This work was supported by UNAM Technology Innovation and Research Support Program (PAPIIT) grant number IN207319 and the Science and Technology National Council (CONACyT-FORDECyT) grant number 303068. A.E.-L. is a master&#39;s student supported by the Science and Technology National Council (CONACyT) CVU number 968128.

1. Fixation
<ol>
	<li>Start with 10 million Schneider&#39;s line 2 plus (S2R+) cells to prepare 17.5 mL of a cell suspension in Schneider medium containing 10% fetal bovine serum (FBS) at room temperature (RT).</li>
	<li>Add methanol-free formaldehyde to obtain a final concentration of 2%. Mix and incubate for 10 min at RT, taking care to mix every minute. 
	NOTE: Formaldehyde is a hazardous chemical. Follow the appropriate health and safety regulations, and work in the fume hood.</li>
	<li>Quench the reaction by adding glycine to achieve a final concentration of 0.125 M and mix. Incubate for 5 min at RT, followed by 15 min on ice.</li>
	<li>Centrifuge for 400 &#215; g at RT for 5 min and then for 10 min at 4 &#176;C; discard the supernatant. Resuspend the pellet carefully in 25 mL of cold 1x phosphate-buffered saline.</li>
	<li>Centrifuge at 400 &#215; g for 10 min at 4 &#176;C, then discard the supernatant. 
	NOTE: If continuing with the protocol, go to step 2.1 for lysis; otherwise, flash-freeze the pellet in liquid N2 and store the pellet at -80 &#176;C.</li>
</ol>
2. Lysis
<ol>
	<li>Resuspend the cells in 1 mL of ice-cold lysis buffer (10 mM Tris-HCl, pH 8; 0.2% of non-ionic surfactant (see the Table of Materials); 10 mM NaCl; 1x protease inhibitors), and adjust the volume to 10 mL with ice-cold lysis buffer. Adjust the volume to obtain a concentration of 1 &#215; 106 cells/mL. Incubate on ice for 30 min, mixing every 2 min by inverting the tubes.</li>
	<li>Centrifuge the nuclei at 300 &#215; g for 5 min at 4 &#176;C, and then carefully discard the supernatant. Wash the pellet 1x with 1 mL of cold lysis buffer, and transfer it to a microcentrifuge tube. Wash the pellet 1x with 1 mL of cold 1.25x restriction buffer, and resuspend each cell pellet in 360 &#181;L of 1.25x restriction buffer.</li>
	<li>Add 11 &#181;L of 10% sodium dodecyl sulfate (SDS) per tube (0.3% final concentration), mix carefully by pipetting, and incubate at 37 &#176;C for 45 min, shaking at 700-950 rpm. Pipet up and down to disrupt clumps a few times during incubation.</li>
	<li>Quench the SDS by adding 75 &#181;L of non-ionic surfactant (10% solution, see the Table of Materials) per tube (1.6% final concentration), and incubate at 37 &#176;C for 45 min, shaking at 950 rpm. Pipet up and down a few times to disrupt clumps during incubation. 
	NOTE: If clumps are large and difficult to disrupt, decrease the rotating speed to 400 rpm during SDS and surfactant treatments. If the clumps are difficult to disaggregate by pipetting, split the sample into two; adjust the volumes of restriction buffer, SDS, and surfactant; and proceed with the permeabilization. Next, spin the nuclei at minimum speed (200 &#215; g), carefully discard the supernatant, pool the samples together in&#160;1X&#160;restriction&#160;buffer, and proceed with digestion. Take a 10 &#181;L aliquot as the undigested sample (UD).</li>
</ol>
3. Enzymatic digestion
<ol>
	<li>Digest the chromatin by adding 200 units (U) of Mbo I per tube, and incubate at 37 &#176;C for a period ranging from 4 h to overnight while rotating (950 rpm).</li>
	<li>On the next day, add an additional 50 U of Mbo I per tube, and incubate at 37 &#176;C for 2 h while rotating (950 rpm).</li>
	<li>Inactivate the enzyme by incubating the tubes at 60 &#176;C for 20 min. Place the tubes on ice. 
	NOTE: Take a 10 &#181;L aliquot as the digested sample (D).</li>
</ol>
4. Biotinylation of DNA ends
<ol>
	<li>To fill in the restriction fragment overhangs and label the DNA ends with biotin, add 1.5 &#181;L each of 10 mM dCTP, dGTP, dTTP, 20 &#181;L of 0.4 mM biotin dATP, 17.5 &#181;L of Tris low-EDTA (TLE) buffer [10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0], and 10 &#181;L of 5 U/&#181;L of Klenow (DNA polymerase I large fragment) to all the tubes. Mix carefully and incubate for 75 min at 37 &#176;C. Shake at 700 rpm every 10 s for 30 s. Place all the tubes on ice while preparing the ligation mix.</li>
</ol>
5. Ligation
<ol>
	<li>Transfer each digested chromatin mixture to a separate 1 mL tube with ligation mix (100 &#181;L of 10x ligation buffer, 10 &#181;L of 10 mg/mL bovine serum albumin, 15 U of T4 DNA ligase, and 425 &#181;L of double-distilled water [ddH2O]). Mix thoroughly by gentle pipetting, and incubate overnight at 16 &#176;C.</li>
</ol>
6. Crosslink reversal and DNA purification
<ol>
	<li>Degrade proteins by adding 50 &#181;L of 10 mg/mL Proteinase K per tube, and incubate at 37 &#176;C for 2 h. Reverse crosslinks by increasing the temperature to 65 &#176;C and incubate overnight.</li>
	<li>Degrade RNA by adding 20 &#181;L of 10 mg/mL RNase A, and incubate at 37 &#176;C for 1 h.</li>
	<li>Perform phenol:chloroform extraction followed by ethanol precipitation.
	<ol>
		<li>Add 1 volume of phenol-chloroform, and mix thoroughly by inversion to obtain a homogeneous white phase. 
		NOTE: Phenol is a hazardous chemical. Follow the appropriate health and safety regulations. Work in the fume hood.</li>
		<li>Centrifuge at 15,000 &#215; g for 15 min. Transfer the aqueous phase into a fresh 2 mL microcentrifuge tube. Perform a back-extraction of the lower layer with 100 &#181;L of TLE buffer, and transfer the aqueous phase into the same 2 mL tube.</li>
		<li>Precipitate DNA by adding 2 volumes of 100% ethyl alcohol (EtOH), 0.1 volumes of 3 M sodium acetate, and 2 &#181;L of 20 mg/mL glycogen. Incubate at -20 &#176;C for a period ranging from 2 h to overnight.</li>
		<li>Spin at 15,000 &#215; g for 30 min at 4 &#176;C, and wash the pellets 2x with ice-cold 70% EtOH. Dry the pellets at RT, and resuspend in 100 &#181;L of TLE buffer. Quantify the DNA using a fluorogenic dye that binds selectively to DNA and a fluorometer according to the manufacturer&#39;s instructions (Table of Materials). 
		NOTE: The protocol can be paused here. Store ligation products at 4 &#176;C for the short term or at -20 &#176;C for the long term. Use an aliquot (100 ng) of the material as the ligated sample (L) for quality control.</li>
	</ol>
	</li>
</ol>
7.&#160;Assess Hi-C template quality
<ol>
	<li>Digestion and ligation qualitative controls
	<ol>
		<li>Purify DNA from the UD and D aliquots by reversing the crosslinks, and perform phenol:chloroform extraction and ethanol precipitation as described above.</li>
		<li>Load 100 ng of UD, D, and L samples in a 1.5% agarose gel. Look for a smear centered around 500 bp in the D sample versus a high molecular weight band for the L sample (see representative results).</li>
	</ol>
	</li>
	<li>Digestion efficiency quantitative control 
	NOTE: To assess the digestion efficiency more accurately, use the UD and D samples as templates to perform quantitative polymerase chain reactions (qPCR) using primers designed as follows.
	<ol>
		<li>Design a primer pair that amplifies a DNA fragment containing the DNA restriction site for the enzyme used for digestion (Mbo I in the present protocol), called R in the formula in step 7.2.3.</li>
		<li>Design a primer pair that amplifies a control DNA fragment that does not contain the restriction site for the enzyme used for digestion (Mbo I for the present protocol), called C in the formula in step 7.2.3.</li>
		<li>Use the cycle threshold values (Ct values) of the amplification to calculate restriction efficiency according to the formula shown below: 
		% Restriction = 100 - 100/2{(CtR - CtC)D - (CtR - CtC)UD} 
		Where CtR refers to the Ct value of fragment R, and CtC refers to the Ct value of the fragment C for sample D and sample UD. 
		NOTE: The restriction percentage reflects the efficiency of the restriction enzyme cleaving the restricted (R) DNA fragment compared to a control (C) DNA fragment that does not contain the restriction DNA site. A restriction efficiency of &#8805; 80% is recommended.</li>
	</ol>
	</li>
	<li>Detection of known interactions
	<ol>
		<li>Perform PCR to amplify an internal ligation control to examine short-range and/or medium- or long-range interactions (see representative results).</li>
		<li>Alternatively, design primers to amplify a ligation product in which the primers are in forward-forward or reverse-reverse orientation in adjacent restriction fragments.</li>
	</ol>
	</li>
	<li>Fill-in and biotin-labeling control
	<ol>
		<li>Verify Hi-C marking and ligation efficiency by amplification and digestion of a known interaction or a ligation product between adjacent restriction fragments in the genome, as described above. 
		NOTE: Successful fill-in and ligation of the Mbo I site (GATC) generates a new site for the restriction enzyme Cla I (ATCGAT) at the ligation junction and regenerates the Mbo I site.</li>
		<li>Digest the PCR product with Mbo I, Cla I, or both. After running the samples on a 1.5-2% gel, estimate the relative number of 3C and Hi-C ligation junctions by quantifying the intensity of the cut and uncut bands26. 
		NOTE: An efficiency of &#62; 70% is desired (see representative results).</li>
	</ol>
	</li>
</ol>
8. Sonication
<ol>
	<li>Sonicate the samples to obtain 200-500 bp DNA fragments. For the instrument used in this protocol (see the Table of Materials), dilute the sample (from 5 to 10 &#181;g) in 130 &#181;L of ddH2O per tube, and set the instrument to sonicate to 400 bp: fill level: 10; duty factor: 10%; peak incident power (w): 140; cycles per burst: 200; time (s): 80.</li>
</ol>
9. Biotin removal/end repair
NOTE: The steps shown below are adjusted for 5 &#181;g of Hi-C DNA.
<ol>
	<li>To perform biotin removal, transfer the sample (130 &#181;L) into a fresh microcentrifuge tube. Add 16 &#181;L of 10x ligation buffer, 2 &#181;L of 10 mM dATP, 5 &#181;L of T4 DNA Polymerase (15U), and 7 &#181;L of ddH2O (160 &#181;L of total volume). Incubate at 20 &#176;C for 30 min.</li>
	<li>Add 5 &#181;L of 10 mM dNTPs, 4 &#181;L of 10x ligation buffer, 5 &#181;L of T4 polynucleotide kinase (10 U/&#181;L), 1 &#181;L of Klenow, and 25 &#181;L of ddH2O (200 &#181;L of total volume). Incubate at 20 &#176;C for 30 min.</li>
</ol>
10. Size selection
<ol>
	<li>To select fragments mostly in the 250-550 bp size range, perform sequential solid phase reversible immobilization (SPRI) size selection first with 0.6x, followed by 0.90x according to the manufacturer&#39;s instructions, and elute the DNA using 100 &#181;L of TLE.</li>
</ol>
11. Biotin pulldown/A-tailing/adapter ligation
NOTE:&#160;Perform the washes by resuspending the magnetic beads by vortexing, rotate the samples for 3 min on a rotating wheel, and then briefly spin down the sample and place it on the magnetic stand. Allow the beads to stick to the magnet, discard the supernatant, and proceed with the following wash step. Perform the washes at 55 &#176;C on a thermo-block with rotation instead of the rotating wheel.
<ol>
	<li>Make up the final volume to 300 &#181;L per sample with TLE for pull-down. Prepare the bead-washing buffers: 1x Tween Buffer (TB) (TB: 5 mM Tris-HCl pH 8.0, 0.5 mM EDTA, 1 M NaCl, 0.05% Tween), 0.5x TB, 1x No-Tween buffer (NTB) (5 mM Tris-HCl pH 8.0, 0.5 mM EDTA, 1 M NaCl), 2x NTB.</li>
	<li>Use 150 &#181;L of streptavidin-linked magnetic beads (see the Table of Materials) per library. Wash the beads 2x with 400 &#181;L of 1x TB.&#160;Then resuspend beads in 300 &#181;L 2x NTB.</li>
	<li>Mix the beads with the 300 &#181;L Hi-C material and incubate at RT for 30 minutes on a rotating wheel to allow biotin binding to streptavidin beads.</li>
	<li>Wash the beads with 400 &#181;L of 0.5x TB, and incubate at 55 &#176;C for 3 min, rotating at 750 rpm. Wash the beads in 200 &#181;L of 1x restriction buffer.</li>
	<li>Resuspend the beads in 100 &#181;L of dATP tailing mix (5 &#181;L of 10 mM dATP, 10 &#181;L of 10x restriction buffer, 5 &#181;L of Klenow exo-, and 80 &#181;L of ddH2O). Incubate at 37 &#176;C for 30 min.</li>
	<li>Remove the supernatant, wash the beads 2x with 400 &#181;L of 0.5x TB by incubating at 55 &#176;C for 3 min and rotating at 750 rpm.</li>
	<li>Wash the beads with 400 &#181;L of 1x NTB and then with 100 &#181;L of 1x ligation buffer.</li>
	<li>Resuspend the beads in 50 &#181;L of 1x ligation buffer, and transfer the suspension to a new tube. Add 4 &#181;L of pre-annealed PE adapters (15 &#181;M stock) and 2 &#181;L of T4 ligase (400 U/&#181;L, i.e., 800 U/tube); incubate at RT for 2 h. 
	NOTE: Pre-anneal the adapters by adding equal volumes of both PE 1.0 and PE 2.0 adapters (30 &#181;M stock) and incubating for 10 min at RT (see the Table of Materials).</li>
	<li>Recapture the beads by removing the supernatant and washing the beads 2x with 400 &#181;L of TB. Wash the beads with 200 &#181;L of 1x NTB, then with 100 &#181;L of 1x restriction buffer, and resuspend the beads in 40 &#181;L of 1x restriction buffer.</li>
</ol>
12. PCR amplification
<ol>
	<li>Set up PCRs of 25 &#181;L volume with 5, 6, 7, and 8 cycles. For each PCR, use:
	<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
		<tbody>
			<tr>
				<td colspan="2">Reaction Recipe</td>
			</tr>
			<tr>
				<td>Hi-C beads</td>
				<td>2.5 &#181;L</td>
			</tr>
			<tr>
				<td>10 &#181;M PE PCR primer 1 (Table of Materials)</td>
				<td>0.75 &#181;L</td>
			</tr>
			<tr>
				<td>10 &#181;M PE PCR primer 2 (Table of Materials)</td>
				<td>0.75 &#181;L</td>
			</tr>
			<tr>
				<td>10 mM dNTP</td>
				<td>0.6 &#181;L</td>
			</tr>
			<tr>
				<td>5x reaction buffer</td>
				<td>5 &#181;L</td>
			</tr>
			<tr>
				<td>DNA polymerase</td>
				<td>0.3 &#181;L</td>
			</tr>
			<tr>
				<td>ddH2O</td>
				<td>14.65 &#181;L</td>
			</tr>
			<tr>
				<td>Total</td>
				<td>25 &#181;L</td>
			</tr>
		</tbody>
	</table>
	<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
		<tbody>
			<tr>
				<td>Cycles</td>
				<td>Temperature</td>
				<td>Time</td>
			</tr>
			<tr>
				<td>1</td>
				<td>98 &#176;C</td>
				<td>30 s</td>
			</tr>
			<tr>
				<td rowspan="3">n cycles</td>
				<td>98 &#176;C</td>
				<td>10 s</td>
			</tr>
			<tr>
				<td>65 &#176;C</td>
				<td>30 s</td>
			</tr>
			<tr>
				<td>72 &#176;C</td>
				<td>30 s</td>
			</tr>
			<tr>
				<td>1</td>
				<td>72 &#176;C</td>
				<td>7 min</td>
			</tr>
		</tbody>
	</table>
	</li>
</ol>
13. Final PCR amplification
<ol>
	<li>Perform final PCR amplification using the same conditions as described above and the number of cycles selected. Split the sample using 5 &#181;L of Hi-C beads as template in 50 &#181;L reactions.</li>
	<li>Collect all PCR reactions and transfer them to a fresh tube. Use the magnet to remove the streptavidin beads and recover the supernatant (PCR products). Transfer the beads to a fresh tube, wash the beads as indicated in step 11.2.9, and store in 1x restriction buffer at 4 &#176;C as a backup.</li>
	<li>Purify the PCR products using 0.85x the volume of the SPRI beads according to the manufacturer&#180;s instructions. Elute with 30 &#181;L of TLE buffer.</li>
	<li>Quantify the Hi-C library using a fluorometric instrument, and confirm the quality of the library by chip-based capillary electrophoresis.</li>
	<li>As a last quality checkpoint, use 1 &#181;L of the Hi-C library as a template to perform a PCR reaction using 10 cycles using the same conditions described in step 12.1. Divide the PCR product into two microcentrifuge tubes: digest one with Cla I and leave the other one undigested as a control. Run the products in a 1.5-2% agarose gel (see representative results).</li>
	<li>Proceed to 50 bp or 75 bp paired-end sequencing on a suitable sequencing platform.</li>
</ol>

<ol>
	<li>Cremer, T., Cremer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosome+territories,+nuclear+architecture+and+gene+regulation+in+mammalian+cells.">Chromosome territories, nuclear architecture and gene regulation in mammalian cells.</a> Nature Review Genetics. 2, 292-301 (2001).</li><li>Lieberman-Aiden, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+mapping+of+long-range+interactions+reveals+folding+principles+of+the+human+genome.">Comprehensive mapping of long-range interactions reveals folding principles of the human genome.</a> Science. 326, 289-293 (2009).</li><li>Dixon, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Topological+domains+in+mammalian+genomes+identified+by+analysis+of+chromatin+interactions.">Topological domains in mammalian genomes identified by analysis of chromatin interactions.</a> Nature. 485, 376-380 (2012).</li><li>Sexton, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+folding+and+functional+organization+principles+of+the+Drosophila+genome.">Three-dimensional folding and functional organization principles of the Drosophila genome.</a> Cell. 148 (3), 458-472 (2012).</li><li>Dixon, J. R., Gorkin, D. U., Ren, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+domains:+the+unit+of+chromosome+organization.">Chromatin domains: the unit of chromosome organization.</a> Molecular Cell. 62, 668-680 (2016).</li><li>Bonev, B., Cavalli, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organization+and+function+of+the+3D+genome.">Organization and function of the 3D genome.</a> Nature Reviews Genetics. 17, 661-678 (2016).</li><li>Lupi&#225;&#241;ez, D. G., Spielmann, M., Mundlos, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breaking+TADs:+how+alterations+of+chromatin+domains+result+in+disease.">Breaking TADs: how alterations of chromatin domains result in disease.</a> Trends in Genetics. 32, 225-237 (2016).</li><li>Phillips, J. E., Corces, V. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF:+master+weaver+of+the+genome.">CTCF: master weaver of the genome.</a> Cell. 137 (7), 1194-1211 (2009).</li><li>Hong, S., Kim, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+characterization+of+chromatin+domain+boundary-associated+genomic+elements.">Computational characterization of chromatin domain boundary-associated genomic elements.</a> Nucleic Acids Research. 45, 10403-10414 (2017).</li><li>Zuin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cohesin+and+CTCF+differentially+affect+chromatin+architecture+and+gene+expression+in+human+cells.">Cohesin and CTCF differentially affect chromatin architecture and gene expression in human cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (3), 996-1001 (2014).</li><li>Guo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+inversion+of+CTCF+sites+alters+genome+topology+and+enhancer/promoter+function.">CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function.</a> Cell. 162, 900-910 (2015).</li><li>Lupi&#225;&#241;ez, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disruptions+of+topological+chromatin+domains+cause+pathogenic+rewiring+of+gene-enhancer+interactions.">Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions.</a> Cell. 161, 1012-1025 (2015).</li><li>Van-Steensel, B., Furlong, E. E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+transcription+in+shaping+the+spatial+organization+of+the+genome.">The role of transcription in shaping the spatial organization of the genome.</a> Nature Reviews Molecular Cell Biology. 20, 327-337 (2019).</li><li>Merkenschlager, M., Nora, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+and+cohesin+in+genome+folding+and+transcriptional+gene+regulation.">CTCF and cohesin in genome folding and transcriptional gene regulation.</a> Annual Review of Genomics and Human Genetics. 17 (1), 17-43 (2016).</li><li>Hansen, A. S., Pustova, I., Cattoglio, C., Tjian, R., Darzacq, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+and+cohesin+regulate+chromatin+loop+stability+with+distinct+dynamics.">CTCF and cohesin regulate chromatin loop stability with distinct dynamics.</a> Elife. 6, 1-10 (2017).</li><li>Van Bortle, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulator+function+and+topological+domain+border+strength+scale+with+architectural+protein+occupancy.">Insulator function and topological domain border strength scale with architectural protein occupancy.</a> Genome Biology. 15, 82 (2014).</li><li>Ram&#237;rez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+TADs+reveal+DNA+sequences+underlying+genome+organization+in+flies.">High-resolution TADs reveal DNA sequences underlying genome organization in flies.</a> Nature Communications. 9, 189 (2018).</li><li>Ulianov, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+chromatin+and+transcription+play+a+key+role+in+chromosome+partitioning+into+topologically+associating+domains.">Active chromatin and transcription play a key role in chromosome partitioning into topologically associating domains.</a> Genome Research. 26, 70-84 (2016).</li><li>Rowley, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionarily+conserved+principles+predict+3D+chromatin+organization.">Evolutionarily conserved principles predict 3D chromatin organization.</a> Molecular Cell. 67, 837-852 (2017).</li><li>Gavrilov, A. A., Golov, A. K., Razin, S. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actual+ligation+frequencies+in+the+chromosome+conformation+capture+procedure.">Actual ligation frequencies in the chromosome conformation capture procedure.</a> PLoS One. 8, 60403 (2013).</li><li>Gavrilov, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disclosure+of+a+structural+milieu+for+the+proximity+ligation+reveals+the+elusive+nature+of+an+active+chromatin+hub.">Disclosure of a structural milieu for the proximity ligation reveals the elusive nature of an active chromatin hub.</a> Nucleic Acids Research. 41, 3563-3575 (2013).</li><li>Nagano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+Hi-C+reveals+cell-to-cell+variability+in+chromosome+structure.">Single-cell Hi-C reveals cell-to-cell variability in chromosome structure.</a> Nature. 502, 59-64 (2013).</li><li>Rao, S. S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+3D+map+of+the+human+genome+at+kilobase+resolution+reveals+principles+of+chromatin+looping.">A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping.</a> Cell. 159 (7), 1665-1680 (2014).</li><li>Nagano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+Hi-C+results+using+in-solution+versus+in-nucleus+ligation.">Comparison of Hi-C results using in-solution versus in-nucleus ligation.</a> Genome Biology. 16, 175 (2015).</li><li>Arzate-Mej&#237;a, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+dissection+of+domain+boundaries+affect+genome+topology+and+gene+transcription+in+Drosophila.">In situ dissection of domain boundaries affect genome topology and gene transcription in Drosophila.</a> Nature Communications. 11, 894 (2020).</li><li>Schoenfelder, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Promoter+capture+Hi-C:+high-resolution,+genome-wide+profiling+of+promoter+interactions.">Promoter capture Hi-C: high-resolution, genome-wide profiling of promoter interactions.</a> Journal of Visualized Experiments. (136), e57320 (2018).</li><li>Servant, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiC-Pro:+an+optimized+and+flexible+pipeline+for+Hi-C+processing.">HiC-Pro: an optimized and flexible pipeline for Hi-C processing.</a> Genome Biology. 16, 259 (2015).</li><li>Philip, E., M&#229;ns, M., Sverker, L., Max, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MultiQC:+Summarize+analysis+results+for+multiple+tools+and+samples+in+a+single+report.">MultiQC: Summarize analysis results for multiple tools and samples in a single report.</a> Bioinformatics. 10, 1093 (2016).</li><li>Wingett, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiCUP:+pipeline+for+mapping+and+processing+Hi-C+data.">HiCUP: pipeline for mapping and processing Hi-C data.</a> F1000 Research. 4, 1310 (2015).</li><li>Imakaev, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+correction+of+Hi-C+data+reveals+hallmarks+of+chromosome+organization.">Iterative correction of Hi-C data reveals hallmarks of chromosome organization.</a> Nature Methods. 9 (10), 999-1003 (2012).</li><li>Akdemir, K. C., Chin, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiCPlotter+integrates+genomic+data+with+interaction+matrices.">HiCPlotter integrates genomic data with interaction matrices.</a> Genome Biolog. 16, 198 (2015).</li><li>Ramirez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+TADs+reveal+DNA+sequences+underlying+genome+organization+in+flies.">High-resolution TADs reveal DNA sequences underlying genome organization in flies.</a> Nature Communications. 9, 189 (2018).</li><li>Ando-Kuri, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+global+and+promoter-centric+3D+genome+organization+temporally+resolved+during+a+circadian+cycle.">The global and promoter-centric 3D genome organization temporally resolved during a circadian cycle.</a> bioRxiv. , (2020).</li><li>Cuellar-Partida, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+priors+for+identifying+active+transcription+factor+binding+sites.">Epigenetic priors for identifying active transcription factor binding sites.</a> Bioinformatics. 28 (1), 56-62 (2012).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biology. 9, 137 (2008).</li><li>Ong, C. -. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ADP-ribosyl)ation+regulates+insulator+function+and+intrachromosomal+interactions+in+Drosophila.">Poly(ADP-ribosyl)ation regulates insulator function and intrachromosomal interactions in Drosophila.</a> Cell. 155 (1), 148-159 (2013).</li><li>Fres&#225;n, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+insulator+protein+CTCF+regulates+Drosophila+steroidogenesis.">The insulator protein CTCF regulates Drosophila steroidogenesis.</a> Biology Open. 4 (7), 852-857 (2015).</li><li>Quinodoz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+promotes+the+formation+of+spatial+compartments+in+the+nucleus.">RNA promotes the formation of spatial compartments in the nucleus.</a> Cell. 174, 744-757 (2018).</li><li>Olivares-Chauvet, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+pairwise+and+multi-way+chromosomal+conformations+using+chromosomal+walks.">Capturing pairwise and multi-way chromosomal conformations using chromosomal walks.</a> Nature. 540 (7632), 296-300 (2016).</li><li>Beagrie, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complex+multi-enhancer+contacts+captured+by+genome+architecture+mapping.">Complex multi-enhancer contacts captured by genome architecture mapping.</a> Nature. 543, 519-524 (2017).</li><li>Redolfi, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DamC+reveals+principles+of+chromatin+folding+in+vivo+without+crosslinking+and+ligation.">DamC reveals principles of chromatin folding in vivo without crosslinking and ligation.</a> Nature Structural and Molecular Biology. 26, 471-480 (2019).</li><li>Maxwell, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiChIP:+efficient+and+sensitive+analysis+of+protein-directed+genome+architecture.">HiChIP: efficient and sensitive analysis of protein-directed genome architecture.</a> Nature Methods. 13, 919-922 (2016).</li><li>Gao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-BERST:+Defining+subnuclear+proteomic+landscapes+at+genomic+elements+with+dCas9-APEX2.">C-BERST: Defining subnuclear proteomic landscapes at genomic elements with dCas9-APEX2.</a> Nature Methods. 15 (6), 433-436 (2018).</li></ol>

The authors declare no competing interests.

The in-nucleus Hi-C method presented here has allowed detailed exploration of Drosophila genome topology at high resolution, providing a view of genomic interactions at different genomic scales, from chromatin loops between regulatory elements such as promoters and enhancers to TADs and large compartment identification25. The same technology has also been efficiently applied to mammalian tissues with some modifications33. For example, when processing a tissue instead of a s...

In eukaryotes, the genome is partitioned into chromosomes that occupy specific territories in the nuclear space during interphase1. The chromatin forming the chromosomes can be divided into two main states: one of accessible chromatin that is transcriptionally permissive, and the other of compact chromatin that is transcriptionally repressive. These chromatin states segregate and rarely mix in the nuclear space, forming two distinct compartments in the nucleus2. At the sub-megabase scale, boundaries separate domains of high-frequency chromatin interactions, called TADs, that mark chromosomal organization3,4,5. In mammals, TAD boundaries are occupied by cohesin and CCCTC-binding factor (CTCF)6,7,8. The cohesin complex extrudes chromatin and halts at CTCF-binding sites that are disposed in a convergent orientation in the genomic sequence to form stable chromatin loops9,10,13,14. Genetic disruption of the CTCF DNA-binding site at the boundaries or reduction in CTCF and cohesin protein abundance results in abnormal interactions between regulatory elements, loss of TAD formation, and gene expression deregulation9,10,11,13,14.
In Drosophila, the boundaries between TADs are occupied by several APs, including boundary element-associated factor 32 kDa (BEAF-32), Motif 1 binding protein (M1BP), centrosomal protein 190 (CP190), suppressor of hairy-wing (SuHW), and CTCF, and are enriched in active histone modifications and Polymerase II16,17,18. It has been suggested that in Drosophila, TADs appear as a consequence of transcription13,17,19, and the exact role of independent APs in boundary formation and insulation properties is still under investigation. Thus, whether domains in Drosophila are a sole consequence of the aggregation of regions of similar transcriptional states or whether APs, including CTCF, contribute to boundary formation remains to be fully characterized. Exploration of genomic contacts at high resolution has been possible through the development of chromosome conformation capture technologies coupled with next-generation sequencing. The Hi-C protocol was first described with the ligation step performed &#34;in solution&#34;2 in an attempt to avoid spurious ligation products between chromatin fragments. However, several studies pointed to the realization that the useful signal in the data came from ligation products formed at partially lysed nuclei that were not in solution20,21.
The protocol was then modified to perform the ligation inside the nucleus as part of the single-cell Hi-C experiment22. The in-nucleus Hi-C protocol was subsequently incorporated into cell population Hi-C to yield a more consistent coverage over the full range of genomic distances and produce data with less technical noise23,24. The protocol, described in detail here, is based on the population in-nucleus Hi-C protocol23,24 and was used to investigate the consequences of genetically removing DNA-binding motifs for CTCF and M1BP from a domain boundary at the Notch gene locus in Drosophila25. The results show that altering the DNA-binding motifs for APs at the boundary has drastic consequences for Notch domain formation, larger topological defects in the regions surrounding the Notch locus, and gene expression deregulation. This indicates that genetic elements at domain boundaries are important for the maintenance of genome topology and gene expression in Drosophila25.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>16% (vol/vol) paraformaldehyde solution</td>
			<td>Agar Scientific</td>
			<td>R1026</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotin-14-dATP</td>
			<td>Invitrogen</td>
			<td>CA1524-016</td>
			<td></td>
		</tr>
		<tr>
			<td>ClaI enzyme</td>
			<td>NEB</td>
			<td>R0197S</td>
			<td></td>
		</tr>
		<tr>
			<td>COVARIS Ultrasonicator</td>
			<td>Covaris</td>
			<td>LE220-M220</td>
			<td></td>
		</tr>
		<tr>
			<td>Cut Smart</td>
			<td>NEB</td>
			<td>B72002S</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM) 1x</td>
			<td>Life Technologies</td>
			<td>41965-039</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynabeads MyOne Streptabidin C1</td>
			<td>Invitrogen</td>
			<td>65002</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS) sterile filtered</td>
			<td>Sigma</td>
			<td>F9665</td>
			<td></td>
		</tr>
		<tr>
			<td>Klenow Dna PolI large fragment</td>
			<td>NEB</td>
			<td>M0210L</td>
			<td></td>
		</tr>
		<tr>
			<td>Klenow exo(-)</td>
			<td>NEB</td>
			<td>M0210S</td>
			<td></td>
		</tr>
		<tr>
			<td>Ligation Buffer</td>
			<td>NEB</td>
			<td>B020S</td>
			<td></td>
		</tr>
		<tr>
			<td>MboI enzyme</td>
			<td>NEB</td>
			<td>R0147M</td>
			<td></td>
		</tr>
		<tr>
			<td>NP40-Igepal</td>
			<td>SIGMA</td>
			<td>CA-420</td>
			<td>Non-ionic surfactant for addition in lysis buffer</td>
		</tr>
		<tr>
			<td>PE adapter 1.0</td>
			<td>Illumina</td>
			<td>5&#39;-P-GATCGGAAGAGCGGTTCAGCAG 
			GAATGCCGAG-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE adapter 2.0</td>
			<td>Illumina</td>
			<td>5&#39;-ACACTCTTTCCCTACACGACGCT 
			CTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE PCR primer 1.0</td>
			<td>Illumina</td>
			<td>5&#39;-AATGATACGGCGACCACCGAGAT 
			CTACACTCTTTCCCTACACGACG 
			CTCTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE PCR primer 2.0</td>
			<td>Illumina</td>
			<td>5&#39;-CAAGCAGAAGACGGCATACGAG 
			ATCGGTCTCGGCATTCCTGCTGA 
			ACCGCTCTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol: Chloroform:Isoamyl Alcohol 25:24:1</td>
			<td>SIGMA</td>
			<td>P2069</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer 1 (known interaction, Figure 2A)</td>
			<td>Sigma</td>
			<td>5&#39;-TCGCGGTAATTTTGCGTTTGA-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer 2 (known interactions, Figure 2A)</td>
			<td>Sigma</td>
			<td>5&#39;-CCTCCCTGCCAAAACGTTTT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Protease inhibitor cocktail tablet</td>
			<td>Roche</td>
			<td>4693132001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Roche</td>
			<td>3115879001</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit</td>
			<td>ThermoFisher</td>
			<td>Q33327</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse</td>
			<td>Roche</td>
			<td>10109142001</td>
			<td></td>
		</tr>
		<tr>
			<td>SPRI Beads</td>
			<td>Beckman</td>
			<td>B23318</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Invitrogen</td>
			<td>15224-025</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA polymerase</td>
			<td>NEB</td>
			<td>M0203S</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 polynucleotide kinase (PNK)&#160;</td>
			<td>NEB</td>
			<td>M0201L</td>
			<td></td>
		</tr>
		<tr>
			<td>TaqPhusion</td>
			<td>NEB</td>
			<td>M0530S</td>
			<td>DNA polymerase</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td></td>
			<td></td>
			<td>Non-ionic surfactant for quenching of SDS</td>
		</tr>
	</tbody>
</table>

in-nucleus hi-c in drosophila cells

The genome is organized into topologically associating domains (TADs) delimited by boundaries that isolate interactions between domains. In Drosophila, the mechanisms underlying TAD formation and boundaries are still under investigation. The application of the in-nucleus Hi-C method described here helped to dissect the function of architectural protein (AP)-binding sites at TAD boundaries isolating the Notch gene. Genetic modification of domain boundaries that cause loss of APs results in TAD fusion, transcriptional defects, and long-range topological alterations. These results provided evidence demonstrating the contribution of genetic elements to domain boundary formation and gene expression control in Drosophila. Here, the in-nucleus Hi-C method has been described in detail, which provides important checkpoints to assess the quality of the experiment along with the protocol. Also shown are the required numbers of sequencing reads and valid Hi-C pairs to analyze genomic interactions at different genomic scales. CRISPR/Cas9-mediated genetic editing of regulatory elements and high-resolution profiling of genomic interactions using this in-nucleus Hi-C protocol could be a powerful combination for the investigation of the structural function of genetic elements.

Described below are the results of a successful Hi-C protocol (see a summary of the Hi-C protocol workflow in Figure 1A). There are several quality control checkpoints during the in-nucleus Hi-C experiment. Sample aliquots were collected before (UD) and after (D) the chromatin restriction step as well as after ligation (L). Crosslinks were reversed, and DNA was purified and run on an agarose gel. A smear of 200-1000 bp was observed when restriction with Mbo I was successful (<strong class="x...

Watch this Scientific Journal Video about In-Nucleus Hi-C in Drosophila Cells at JoVE.com

In-Nucleus Hi-C in Drosophila Cells

The genome is organized in the nuclear space into different structures that can be revealed through chromosome conformation capture technologies. The in-nucleus Hi-C method provides a genome-wide collection of chromatin interactions in Drosophila cell lines, which generates contact maps that can be explored at megabase resolution at restriction fragment level.

The genome is organized into topologically associating domains (TADs) delimited by boundaries that isolate interactions between domains. In Drosophila, ...

Research

JoVE Journal

Genetics

4.0K Views.  Universidad Nacional Autónoma de México. The genome is organized in the nuclear space into different structures that can be revealed through chromosome conformation capture technologies. The in-nucleus Hi-C method provides a genome-wide collection of chromatin interactions in Drosophila cell lines, which generates contact maps that can be explored at megabase resolution at restriction fragment level.

Video: In-Nucleus Hi-C in Drosophila Cells

Quantifying Abdominal Pigmentation in Drosophila melanogaster

Pigmentation is a morphologically simple but highly variable trait that often has adaptive significance. It has served extensively as a model for understanding the development and evolution of morphological phenotypes. Abdominal pigmentation in Drosophila melanogaster has been particularly useful, allowing researchers to identify the loci that underlie inter- and intraspecific variations in morphology. Hitherto, however, D. melanogaster abdominal pigmentation has been largely assayed qualitatively, through scoring, rather than quantitatively, which limits the forms of statistical analysis that can be applied to pigmentation data. This work describes a new methodology that allows for the quantification of various aspects of the abdominal pigmentation pattern of adult D. melanogaster. The protocol includes specimen mounting, image capture, data extraction, and analysis. All the software used for image capture and analysis feature macros written for open-source image analysis. The advantage of this approach is the ability to precisely measure pigmentation traits using a methodology that is highly reproducible across different imaging systems. While the technique has been used to measure variation in the tergal pigmentation patterns of adult D. melanogaster, the methodology is flexible and broadly applicable to pigmentation patterns in myriad different organisms.

Quantifying Abdominal Pigmentation in Drosophila melanogaster

This work presents a method to quickly and precisely quantify the abdominal pigmentation of Drosophila melanogaster using digital image analysis. This method streamlines the procedures between phenotype acquisition and data analysis and includes specimen mounting, image acquisition, pixel value extraction, and trait measurement.

Pigmentation is a morphologically simple but highly variable trait that often has adaptive significance. It has served extensively as a model for ...

Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the spatio-temporal expression of their target genes through physical contact, often bridging considerable (in some cases hundreds of kilobases) genomic distances and bypassing nearby genes. The human genome harbors an estimated one million enhancers, the vast majority of which have unknown gene targets. Assigning distal regulatory regions to their target genes is thus crucial to understand gene expression control. We developed Promoter Capture Hi-C (PCHi-C) to enable the genome-wide detection of distal promoter-interacting regions (PIRs), for all promoters in a single experiment. In PCHi-C, highly complex Hi-C libraries are specifically enriched for promoter sequences through in-solution hybrid selection with thousands of biotinylated RNA baits complementary to the ends of all promoter-containing restriction fragments. The aim is to then pull-down promoter sequences and their frequent interaction partners such as enhancers and other potential regulatory elements. After high-throughput paired-end sequencing, a statistical test is applied to each promoter-ligated restriction fragment to identify significant PIRs at the restriction fragment level. We have used PCHi-C to generate an atlas of long-range promoter interactions in dozens of human and mouse cell types. These promoter interactome maps have contributed to a greater understanding of mammalian gene expression control by assigning putative regulatory regions to their target genes and revealing preferential spatial promoter-promoter interaction networks. This information also has high relevance to understanding human genetic disease and the identification of potential disease genes, by linking non-coding disease-associated sequence variants in or near control sequences to their target genes.

DNA regulatory elements, such as enhancers, control gene expression by physically contacting target gene promoters, often through long-range chromosomal interactions spanning large genomic distances. Promoter Capture Hi-C (PCHi-C) identifies significant interactions between promoters and distal regions, enabling the assignment of potential regulatory sequences to their target genes.

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the ...

Purification of Low-abundant Cells in the Drosophila Visual System

Recent improvements in the sensitivity of next generation sequencing have facilitated the application of transcriptomic and genomic analyses to small numbers of cells. Utilizing this technology to study development in the Drosophila visual system, which boasts a wealth of cell type-specific genetic tools, provides a powerful approach for addressing the molecular basis of development with precise cellular resolution. For such an approach to be feasible, it is crucial to have the capacity to reliably and efficiently purify cells present at low abundance within the brain. Here, we present a method that allows efficient purification of single cell clones in genetic mosaic experiments. With this protocol, we consistently achieve a high cellular yield after purification using fluorescence activated cell sorting (FACS) (~25% of all labeled cells), and successfully performed transcriptomics analyses on single cell clones generated through mosaic analysis with a repressible cell marker (MARCM). This protocol is ideal for applying transcriptomic and genomic analyses to specific cell types in the visual system, across different stages of development and in the context of different genetic manipulations.

Here, we present a cell dissociation protocol for efficiently isolating cells present at low abundance within the Drosophila visual system through fluorescence activated cell sorting (FACS).

Recent improvements in the sensitivity of next generation sequencing have facilitated the application of transcriptomic and genomic analyses to small ...

In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila

Advances in sequencing technology have made whole-genome and whole-exome datasets more accessible for both clinical diagnosis and cutting-edge human genetics research. Although a number of in silico algorithms have been developed to predict the pathogenicity of variants identified in these datasets, functional studies are critical to determining how specific genomic variants affect protein function, especially for missense variants. In the Undiagnosed Diseases Network (UDN) and other rare disease research consortia, model organisms (MO) including Drosophila, C. elegans, zebrafish, and mice are actively used to assess the function of putative human disease-causing variants. This protocol describes a method for the functional assessment of rare human variants used in the Model Organisms Screening Center Drosophila Core of the UDN. The workflow begins with gathering human and MO information from multiple public databases, using the MARRVEL web resource to assess whether the variant is likely to contribute to a patient&#39;s condition as well as design effective experiments based on available knowledge and resources. Next, genetic tools (e.g., T2A-GAL4 and UAS-human cDNA lines) are generated to assess the functions of variants of interest in Drosophila. Upon development of these reagents, two-pronged functional assays based on rescue and overexpression experiments can be performed to assess variant function. In the rescue branch, the endogenous fly genes are &#34;humanized&#34;&#160;by replacing the orthologous Drosophila gene with reference or variant human transgenes. In the overexpression branch, the reference and variant human proteins are exogenously driven in a variety of tissues. In both cases, any scorable phenotype (e.g., lethality, eye morphology, electrophysiology) can be used as a read-out, irrespective of the disease of interest. Differences observed between reference and variant alleles suggest a variant-specific effect, and thus likely pathogenicity. This protocol allows rapid, in vivo assessments of putative human disease-causing variants of genes with known and unknown functions.

In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila

The goal of this protocol is to outline the design and performance of in vivo experiments in Drosophila melanogaster to assess the functional consequences of rare gene variants associated with human diseases.

Advances in sequencing technology have made whole-genome and whole-exome datasets more accessible for both clinical diagnosis and cutting-edge human ...

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic screening using chemical mutagens is a useful strategy for mapping mutant phenotypes to genes among Drosophila and other model organisms that share conserved cellular pathways with humans. If the mutated gene of interest is not lethal in early developmental stages of flies, a climbing assay can be conducted to screen for phenotypic indicators of decreased brain functioning, such as low climbing rates. Subsequently, secondary histological analysis of brain tissue can be performed in order to verify the neuroprotective function of the gene by scoring neurodegeneration phenotypes. Gene mapping strategies include meiotic and deficiency mapping that rely on these same assays can be followed by DNA sequencing to identify possible nucleotide changes in the gene of interest.

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

We present a protocol using a forward genetic approach to screen for mutants exhibiting neurodegeneration in Drosophila melanogaster. It incorporates a climbing assay, histology analysis, gene mapping and DNA sequencing to ultimately identify novel genes related to the process of neuroprotection.

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic ...

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a rapid and high-throughput manner. S2 cells have proven amenable to both fixed- and live-cell imaging applications. Notably, live-cell imaging can yield valuable information about how loss or knockdown of a gene can affect the kinetics and dynamics of key events during cell division, including mitotic spindle assembly, chromosome congression, and segregation, as well as overall cell cycle timing. Here we utilize S2 cells stably transfected with fluorescently tagged mCherry:&#945;-tubulin to mark the mitotic spindle and GFP:CENP-A (referred to as &#8216;CID&#8217; gene in Drosophila) to mark the centromere to analyze the effects of key mitotic genes on the timing of cell divisions, from prophase (specifically at Nuclear Envelope Breakdown; NEBD) to the onset of anaphase. This imaging protocol also allows for the visualization of the spindle microtubule and chromosome dynamics throughout mitosis. Herein, we aim to provide a simple yet comprehensive protocol that will allow readers to easily adapt S2 cells for live imaging experiments. Results obtained from such experiments should expand our understanding of genes involved in the cell division by defining their role in several simultaneous and dynamic events. Observations made in this cell culture system can be validated and further investigated in vivo using the impressive toolkit of genetic approaches in flies.

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Cell divisions can be visualized in real time using fluorescently tagged proteins and time-lapse microscopy. Using the protocol presented here, users can analyze cell division timing dynamics, mitotic spindle assembly, and chromosome congression and segregation. Defects in these events following RNA interference (RNAi)-mediated gene knockdown can be assessed and quantified.

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding sites for transcriptional regulators to modulate gene expression. Alterations of CREs have been implicated in various diseases including cancer. While promoters and enhancers have been the primary CREs for studying gene regulation, very little is known about the role of silencer, which is another type of CRE that mediates gene repression. Originally identified as an adaptive immunity system in prokaryotes, CRISPR/Cas9 has been exploited to be a powerful tool for eukaryotic genome editing. Here, we present the use of this technique to delete an intronic silencer in the human RUNX1 gene and investigate the impacts on gene expression in OCI-AML3 leukemic cells. Our approach relies on electroporation-mediated delivery of two preassembled Cas9/guide RNA (gRNA) ribonucleoprotein (RNP) complexes to create two double-strand breaks (DSBs) that flank the silencer. Deletions can be readily screened by fragment analysis. Expression analyses of different mRNAs transcribed from alternative promoters help evaluate promoter-dependent effects. This strategy can be used to study other CREs and is particularly suitable for hematopoietic cells, which are often difficult to transfect with plasmid-based methods. The use of a plasmid- and virus-free strategy allows simple and fast assessments of gene regulatory functions.

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Direct delivery of preassembled Cas9/guide RNA ribonucleoprotein complexes is a fast and efficient means for genome editing in hematopoietic cells. Here, we utilize this approach to delete a RUNX1 intronic silencer and examine the transcriptional responses in OCI-AML3 leukemic cells.

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of individual cell populations often makes it difficult to obtain enough material for molecular studies. For example, the accessory gland of the Drosophila male reproductive system contains two distinct secretory cell types. The main cells make up 96% of the secretory cells of the gland, while the secondary cells (SC) make up the remaining 4% of cells (about 80 cells per male). Although both cell types produce important components of the seminal fluid, only a few genes are known to be specific to the SCs. The rarity of SCs has, thus far, hindered transcriptomic analysis study of this important cell type. Here, a method is presented that allows for the purification of SCs for RNA extraction and sequencing. The protocol consists in first dissecting glands from flies expressing a SC-specific GFP reporter and then subjecting these glands to protease digestion and mechanical dissociation to obtain individual cells. Following these steps, individual, living, GFP-marked cells are sorted using a fluorescent activated cell sorter (FACS) for RNA purification. This procedure yields SC-specific RNAs from ~40 males per condition for downstream RT-qPCR and/or RNA sequencing in the course of one day. The rapidity and simplicity of the procedure allows for the transcriptomes of many different flies, from different genotypes or environmental conditions, to be determined in a short period of time.

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

Here, we present a protocol to dissociate and sort a specific cell population from the Drosophila male accessory glands (secondary cells) for RNA sequencing and RT-qPCR. Cell isolation is accomplished through FACS purification of GFP-expressing secondary cells after a multistep-dissociation process requiring dissection, proteases digestion and mechanical dispersion.

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of ...

Cryopreservation of PGCs for Long-Term Preservation of Drosophila Strains

Primordial Germ Cell Cryopreservation and Revival of Drosophila Strains

Drosophila strains must be maintained by the frequent transfer of adult flies to new vials. This carries a danger of mutational deterioration and phenotypic changes. Development of an alternative method for long-term preservation without such changes is therefore imperative. Despite previous successful attempts, cryopreservation of Drosophila embryos is still not of practical use because of low reproducibility. Here, we describe a protocol for primordial germ cell (PGC) cryopreservation and strain revival via transplantation of cryopreserved PGCs into agametic Drosophila melanogaster (D. melanogaster) host embryos. PGCs are highly permeable to cryoprotective agents (CPAs), and developmental and morphological variation among strains is less problematic than in embryo cryopreservation. In this method, PGCs are collected from approximately 30 donor embryos, loaded into a needle after CPA treatment, and then cryopreserved in liquid nitrogen. To produce donor-derived gametes, the cryopreserved PGCs in a needle are thawed and then deposited into approximately 15&#160;agametic host embryos. A frequency of at least 15% fertile flies was achieved with this protocol, and the number of progeny per fertile couple was always more than enough to revive the original strain (the average progeny number being 77.2 &#177; 7.1), indicating the ability of cryopreserved PGCs to become germline stem cells. The average number of fertile flies per needle was 1.1 &#177; 0.2, and 9 out of 26 needles produced two or more fertile progeny. It was found that 11 needles are enough to produce 6 or more progeny, in which at least one female and one male are likely included. The agametic host makes it possible to revive the strain quickly by simply crossing newly emerged female and male flies. In addition, PGCs have the potential to be used in genetic engineering applications, such as genome editing.

Author Spotlight: PGC Cryopreservation &#8211; An Alternative Approach Towards Long-Term Preservation of Drosophila Strains 

A long-term preservation method for Drosophila strains as an alternative to the frequent transfer of adult flies to fresh food vials is highly desirable. This protocol describes the cryopreservation of Drosophila primordial germ cells and strain revival via their transplantation to agametic host embryos.