>
			<td>4346907</td>
			<td>qPCR drop off assay and qRT-PCR</td>
		</tr>
		<tr>
			<td>384-well PCR microplate</td>
			<td>Sigma-Aldrich</td>
			<td>Z374911</td>
			<td>qRT-PCR</td>
		</tr>
		<tr>
			<td>Mineral oil</td>
			<td>Sigma-Aldrich</td>
			<td>M5904_500mL</td>
			<td>for injection procedure</td>
		</tr>
		<tr>
			<td>Model p87 Flaming Brown Micropipette Puller</td>
			<td>Sutter Instrument Co.</td>
			<td></td>
			<td>Capillary Preparation</td>
		</tr>
		<tr>
			<td>Mowiol 4-88</td>
			<td>Sigma-Aldrich</td>
			<td>81381</td>
			<td>for embedding solution</td>
		</tr>
		<tr>
			<td>Nanoliter 2000</td>
			<td>World Precision Instruments Nanoliter</td>
			<td></td>
			<td>Injection Apparatus</td>
		</tr>
		<tr>
			<td>Normal Donkey Serum</td>
			<td>Jackson Research Laboratories</td>
			<td>AB_2337258</td>
			<td>blocking agent for immunocytochemistry</td>
		</tr>
		<tr>
			<td>Non-immune Goat Serum</td>
			<td>Invitrogen</td>
			<td>50-062Z 100 mL</td>
			<td>blocking agent for immunoblotting</td>
		</tr>
		<tr>
			<td>Nuclease-free buffer</td>
			<td>IDT</td>
			<td>1072570</td>
			<td>Nuclease-free buffer that is used in the preparation of CRISPR-Cas9 injection</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>IDT</td>
			<td>AM9337</td>
			<td>nuclease -free water that is used in preparation of CRISPR-Cas 9 system</td>
		</tr>
		<tr>
			<td>OrbitalShaker Mp4</td>
			<td>Genemate</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Sigma-Aldrich</td>
			<td>158127-500 g</td>
			<td>used with PBS to make fixative for bee brains</td>
		</tr>
		<tr>
			<td>Phenylmethylsulphonyl fluoride (PMSF)</td>
			<td>Sigma-Aldrich</td>
			<td>P7626-250 mg</td>
			<td>protease inhibitor</td>
		</tr>
		<tr>
			<td>Phosphate Buffer Saline</td>
			<td>Sigma-Aldrich</td>
			<td>P4417-100TAB</td>
			<td>Used with Paraformaldehyde as fixative; buffer for antibodies</td>
		</tr>
	</tbody>
</table>

anti-rdl and anti-mglutr1 receptors antibody testing in honeybee brain sections using crispr-cas9

Cluster Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) is a gene editing technique widely used in studies of gene function. We use this method in this study to check for the specificity of antibodies developed against the insect GABAA receptor subunit Resistance to Dieldrin (RDL) and a metabotropic glutamate receptor mGlutR1 (mGluRA). The antibodies were generated in rabbits against the conjugated peptides specific to fruit flies (Drosophila melanogaster) as well to honeybees (Apis mellifera). We used these antibodies in honeybee brain sections to study the distribution of the receptors in honeybee brains. The antibodies were affinity purified against the peptide and tested with immunoblotting and the classical method of preadsorption with peptide conjugates to show that the antibodies are specific to the corresponding peptide conjugates against which they were raised. Here we developed the CRISPR-Cas9 technique to test for the reduction of protein targets in the brain 48 h after CRISPR-Cas9 injection with guide RNAs designed for the corresponding receptor. The CRISPR-Cas9 method can also be used in behavioral analyses in the adult bees when one or multiple genes need to be modified.

Anti-RDL antibody tests 
The antibodies were produced against the RDL peptide conjugates as shown in Figure 1A. The first step in characterizing the anti-RDL antibodies is to check the homogenate of the protein extracted from the bee brain using a Western blot with anti-RDL antibodies and a HRP-labeled goat anti-rabbit IgG secondary antibody (Figure 1A, insert). Both anti-RDL antibodies recognized the band located at ~50-60 kD (arrow), corresponding to the estimated weight of the RDL subunit isoform proteins. To demonstrate that anti-RDL antibodies recognized the peptide in the brain slices, we used a preadsorption control (Figure 1B,C). When antibodies were preincubated with conjugated peptides, the staining on the section was absent. This demonstrated that the anti-RDL antibodies recognized the conjugated peptide against which they were raised. In order to demonstrate that the anti-RDL antibodies recognize the protein in the fixed brain tissue, we used CRISPR-Cas9 to knock out the RDL gene that produces the RDL protein in the cells. Figure 1D1-3, shows control frontal bee brain sections that were labeled with anti-RDL antibodies. This bee was not injected with RDL-CRISPR-Cas9 RNP. In Figure 1D1, anti-RDL labels neuropils in the frontal section of the bee brain. The same frontal section in Figure 1D2 shows the absence of fluorescence from ATTO550, because the RDL-CRISPR-Cas9 complex was not injected.
Figure 1E1-E3 shows a brain section from a bee injected with RDL-CRISPR-Cas 9 and then processed with the same amount of antibodies as the control brain in Figure 1D1-D3. The anti-RDL staining was significantly reduced in the whole brain 48 h after the injection, and the distribution of the ATTO550 staining in the brain (Figure 1E2) shows the success of the RDL-CRISPR-Cas 9 injections in the bee median ocelli. The multiple scattered cells of the brain exhibit ATTO550. The successful injection of RDL-CRISPR-Cas 9 reduced the protein expression compared with the control (Figure 1E1-3). From eight immunostained bee brains, only one brain had a high level of distribution of the RDL-CRISPR-Cas9 in the cells of mushroom body, protocerebrum, and antennal lobe, whereas other brains had cell staining with ATTO550 in the mushroom body calyx, central complex, but not antennal lobe. It is important to note that in these bees, reduction anti-RDL immunostaining was not as dramatic as in the brain shown in Figure 1E1.
Next, to estimate the level of the modified RDL gDNA in the bees 48 h after RDL-CRISPR-Cas9 injection, we performed a qPCR drop-off test, where the drop-off probe was designed to match the area of one of the RDL gRNAs. In these experiments, in the bee brains injected with RDL-CRISPR-Cas 9, the relative reduction of the fluorescence corresponded to the number of the modified gDNA in the samples. In our tests the area corresponding to this guide in gDNA in 12 bees injected with RDL-CRISPR-Cas9 were 64 % &#177; (mean &#177; 30 %SD) compared with gDNA in noninjected bees (Figure 3A).
Next, to estimate the level of the RDL RNA in the bees 48 h after injection, we performed qRT-PCR in a separate group of bees (Figure 3B). We compared the level of RDL RNA of RDL-CRISPR-Cas 9 injected bees (n = 19) with the level of RNA in bees that were not injected (n = 12). In these experiments, the relative reduction of the mRNA RDL was 59% &#177; (mean &#177; 15% SE) compared with the level of RNA in non-injected bees. When we examined the level of RDL RNA in each bee individually, only 13 bees out of 19 bees showed a significant reduction of the RNA. These data indicate that injection of RDL-CRISPR-Cas9 through the ocelli might not always reach a large number of brain cells, which confirms the data with RDL immune-stained RDL-CRISPR-Cas9 injected bees. In these preparations, only one bee out of 8 had RDL CRISP-Cas9 in many brain cells (mushroom body, protocerebrum, and antennal lobe) compared with other bee brains, where the distribution of the RDL-CRISPR-Cas9 was concentrated in cells in the protocerebrum (mushroom body calyx and central complex) but not the antennal lobe (Figure 4A-D).
Anti-mGlutR1 antibodies tests 
We used the anti-mGlutR1 antibodies produced in rabbit against conjugated peptides specific to Drosophila melanogaster (Figure 2A). The sequence of this peptide shows a 94% identity with the bee peptide (CLSDKTRFDYFARTVPPD) Figure 2A. First, we checked the antibodies against the bee brain protein using immunoblotting. The bee brain homogenate was separated by 10% SDS-PAGE and electrophoretically transferred from to a nitrocellulose membrane and stained with anti-mGlutR1. The insert in Figure 2A shows two bands with estimated weights (103 and 83 kD) corresponding to two isoforms. When we tested this antibody on honeybee brains, we found that they label neuropilar profiles and cells in the bee brain sections as illustrated in Figure 2B,D. After preadsorption of the anti-mGlutR1 antibody with conjugated-mGlutR1 peptide, the specific staining disappeared in the bee brain slice (Figure 2C). This confirms that anti-mGlutR1 antibodies recognize the peptide (Figure 2C). Next, we injected a mix of mGlutR1-CRISPR-Cas9 in the median ocelli and used the control noguideRNA. In control bees (n = 7), the fluorescence from ATTO550 was not concentrated in the cells. Some brains had scattered fluorescence ATTO550 labeling. Thus, the control preparation in Figure 2D1-3 shows anti-mGlutR1 staining in the brain but not the ATTO550 fluorescence. When mGlutR1-CRISPR-Cas9 was injected into the ocelli and taken up by many cells, the level of fluorescence of the secondary antibodies was significantly reduced in the area that uptakes the functional mGlutR1RNP (Figure 2E1-3). The bees were monitored for 48 h, and one bee from each experimental condition was found dead. Thus, in this experiment, we checked seven control bees and eight CRISPR-Cas9 bees. All the bees injected with CRISPR-Cas9 had cells that took in mGlutR1-CRISPR-Cas9. Most of these cells were in the mushroom body calyx, central complex, and posterior protocerebrum. Only two bees out of seven showed ATTO550 labeling in many cells in the mushroom body, central complex, and the antennal lobe. An example of one of these bees is shown in Figure 2E. The reduction of the level of mGlutR1 staining in these preparations was significant. The other five bees have ATTO550 labeling corresponding to the successful delivery of the mGlutR1 CRISPR-Cas9 in the mushroom body and posterior protocerebrum but not in the antennal lobes.
Next, to estimate the level of the modified mGlutR1 gDNA in the bees 48 h after injection, we performed a qPCR-based drop-off test, where the drop-off probe was designed to be in the area near the mGlutR1 guide. In these experiments, in the bee brains injected with mGlutR1-CRISPR-Cas 9, the relative modification of gDNA in 12 bees were 59% &#177; (mean &#177; 33 %SD) compared with gDNA in noninjected bees (Figure 3A).
These results were also confirmed by qRT-PCR tests in a different group of bees, where we estimated the mGlutR1 RNA levels using qRT-PCR in the bees 48 h after injections with RNPmGlutR1mix (Figure 3B). We compared the level of mGlutR1 RNA of the mGlutR1-CRISPR-Cas9 injected bees (n = 6) with the RNA levels in bees that were not injected (n = 6). In these experiments, the relative reduction of the mRNA mGlutR1 in injected bees was 53% &#177; (mean &#177; 18% SE) compared with uninjected bees (Figure 3B).
The section from four different bees that expressed the RNP RDL-CRISPR-Cas9 in Kenyon cell of mushroom body is shown in Figure 4A-D. The example bee with ATTO550 fluorescence in the mushroom body and the antennal lobe is shown in Figure 4E,F.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Guides</td>
			<td>Sequences</td>
			<td>gRNA</td>
			<td>RNP</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>[guideRNA:tracrRNA]</td>
			<td>[gRNA:Cas9 Nuclease]</td>
		</tr>
		<tr>
			<td>RDL_Guide1</td>
			<td>ACCGTAACGCGACCCCCGCT</td>
			<td>GRDL1</td>
			<td>RRDL1</td>
		</tr>
		<tr>
			<td>RDL_Guide2</td>
			<td>AACGTCGATCGACTTGACGT</td>
			<td>GRDL2</td>
			<td>RRDL2</td>
		</tr>
		<tr>
			<td>RDL_Guide3</td>
			<td>CCATGACGAAACACGTGCCC</td>
			<td>GRDL3</td>
			<td>RRDL3</td>
		</tr>
		<tr>
			<td>mGlu_Guide 1</td>
			<td>CGAAAGTTATCTGACGGTGT</td>
			<td>GMGL1</td>
			<td>RMGL1</td>
		</tr>
		<tr>
			<td>mGlu_Guide 2</td>
			<td>TTCAACGAGAGCAAGTTCAT</td>
			<td>GMGL2</td>
			<td>RMGL2</td>
		</tr>
		<tr>
			<td>mGlu_Guide 3</td>
			<td>GCAAACGTCGGTAGGAGTGA</td>
			<td>GMGL3</td>
			<td>RMGL3</td>
		</tr>
	</tbody>
</table>
Table 1: Nucleotide sequences of guides designed for RDL and mGlutR1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59993/59993fig1a.jpg" /> 
Figure 1: Characterization of anti-RDL antibodies. (A) Schematic of the RDL subunit, where the pink circles indicate the localization of peptide 2 (extracellular CVNEKQSYFHIATTSNEFIRI-amide) in the N-terminus and peptide 1 (intracellular CVRFKVHDPKAHSKGGTL-amide) in the C-terminus. The insert in A shows the bands in the Western blot of honeybee brain extracts processed with corresponding anti-RDL antibodies (one with anti-RDL pep1 and anti-RDL pep2). Each immunoblot shows the apparent size of the protein ~50-60 kD, corresponding to the estimated weights of the various isoform of the RDL subunits. (B,C) Preadsorption of the anti-RDL antibodies with conjugated peptide 1. The image in C shows a reduction in staining in the section when the antibodies were preincubated with conjugated peptide 1. The fan-shaped body (Fb) and Ellipsoid body (eb) are central complex structures in the brain. M = medial lobe of mushroom body. (D1-3) Anti-RDL staining of a control, uninjected bee brain section after 48 h. Green indicates the anti-RDL positive profile in the brain. (D2) This bee was not injected and does not contain ATTO550 fluorescence. (D3) Merged images from D1 and D3. (E1-3) The injection of RDL-CRISPR-Cas9 reduced anti-RDL staining after 48 h. (E2) ATTO550 fluorescence in the cell nuclei indicated successful RDL-CRISPR-Cas9 delivery. (E3) The merged image of anti-RDL (green) and ATTO550 (red). Scale bar = 100 &#956;m (B-E). <a href="https://www.jove.com/files/ftp_upload/59993/59993fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59993/59993fig2a.jpg" /> 
Figure 2: Characterization of anti-mGlutR1 antibodies. (A) Schematic of GCPR mGluR that shows the Drosophila melanogaster peptide used for immunization. For comparison, the Apis mellifera peptide is shown below. The circle indicates the localization of the peptide in the N-terminus of the mGlutR1 receptor extracellular domain. The insert in A shows that the anti-mGlutR1 antibodies recognized two bands in the Western blot of bee brains ~103 kD and ~83 kD that correspond to the estimated weights of known isoforms. (B,C) Preadsorption control of the anti-mGlutR1 antibody in two consecutive sections of the antennal lobe glomeruli. Image of anti-mGlutR1 in the antennal glomeruli section in C shows the reduction of the staining as a result of preincubation of the anti-mGlutR1 peptide with the anti-mGlutR1 antibody. This procedure causes the antibody to precipitate out of solution, which abolishes staining in comparison with B (control, absence of the peptide in the preincubation). (D1) shows staining of anti-mGlutR1 in a bee brain slice after a control injection in the median ocellus. This injection lacked the mGlutR1 gRNA that enables the knock down of mGlutR1 receptors by CRISPR-Cas9, and thus the staining of the anti-mGlutR1 antibody was not reduced (green). (D2) The Absence of ATTO550 fluorescence indicates the absence of functional CRISPR-Cas9 in the brain. (D3) Merged images of anti-mGlutR1 and ATTO550. (E1-E3) show the staining of anti-mGlutR1 in a brain section where mGlutR1 has been permanently knocked down 48 h after injection with mGlutR1-CRISPR-Cas 9 in the median ocellus. Thus, the staining in this brain is greatly reduced due to the successful knockout of the mGlutR1 in many cells. (E2) ATTO550 staining in many cell nuclei in the bee brains indicates that injection of mGlut1-CRISPR-Cas 9 was successful. (E3) Merged image of ATTO550 (red) and anti-mGlutR1 (green). Scale bar = 10 &#956;m (B,C); 100 &#956;m (D,E). <a href="https://www.jove.com/files/ftp_upload/59993/59993fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59993/59993fig3.jpg" /> 
Figure 3: Evaluation of modified gDNA and expression of mRNA of RDL and mGlutR1 mRNA in bee brains 48 h after injection with 345 nL of corresponding RPN CRISPR-Cas9. (A) The qPCR-based drop-off assay test to evaluate the amount of gDNA with a modify area were calculated using 2-&#916;&#916;Ct method and normalized against control, uninjected brains. The data are expressed as mean + SD. (B) TheqRT-PCR test was used to evaluate the amount of mRNA in CRISPR-Cas9 injected and uninjected bees. AmActin was used as a reference gene. The relative gene expression was calculated using 2-&#916;&#916;Ct methods and normalized against control, uninjected brains. The data are expressed as mean + SE. <a href="https://www.jove.com/files/ftp_upload/59993/59993fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59993/59993fig4a.jpg" /> 
Figure 4: Example of the distribution of RNP CRISPR-Cas9 in bee brains via ATTO550 fluorescence. (A-D) The brain sections from four different bees that expressed the RNP RDL-CRISPR-Cas9 in the Kenyon cell of the mushroom body. (E,F) Example of two brains 48 h after injection with RNPmGlutR1 CRISPR-Cas9. Scale bar = 150 &#956;m (A-F). <a href="https://www.jove.com/files/ftp_upload/59993/59993fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Anti-RDL and Anti-mGlutR1 Receptors Antibody Testing in Honeybee Brain Sections using CRISPR-Cas9 at JoVE.com

Anti-RDL and Anti-mGlutR1 Receptors Antibody Testing in Honeybee Brain Sections using CRISPR-Cas9

Presented here is a protocol to use the CRISPR-Cas9 system for reducing the production of a protein in the adult honeybee brain to test antibody specificity.

Cluster Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) is a gene editing technique widely used in studies of ...

anti-rdl-anti-mglutr1-receptors-antibody-testing-honeybee-brain

Research

JoVE Journal

Neuroscience

8.0K Views.  University of Arizona. Presented here is a protocol to use the CRISPR-Cas9 system for reducing the production of a protein in the adult honeybee brain to test antibody specificity.

Video: Anti-RDL and Anti-mGlutR1 Receptors Antibody Testing in Honeybee Brain Sections using CRISPR-Cas9

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh frozen brain sections. Our group has successfully used this approach to study gene co-regulation. More specifically, we have used this dFISH method to explore the anatomical organization, neurochemical properties, and the impact of sensory experience in central sensory circuits, at single cell resolution. This protocol has been validated in brain tissue from mice, rats and songbirds but is expected to be easily adaptable to other vertebrate species, as well as to an array of non-neural tissues. In this film we provide a detailed demonstration of the main steps of this procedure.

Double Fluorescence in situ Hybridization in Fresh Brain Sections

This protocol involves a non-radioactive in-situ hybridization procedure that enables the simultaneous identification of two transcript species, at a single cell resolution, in thin sections of the vertebrate brain.

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh ...

Morphometric Analyses of Retinal Sections

Morphometric analyses of retinal sections have been used in examining retinal diseases. For examples, neuronal cells were significantly lost in the retinal ganglion cell layer (RGCL) in rat models with N-methyl-D-aspartate (NMDA)&#x2013;induced excitotoxicity1, retinal ischemia-reperfusion injury2 and glaucoma3. Reduction of INL and inner plexiform layer (IPL) thicknesses were reversed with citicoline treatment in rats' eyes subjected to kainic acid-mediated glutamate excitotoxicity4. Alteration of RGC density and soma sizes were observed with different drug treatments in eyes with elevated intraocular pressure3,5,6. Therefore, having objective methods of analyzing the retinal morphometries may be of great significance in evaluating retinal pathologies and the effectiveness of therapeutic strategies.
The retinal structure is multi-layers and several different kinds of neurons exist in the retina. The morphometric parameters of retina such as cell number, cell size and thickness of different layers are more complex than the cell culture system. Early on, these parameters can be detected using other commercial imaging software. The values are normally of relative value, and changing to the precise value may need further accurate calculation. Also, the tracing of the cell size and morphology may not be accurate and sensitive enough for statistic analysis, especially in the chronic glaucoma model. The measurements used in this protocol provided a more precise and easy way. And the absolute length of the line and size of the cell can be reported directly and easy to be copied to other files. For example, we traced the margin of the inner and outer most nuclei in the INL and formed a line then using the software to draw a 90 degree angle to measure the thickness. While without the help of the software, the line maybe oblique and the changing of retinal thickness may not be repeatable among individual observers. In addition, the number and density of RGCs can also be quantified. This protocol successfully decreases the variability in quantitating features of the retina, increases the sensitivity in detecting minimal changes.
 	This video will demonstrate three types of morphometric analyses of the retinal sections. They include measuring the INL thickness, quantifying the number of RGCs and measuring the sizes of RGCs in absolute value. These three analyses are carried out with Stereo Investigator (MBF Bioscience &mdash; MicroBrightField, Inc.). The technique can offer a simple but scientific platform for morphometric analyses.

This video demonstrates three types of morphometric analyses of the retina, which include measuring the inner nuclear layer thickness, quantifying the number of retinal ganglion cells (RGCs) and measuring the sizes of RGCs. The technique can offer a simple but scientific platform for morphometric analyses.

Morphometric analyses of retinal sections have been used in examining retinal diseases. For examples, neuronal cells were significantly lost in the ...

Functional Neuroimaging Using Ultrasonic Blood-brain Barrier Disruption and Manganese-enhanced MRI

Although mice are the dominant model system for studying the genetic and molecular underpinnings of neuroscience, functional neuroimaging in mice remains technically challenging. One approach, Activation-Induced Manganese-enhanced MRI (AIM MRI), has been used successfully to map neuronal activity in rodents 1-5. In AIM MRI, Mn2+ acts a calcium analog and accumulates in depolarized neurons 6,7. Because Mn2+ shortens the T1 tissue property, regions of elevated neuronal activity will enhance in MRI. Furthermore, Mn2+ clears slowly from the activated regions; therefore, stimulation can be performed outside the magnet prior to imaging, enabling greater experimental flexibility. However, because Mn2+ does not readily cross the blood-brain barrier (BBB), the need to open the BBB has limited the use of AIM MRI, especially in mice.
One tool for opening the BBB is ultrasound. Though potentially damaging, if ultrasound is administered in combination with gas-filled microbubbles (i.e., ultrasound contrast agents), the acoustic pressure required for BBB opening is considerably lower. This combination of ultrasound and microbubbles can be used to reliably open the BBB without causing tissue damage 8-11.
Here, a method is presented for performing AIM MRI by using microbubbles and ultrasound to open the BBB. After an intravenous injection of perflutren microbubbles, an unfocused pulsed ultrasound beam is applied to the shaved mouse head for 3 minutes. For simplicity, we refer to this technique of BBB Opening with Microbubbles and UltraSound as BOMUS 12. Using BOMUS to open the BBB throughout both cerebral hemispheres, manganese is administered to the whole mouse brain. After experimental stimulation of the lightly sedated mice, AIM MRI is used to map the neuronal response.
To demonstrate this approach, herein BOMUS and AIM MRI are used to map unilateral mechanical stimulation of the vibrissae in lightly sedated mice 13. Because BOMUS can open the BBB throughout both hemispheres, the unstimulated side of the brain is used to control for nonspecific background stimulation. The resultant 3D activation map agrees well with published representations of the vibrissae regions of the barrel field cortex 14. The ultrasonic opening of the BBB is fast, noninvasive, and reversible; and thus this approach is suitable for high-throughput and/or longitudinal studies in awake mice.

A technique is described for broadly opening the blood-brain barrier in the mouse using microbubbles and ultrasound. Using this technique, manganese can be administered to the mouse brain. Because manganese is an MRI contrast agent that accumulates in depolarized neurons, this approach enables imaging of neuronal activity.

Although mice are the dominant model system for studying the genetic and molecular underpinnings of neuroscience, functional neuroimaging in mice remains ...

Immunohistochemical Analysis in the Rat Central Nervous System and Peripheral Lymph Node Tissue Sections

Immunohistochemistry (IHC) provides highly specific, reliable and attractive protein visualization. Correct performance and interpretation of an IHC-based multicolor labeling is challenging, especially when utilized for assessing interrelations between target proteins in the tissue with a high fat content such as the central nervous system (CNS).
Our protocol represents a refinement of the standard immunolabeling technique particularly adjusted for detection of both structural and soluble proteins in the rat CNS and peripheral lymph nodes (LN) affected by neuroinflammation. Nonetheless, with or without further modifications, our protocol could likely be used for detection of other related protein targets, even in other organs and species than here presented.

We here present an optimized, detailed protocol for double immunostaining in formalin-fixed, paraffin-embedded rat central nervous system (CNS) and peripheral lymph node (LN) tissue sections.

Immunohistochemistry (IHC) provides highly specific, reliable and attractive protein visualization. Correct performance and interpretation of an IHC-based ...

Inducing Plasticity of Astrocytic Receptors by Manipulation of Neuronal Firing Rates

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be stimulated by neuronally-released transmitter. However, the ability of astrocytic receptors to exhibit plasticity in response to changes in neuronal activity has received little attention. Here we describe a model system that can be used to globally scale up or down astrocytic group I metabotropic glutamate receptors (mGluRs) in acute brain slices. Included are methods on how to prepare parasagittal hippocampal slices, construct chambers suitable for long-term slice incubation, bidirectionally manipulate neuronal action potential frequency, load astrocytes and astrocyte processes with fluorescent Ca2+ indicator, and measure changes in astrocytic Gq GPCR activity by recording spontaneous and evoked astrocyte Ca2+ events using confocal microscopy. In essence, a &#8220;calcium roadmap&#8221; is provided for how to measure plasticity of astrocytic Gq GPCRs. Applications of the technique for study of astrocytes are discussed. Having an understanding of how astrocytic receptor signaling is affected by changes in neuronal activity has important implications for both normal synaptic function as well as processes underlying neurological disorders and neurodegenerative disease.

Here we describe an adaptation of protocols used to induce homeostatic plasticity in neurons for the study of plasticity of astrocytic G protein-coupled receptors. Recently used to examine changes in astrocytic group I mGluRs in juvenile mice, the method can be applied to measure scaling of various astrocytic GPCRs, in tissue from adult mice in situ and in vivo, and to gain a better appreciation of the sensitivity of astrocytic receptors to changes in neuronal activity.

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be ...

Detection of Axonally Localized mRNAs in Brain Sections Using High-Resolution In Situ Hybridization

mRNAs are frequently localized to vertebrate axons and their local translation is required for axon pathfinding or branching during development and for maintenance, repair or neurodegeneration in postdevelopmental periods. High throughput analyses have recently revealed that axons have a more dynamic and complex transcriptome than previously expected. These analysis, however have been mostly done in cultured neurons where axons can be isolated from the somato-dendritic compartments. It is virtually impossible to achieve such isolation in whole tissues in vivo. Thus, in order to verify the recruitment of mRNAs and their functional relevance in a whole animal, transcriptome analyses should ideally be combined with techniques that allow the visualization of mRNAs in situ. Recently, novel ISH technologies that detect RNAs at a single-molecule level have been developed. This is especially important when analyzing the subcellular localization of mRNA, since localized RNAs are typically found at low levels. Here we describe two protocols for the detection of axonally-localized mRNAs using a novel ultrasensitive RNA ISH technology. We have combined RNAscope ISH with axonal counterstain using fluorescence immunohistochemistry or histological dyes to verify the recruitment of Atf4 mRNA to axons in vivo in the mature mouse and human brains.

Detection of Axonally Localized mRNAs in Brain Sections Using High-Resolution In Situ Hybridization

RNA in situ hybridization (ISH) enables the visualization of RNAs in cells and tissues. Here we show how combination of RNAscope ISH with immunohistochemistry or histological dyes can be successfully used to detect mRNAs localized to axons in sections of mouse and human brains.

mRNAs are frequently localized to vertebrate axons and their local translation is required for axon pathfinding or branching during development and for ...

Simultaneous ex vivo Functional Testing of Two Retinas by in vivo Electroretinogram System

An In vivo electroretinogram (ERG) signal is composed of several overlapping components originating from different retinal cell types, as well as noise from extra-retinal sources. Ex vivo ERG provides an efficient method to dissect the function of retinal cells directly from an intact isolated retina of animals or donor eyes. In addition, ex vivo ERG can be used to test the efficacy and safety of potential therapeutic agents on retina tissue from animals or humans. We show here how commercially available in vivo ERG systems can be used to conduct ex vivo ERG recordings from isolated mouse retinas. We combine the light stimulation, electronic and heating units of a standard in vivo system with custom-designed specimen holder, gravity-controlled perfusion system and electromagnetic noise shielding to record low-noise ex vivo ERG signals simultaneously from two retinas with the acquisition software included in commercial in vivo systems. Further, we demonstrate how to use this method in combination with pharmacological treatments that remove specific ERG components in order to dissect the function of certain retinal cell types.

Simultaneous ex vivo Functional Testing of Two Retinas by in vivo Electroretinogram System

Ex vivo ERG can be used to record electrical activity of retinal cells directly from isolated intact retinas of animals or humans. We demonstrate here how common in vivo ERG systems can be adapted for ex vivo ERG recordings in order to dissect the electrical activity of retinal cells.

An In vivo electroretinogram (ERG) signal is composed of several overlapping components originating from different retinal cell types, as well as noise ...

Combined Optogenetic and Freeze-fracture Replica Immunolabeling to Examine Input-specific Arrangement of Glutamate Receptors in the Mouse Amygdala

Freeze-fracture electron microscopy has been a major technique in ultrastructural research for over 40 years. However, the lack of effective means to study the molecular composition of membranes produced a significant decline in its use. Recently, there has been a major revival in freeze-fracture electron microscopy thanks to the development of effective ways to reveal integral membrane proteins by immunogold labeling. One of these methods is known as detergent-solubilized Freeze-fracture Replica Immunolabeling (FRIL).
The combination of the FRIL technique with optogenetics allows a correlated analysis of the structural and functional properties of central synapses. Using this approach it is possible to identify and characterize both pre- and postsynaptic neurons by their respective expression of a tagged channelrhodopsin and specific molecular markers. The distinctive appearance of the postsynaptic membrane specialization of glutamatergic synapses further allows, upon labeling of ionotropic glutamate receptors, to quantify and analyze the intrasynaptic distribution of these receptors. Here, we give a step-by-step description of the procedures required to prepare paired replicas and how to immunolabel them. We will also discuss the caveats and limitations of the FRIL technique, in particular those associated with potential sampling biases. The high reproducibility and versatility of the FRIL technique, when combined with optogenetics, offers a very powerful approach for the characterization of different aspects of synaptic transmission at identified neuronal microcircuits in the brain.
Here, we provide an example how this approach was used to gain insights into structure-function relationships of excitatory synapses at neurons of the intercalated cell masses of the mouse amygdala. In particular, we have investigated the expression of ionotropic glutamate receptors at identified inputs originated from the thalamic posterior intralaminar and medial geniculate nuclei. These synapses were shown to relay sensory information relevant for fear learning and to undergo plastic changes upon fear conditioning.

This article illustrates how the expression of neurotransmitter receptors can be quantified and the pattern analyzed at synapses with identified pre and postsynaptic elements using a combination of viral transduction of optogenetic tools and the freeze-fracture replica immunolabeling technique.

Freeze-fracture electron microscopy has been a major technique in ultrastructural research for over 40 years. However, the lack of effective means to ...

Imaging Neurons within Thick Brain Sections Using the Golgi-Cox Method

The Golgi-Cox method of neuron staining has been employed for more than two hundred years to advance our understanding of neuron morphology within histological brain samples. While it is preferable from a practical perspective to prepare brain sections at the greatest thickness possible, in order to increase the probability of identifying stained neurons that are fully contained within single sections, this approach is limited from a technical perspective by the working distance of high-magnification microscope objectives. We report here a protocol to stain neurons using the Golgi-Cox method in mouse brain sections that are cut at 500 &#956;m thickness, and to visualize neurons throughout the depth of these sections using an upright microscope fitted with a high-resolution 30X 1.05 N.A. silicone oil-immersion objective that has an 800 &#956;m working distance. We also report two useful variants of this protocol that may be employed to counterstain the surface of mounted brain sections with the cresyl violet Nissl stain, or to freeze whole brains for long-term storage prior to sectioning and final processing. The main protocol and its two variants produce stained thick brain sections, throughout which full neuron dendritic&#160;trees and dendrite spines may be reliably visualized and quantified.

We present a protocol for using the Golgi-Cox staining method in thick brain sections, in order to visualize neurons with long dendritic&#160;trees contained within single tissue samples. Two variants of this protocol are also presented that involve cresyl violet counterstaining, and the freezing of unprocessed brains for long-term storage.

The Golgi-Cox method of neuron staining has been employed for more than two hundred years to advance our understanding of neuron morphology within ...

Making, Testing, and Using Potassium Ion Selective Microelectrodes in Tissue Slices of Adult Brain

Potassium ions significantly contribute to the resting membrane potential of cells and, therefore, extracellular K+ concentration is a crucial regulator of cell excitability. Altered concentrations of extracellular K+ affect the resting membrane potential and cellular excitability by shifting the equilibria between closed, open and inactivated states for voltage-dependent ion channels that underlie action potential initiation and conduction. Hence, it is valuable to directly measure extracellular K+ dynamics in health and diseased states. Here, we describe how to make, calibrate and use monopolar K+-selective microelectrodes. We deployed them in adult hippocampal brain slices to measure electrically evoked K+ concentration dynamics. The judicious use of such electrodes is an important part of the tool-kit needed to evaluate cellular and biophysical mechanisms that control extracellular K+ concentrations in the nervous system.

Potassium ions contribute&#160;to the resting membrane potential of cells and extracellular K+ concentration is a crucial regulator of cellular excitability. We describe how to make, calibrate and use monopolar K+-selective microelectrodes. Using such electrodes enables the measurement of electrically evoked K+ concentration dynamics in adult hippocampal slices.

Potassium ions significantly contribute to the resting membrane potential of cells and, therefore, extracellular K+ concentration is a crucial regulator ...