This work was supported by UNAM Technology Innovation and Research Support Program (PAPIIT) grant number IN207319 and the Science and Technology National Council (CONACyT-FORDECyT) grant number 303068. A.E.-L. is a master&#39;s student supported by the Science and Technology National Council (CONACyT) CVU number 968128.

1. Fixation
<ol>
	<li>Start with 10 million Schneider&#39;s line 2 plus (S2R+) cells to prepare 17.5 mL of a cell suspension in Schneider medium containing 10% fetal bovine serum (FBS) at room temperature (RT).</li>
	<li>Add methanol-free formaldehyde to obtain a final concentration of 2%. Mix and incubate for 10 min at RT, taking care to mix every minute. 
	NOTE: Formaldehyde is a hazardous chemical. Follow the appropriate health and safety regulations, and work in the fume hood.</li>
	<li>Quench the reaction by ...

<ol>
	<li>Cremer, T., Cremer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosome+territories,+nuclear+architecture+and+gene+regulation+in+mammalian+cells.">Chromosome territories, nuclear architecture and gene regulation in mammalian cells.</a> Nature Review Genetics. 2, 292-301 (2001).</li><li>Lieberman-Aiden, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+mapping+of+long-range+interactions+reveals+folding+principles+of+the+human+genome.">Comprehensive mapping of long-range interactions reveals folding principles of the human genome.</a> Science. 326, 289-293 (2009).</li><li>Dixon, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Topological+domains+in+mammalian+genomes+identified+by+analysis+of+chromatin+interactions.">Topological domains in mammalian genomes identified by analysis of chromatin interactions.</a> Nature. 485, 376-380 (2012).</li><li>Sexton, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+folding+and+functional+organization+principles+of+the+Drosophila+genome.">Three-dimensional folding and functional organization principles of the Drosophila genome.</a> Cell. 148 (3), 458-472 (2012).</li><li>Dixon, J. R., Gorkin, D. U., Ren, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+domains:+the+unit+of+chromosome+organization.">Chromatin domains: the unit of chromosome organization.</a> Molecular Cell. 62, 668-680 (2016).</li><li>Bonev, B., Cavalli, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organization+and+function+of+the+3D+genome.">Organization and function of the 3D genome.</a> Nature Reviews Genetics. 17, 661-678 (2016).</li><li>Lupi&#225;&#241;ez, D. G., Spielmann, M., Mundlos, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breaking+TADs:+how+alterations+of+chromatin+domains+result+in+disease.">Breaking TADs: how alterations of chromatin domains result in disease.</a> Trends in Genetics. 32, 225-237 (2016).</li><li>Phillips, J. E., Corces, V. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF:+master+weaver+of+the+genome.">CTCF: master weaver of the genome.</a> Cell. 137 (7), 1194-1211 (2009).</li><li>Hong, S., Kim, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+characterization+of+chromatin+domain+boundary-associated+genomic+elements.">Computational characterization of chromatin domain boundary-associated genomic elements.</a> Nucleic Acids Research. 45, 10403-10414 (2017).</li><li>Zuin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cohesin+and+CTCF+differentially+affect+chromatin+architecture+and+gene+expression+in+human+cells.">Cohesin and CTCF differentially affect chromatin architecture and gene expression in human cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (3), 996-1001 (2014).</li><li>Guo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+inversion+of+CTCF+sites+alters+genome+topology+and+enhancer/promoter+function.">CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function.</a> Cell. 162, 900-910 (2015).</li><li>Lupi&#225;&#241;ez, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disruptions+of+topological+chromatin+domains+cause+pathogenic+rewiring+of+gene-enhancer+interactions.">Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions.</a> Cell. 161, 1012-1025 (2015).</li><li>Van-Steensel, B., Furlong, E. E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+transcription+in+shaping+the+spatial+organization+of+the+genome.">The role of transcription in shaping the spatial organization of the genome.</a> Nature Reviews Molecular Cell Biology. 20, 327-337 (2019).</li><li>Merkenschlager, M., Nora, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+and+cohesin+in+genome+folding+and+transcriptional+gene+regulation.">CTCF and cohesin in genome folding and transcriptional gene regulation.</a> Annual Review of Genomics and Human Genetics. 17 (1), 17-43 (2016).</li><li>Hansen, A. S., Pustova, I., Cattoglio, C., Tjian, R., Darzacq, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+and+cohesin+regulate+chromatin+loop+stability+with+distinct+dynamics.">CTCF and cohesin regulate chromatin loop stability with distinct dynamics.</a> Elife. 6, 1-10 (2017).</li><li>Van Bortle, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulator+function+and+topological+domain+border+strength+scale+with+architectural+protein+occupancy.">Insulator function and topological domain border strength scale with architectural protein occupancy.</a> Genome Biology. 15, 82 (2014).</li><li>Ram&#237;rez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+TADs+reveal+DNA+sequences+underlying+genome+organization+in+flies.">High-resolution TADs reveal DNA sequences underlying genome organization in flies.</a> Nature Communications. 9, 189 (2018).</li><li>Ulianov, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+chromatin+and+transcription+play+a+key+role+in+chromosome+partitioning+into+topologically+associating+domains.">Active chromatin and transcription play a key role in chromosome partitioning into topologically associating domains.</a> Genome Research. 26, 70-84 (2016).</li><li>Rowley, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionarily+conserved+principles+predict+3D+chromatin+organization.">Evolutionarily conserved principles predict 3D chromatin organization.</a> Molecular Cell. 67, 837-852 (2017).</li><li>Gavrilov, A. A., Golov, A. K., Razin, S. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actual+ligation+frequencies+in+the+chromosome+conformation+capture+procedure.">Actual ligation frequencies in the chromosome conformation capture procedure.</a> PLoS One. 8, 60403 (2013).</li><li>Gavrilov, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disclosure+of+a+structural+milieu+for+the+proximity+ligation+reveals+the+elusive+nature+of+an+active+chromatin+hub.">Disclosure of a structural milieu for the proximity ligation reveals the elusive nature of an active chromatin hub.</a> Nucleic Acids Research. 41, 3563-3575 (2013).</li><li>Nagano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+Hi-C+reveals+cell-to-cell+variability+in+chromosome+structure.">Single-cell Hi-C reveals cell-to-cell variability in chromosome structure.</a> Nature. 502, 59-64 (2013).</li><li>Rao, S. S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+3D+map+of+the+human+genome+at+kilobase+resolution+reveals+principles+of+chromatin+looping.">A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping.</a> Cell. 159 (7), 1665-1680 (2014).</li><li>Nagano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+Hi-C+results+using+in-solution+versus+in-nucleus+ligation.">Comparison of Hi-C results using in-solution versus in-nucleus ligation.</a> Genome Biology. 16, 175 (2015).</li><li>Arzate-Mej&#237;a, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+dissection+of+domain+boundaries+affect+genome+topology+and+gene+transcription+in+Drosophila.">In situ dissection of domain boundaries affect genome topology and gene transcription in Drosophila.</a> Nature Communications. 11, 894 (2020).</li><li>Schoenfelder, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Promoter+capture+Hi-C:+high-resolution,+genome-wide+profiling+of+promoter+interactions.">Promoter capture Hi-C: high-resolution, genome-wide profiling of promoter interactions.</a> Journal of Visualized Experiments. (136), e57320 (2018).</li><li>Servant, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiC-Pro:+an+optimized+and+flexible+pipeline+for+Hi-C+processing.">HiC-Pro: an optimized and flexible pipeline for Hi-C processing.</a> Genome Biology. 16, 259 (2015).</li><li>Philip, E., M&#229;ns, M., Sverker, L., Max, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MultiQC:+Summarize+analysis+results+for+multiple+tools+and+samples+in+a+single+report.">MultiQC: Summarize analysis results for multiple tools and samples in a single report.</a> Bioinformatics. 10, 1093 (2016).</li><li>Wingett, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiCUP:+pipeline+for+mapping+and+processing+Hi-C+data.">HiCUP: pipeline for mapping and processing Hi-C data.</a> F1000 Research. 4, 1310 (2015).</li><li>Imakaev, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+correction+of+Hi-C+data+reveals+hallmarks+of+chromosome+organization.">Iterative correction of Hi-C data reveals hallmarks of chromosome organization.</a> Nature Methods. 9 (10), 999-1003 (2012).</li><li>Akdemir, K. C., Chin, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiCPlotter+integrates+genomic+data+with+interaction+matrices.">HiCPlotter integrates genomic data with interaction matrices.</a> Genome Biolog. 16, 198 (2015).</li><li>Ramirez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+TADs+reveal+DNA+sequences+underlying+genome+organization+in+flies.">High-resolution TADs reveal DNA sequences underlying genome organization in flies.</a> Nature Communications. 9, 189 (2018).</li><li>Ando-Kuri, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+global+and+promoter-centric+3D+genome+organization+temporally+resolved+during+a+circadian+cycle.">The global and promoter-centric 3D genome organization temporally resolved during a circadian cycle.</a> bioRxiv. , (2020).</li><li>Cuellar-Partida, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+priors+for+identifying+active+transcription+factor+binding+sites.">Epigenetic priors for identifying active transcription factor binding sites.</a> Bioinformatics. 28 (1), 56-62 (2012).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biology. 9, 137 (2008).</li><li>Ong, C. -. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ADP-ribosyl)ation+regulates+insulator+function+and+intrachromosomal+interactions+in+Drosophila.">Poly(ADP-ribosyl)ation regulates insulator function and intrachromosomal interactions in Drosophila.</a> Cell. 155 (1), 148-159 (2013).</li><li>Fres&#225;n, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+insulator+protein+CTCF+regulates+Drosophila+steroidogenesis.">The insulator protein CTCF regulates Drosophila steroidogenesis.</a> Biology Open. 4 (7), 852-857 (2015).</li><li>Quinodoz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+promotes+the+formation+of+spatial+compartments+in+the+nucleus.">RNA promotes the formation of spatial compartments in the nucleus.</a> Cell. 174, 744-757 (2018).</li><li>Olivares-Chauvet, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+pairwise+and+multi-way+chromosomal+conformations+using+chromosomal+walks.">Capturing pairwise and multi-way chromosomal conformations using chromosomal walks.</a> Nature. 540 (7632), 296-300 (2016).</li><li>Beagrie, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complex+multi-enhancer+contacts+captured+by+genome+architecture+mapping.">Complex multi-enhancer contacts captured by genome architecture mapping.</a> Nature. 543, 519-524 (2017).</li><li>Redolfi, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DamC+reveals+principles+of+chromatin+folding+in+vivo+without+crosslinking+and+ligation.">DamC reveals principles of chromatin folding in vivo without crosslinking and ligation.</a> Nature Structural and Molecular Biology. 26, 471-480 (2019).</li><li>Maxwell, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiChIP:+efficient+and+sensitive+analysis+of+protein-directed+genome+architecture.">HiChIP: efficient and sensitive analysis of protein-directed genome architecture.</a> Nature Methods. 13, 919-922 (2016).</li><li>Gao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-BERST:+Defining+subnuclear+proteomic+landscapes+at+genomic+elements+with+dCas9-APEX2.">C-BERST: Defining subnuclear proteomic landscapes at genomic elements with dCas9-APEX2.</a> Nature Methods. 15 (6), 433-436 (2018).</li></ol>

The in-nucleus Hi-C method presented here has allowed detailed exploration of Drosophila genome topology at high resolution, providing a view of genomic interactions at different genomic scales, from chromatin loops between regulatory elements such as promoters and enhancers to TADs and large compartment identification25. The same technology has also been efficiently applied to mammalian tissues with some modifications33. For example, when processing a tissue instead of a s...

In eukaryotes, the genome is partitioned into chromosomes that occupy specific territories in the nuclear space during interphase1. The chromatin forming the chromosomes can be divided into two main states: one of accessible chromatin that is transcriptionally permissive, and the other of compact chromatin that is transcriptionally repressive. These chromatin states segregate and rarely mix in the nuclear space, forming two distinct compartments in the nucleus2. At the sub-megabase scale, boundaries separate domains of high-frequency chromatin interactions, called TADs, that mark chromosomal organization3,4,5. In mammals, TAD boundaries are occupied by cohesin and CCCTC-binding factor (CTCF)6,7,8. The cohesin complex extrudes chromatin and halts at CTCF-binding sites that are disposed in a convergent orientation in the genomic sequence to form stable chromatin loops9,10,13,14. Genetic disruption of the CTCF DNA-binding site at the boundaries or reduction in CTCF and cohesin protein abundance results in abnormal interactions between regulatory elements, loss of TAD formation, and gene expression deregulation9,10,11,13,14.
In Drosophila, the boundaries between TADs are occupied by several APs, including boundary element-associated factor 32 kDa (BEAF-32), Motif 1 binding protein (M1BP), centrosomal protein 190 (CP190), suppressor of hairy-wing (SuHW), and CTCF, and are enriched in active histone modifications and Polymerase II16,17,18. It has been suggested that in Drosophila, TADs appear as a consequence of transcription13,17,19, and the exact role of independent APs in boundary formation and insulation properties is still under investigation. Thus, whether domains in Drosophila are a sole consequence of the aggregation of regions of similar transcriptional states or whether APs, including CTCF, contribute to boundary formation remains to be fully characterized. Exploration of genomic contacts at high resolution has been possible through the development of chromosome conformation capture technologies coupled with next-generation sequencing. The Hi-C protocol was first described with the ligation step performed &#34;in solution&#34;2 in an attempt to avoid spurious ligation products between chromatin fragments. However, several studies pointed to the realization that the useful signal in the data came from ligation products formed at partially lysed nuclei that were not in solution20,21.
The protocol was then modified to perform the ligation inside the nucleus as part of the single-cell Hi-C experiment22. The in-nucleus Hi-C protocol was subsequently incorporated into cell population Hi-C to yield a more consistent coverage over the full range of genomic distances and produce data with less technical noise23,24. The protocol, described in detail here, is based on the population in-nucleus Hi-C protocol23,24 and was used to investigate the consequences of genetically removing DNA-binding motifs for CTCF and M1BP from a domain boundary at the Notch gene locus in Drosophila25. The results show that altering the DNA-binding motifs for APs at the boundary has drastic consequences for Notch domain formation, larger topological defects in the regions surrounding the Notch locus, and gene expression deregulation. This indicates that genetic elements at domain boundaries are important for the maintenance of genome topology and gene expression in Drosophila25.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>16% (vol/vol) paraformaldehyde solution</td>
			<td>Agar Scientific</td>
			<td>R1026</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotin-14-dATP</td>
			<td>Invitrogen</td>
			<td>CA1524-016</td>
			<td></td>
		</tr>
		<tr>
			<td>ClaI enzyme</td>
			<td>NEB</td>
			<td>R0197S</td>
			<td></td>
		</tr>
		<tr>
			<td>COVARIS Ultrasonicator</td>
			<td>Covaris</td>
			<td>LE220-M220</td>
			<td></td>
		</tr>
		<tr>
			<td>Cut Smart</td>
			<td>NEB</td>
			<td>B72002S</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM) 1x</td>
			<td>Life Technologies</td>
			<td>41965-039</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynabeads MyOne Streptabidin C1</td>
			<td>Invitrogen</td>
			<td>65002</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS) sterile filtered</td>
			<td>Sigma</td>
			<td>F9665</td>
			<td></td>
		</tr>
		<tr>
			<td>Klenow Dna PolI large fragment</td>
			<td>NEB</td>
			<td>M0210L</td>
			<td></td>
		</tr>
		<tr>
			<td>Klenow exo(-)</td>
			<td>NEB</td>
			<td>M0210S</td>
			<td></td>
		</tr>
		<tr>
			<td>Ligation Buffer</td>
			<td>NEB</td>
			<td>B020S</td>
			<td></td>
		</tr>
		<tr>
			<td>MboI enzyme</td>
			<td>NEB</td>
			<td>R0147M</td>
			<td></td>
		</tr>
		<tr>
			<td>NP40-Igepal</td>
			<td>SIGMA</td>
			<td>CA-420</td>
			<td>Non-ionic surfactant for addition in lysis buffer</td>
		</tr>
		<tr>
			<td>PE adapter 1.0</td>
			<td>Illumina</td>
			<td>5&#39;-P-GATCGGAAGAGCGGTTCAGCAG 
			GAATGCCGAG-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE adapter 2.0</td>
			<td>Illumina</td>
			<td>5&#39;-ACACTCTTTCCCTACACGACGCT 
			CTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE PCR primer 1.0</td>
			<td>Illumina</td>
			<td>5&#39;-AATGATACGGCGACCACCGAGAT 
			CTACACTCTTTCCCTACACGACG 
			CTCTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE PCR primer 2.0</td>
			<td>Illumina</td>
			<td>5&#39;-CAAGCAGAAGACGGCATACGAG 
			ATCGGTCTCGGCATTCCTGCTGA 
			ACCGCTCTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol: Chloroform:Isoamyl Alcohol 25:24:1</td>
			<td>SIGMA</td>
			<td>P2069</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer 1 (known interaction, Figure 2A)</td>
			<td>Sigma</td>
			<td>5&#39;-TCGCGGTAATTTTGCGTTTGA-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer 2 (known interactions, Figure 2A)</td>
			<td>Sigma</td>
			<td>5&#39;-CCTCCCTGCCAAAACGTTTT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Protease inhibitor cocktail tablet</td>
			<td>Roche</td>
			<td>4693132001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Roche</td>
			<td>3115879001</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit</td>
			<td>ThermoFisher</td>
			<td>Q33327</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse</td>
			<td>Roche</td>
			<td>10109142001</td>
			<td></td>
		</tr>
		<tr>
			<td>SPRI Beads</td>
			<td>Beckman</td>
			<td>B23318</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Invitrogen</td>
			<td>15224-025</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA polymerase</td>
			<td>NEB</td>
			<td>M0203S</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 polynucleotide kinase (PNK)&#160;</td>
			<td>NEB</td>
			<td>M0201L</td>
			<td></td>
		</tr>
		<tr>
			<td>TaqPhusion</td>
			<td>NEB</td>
			<td>M0530S</td>
			<td>DNA polymerase</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td></td>
			<td></td>
			<td>Non-ionic surfactant for quenching of SDS</td>
		</tr>
	</tbody>
</table>

in-nucleus hi-c in drosophila cells

The genome is organized into topologically associating domains (TADs) delimited by boundaries that isolate interactions between domains. In Drosophila, the mechanisms underlying TAD formation and boundaries are still under investigation. The application of the in-nucleus Hi-C method described here helped to dissect the function of architectural protein (AP)-binding sites at TAD boundaries isolating the Notch gene. Genetic modification of domain boundaries that cause loss of APs results in TAD fusion, transcriptional defects, and long-range topological alterations. These results provided evidence demonstrating the contribution of genetic elements to domain boundary formation and gene expression control in Drosophila. Here, the in-nucleus Hi-C method has been described in detail, which provides important checkpoints to assess the quality of the experiment along with the protocol. Also shown are the required numbers of sequencing reads and valid Hi-C pairs to analyze genomic interactions at different genomic scales. CRISPR/Cas9-mediated genetic editing of regulatory elements and high-resolution profiling of genomic interactions using this in-nucleus Hi-C protocol could be a powerful combination for the investigation of the structural function of genetic elements.

Described below are the results of a successful Hi-C protocol (see a summary of the Hi-C protocol workflow in Figure 1A). There are several quality control checkpoints during the in-nucleus Hi-C experiment. Sample aliquots were collected before (UD) and after (D) the chromatin restriction step as well as after ligation (L). Crosslinks were reversed, and DNA was purified and run on an agarose gel. A smear of 200-1000 bp was observed when restriction with Mbo I was successful (<strong class="x...

Watch this Scientific Journal Video about In-Nucleus Hi-C in Drosophila Cells at JoVE.com

In-Nucleus Hi-C in Drosophila Cells

The genome is organized in the nuclear space into different structures that can be revealed through chromosome conformation capture technologies. The in-nucleus Hi-C method provides a genome-wide collection of chromatin interactions in Drosophila cell lines, which generates contact maps that can be explored at megabase resolution at restriction fragment level.

The genome is organized into topologically associating domains (TADs) delimited by boundaries that isolate interactions between domains. In Drosophila, ...

The nucleus Hi-C protocols allow the exploration of chromosomal confirmation at different resolution for the characterization of chromatin loops, domains, and compartment organizing the genome. This protocol provides high-resolution profiling of genomic interactions at different scales, yielding a more consistent coverage over the full range of genomic distances and data with less technical noise. Combining this protocol with genetic editing is a powerful strategy for testing the structural function of genetic elements.It can also be applied to the characterization of structural variations that lead to disease. The nucleus Hi-C protocol can be applied to explore the genome organization of any eukaryotic genome. Doing SDS and Triton treatment disaggregates any nuclear clumps by pipetting as aggregates interfere with enzymatic reaction efficiency, and be sure to perform the appropriate quality controls measure prior to sequencing.Begin by adding methanol-free formaldehyde to one times 10 to the seven Schneider's Line 2 Plus Drosophila cells in 17.5 milliliters of Schneider medium supplemented with 10%FBS to a final concentration of 2%Incubate the cells for 10 minutes at room temperature with mixing every 60 seconds or on a rotating wheel, and add glycine to a final concentration of 0.125 molar with mixing. After five minutes at room temperature and 15 minutes on ice, collect the cells by centrifugation and carefully resuspend the pellet in 25 milliliters of cold PBS and collect the cells with another centrifugation. At the end of the centrifugation, resuspend the cells in one milliliter of ice cold lysis buffer for counting and adjust the cells to a one times 10 to the six cells per milliliter concentration.Incubate the cells on ice for 30 minutes, inverting the tube every two minutes to mix and collect the cells with another centrifugation. Resuspend the pellet in one milliliter of fresh ice cold lysis buffer. After centrifugation, wash the lysate with one milliliter of 1.25X restriction buffer.Centrifuge again to collect the lysate. Resuspend the pellet in 360 microliters of fresh restriction buffer and 11 microliters of 10%SDS with careful pipetting and incubate for 45 minutes at 37 degrees Celsius and 7 to 950 revolutions per minute with occasional pipetting. At the end of the incubation, stop the permeabilization with 75 microliters of non-ionic surfactant and return the tube to the incubator for an additional 45 minutes with shaking at 950 revolutions per minute with occasional pipetting.For chromatin digestion, add 200 units of Mbo1 to the tube for a four to 16-hour incubation at 37 degrees Celsius with rotation. At the end of the incubation, inactivate the enzyme with 20-minute incubation at 60 degrees Celsius. To fill in the restriction fragment overhangs and to label the DNA ends with biotin, add 1.5 microliters each of 10 millimolar dCTP, dGTP, dTTP, 20 microliters of 0.4 millimolar biotin dATP, 17.5 microliters of tris low EDTA buffer, and 10 microliters of five units per microliter of DNA polymerase one large fragment to the tube with careful mixing.Incubate the reaction for 75 minutes at 37 degrees Celsius with shaking at 700 revolutions per minute every 10 seconds for 30 seconds. At the end of the incubation, add the ligation mix to the chromatin and adjust it to one milliliter final reaction volume with thorough gentle mixing and incubate overnight at 16 degrees Celsius. To degrade the sample proteins, add 50 microliters of 10 milligram per milliliter proteinase K to the tube for a two-hour incubation at 37 degrees Celsius.At the end of the incubation, increase the temperature to 65 degrees Celsius overnight to reverse crosslink the sample. The next morning, degrade the RNA with 10 microliters of 10 milligram per milliliter RNAse A.After one hour at 37 degrees Celsius, add one volume of phenol chloroform to the tube and mix thoroughly by inversion to obtain a homogenous white phase. After precipitating the DNA according to standard protocols, quantify the DNA using a fluorogenic dye that binds selectively to DNA and a fluorometer according to the manufacturer's instructions.To purify the DNA from undigested and digested aliquots, load 100 nanograms of undigested, digested, and ligated samples onto a 1.5%agarose gel and look for a smear centered around 500 base pairs in the digested sample versus a high molecular weight band for the ligated sample. To verify the Hi-C marking and ligation efficiency by amplification and digestion of a known interaction, after PCR, digest the products with Mbo1, Cla1, or both, and run the samples on a new 1.5 to 2%gel to allow estimation of the relative number of 3C and Hi-C ligation junctions. After sonicating the sample to obtain 200 to 500 base pair DNA fragments, transfer 130 microliters with five micrograms of DNA from each sample into new microcentrifuge tubes containing 16 microliters of 10X ligation buffer, two microliters of 10 millimolar dATP, five microliters of T4 DNA polymerase, and seven microliters of double distilled water for a 30-minute incubation at 20 degrees Celsius.At the end of the incubation, add five microliters of 10 millimolar dNTPs, four microliters of 10X ligation buffer, five microliters of T4 polynucleotide kinase, one microliter of DNA polymerase one large fragment, and 25 microliters of double distilled water to the tubes for a second 30-minute incubation at 20 degrees Celsius. To select fragments mostly in the 250 to 550 base pair size range, perform sequential solid phase reversible and mobilization size selection with 0.6X, then 0.9X according to the manufacturer's instructions and elute the DNA with 100 microliters of tris low EDTA. For biotin pulldown for each library, wash 150 microliters of Streptavidin-linked magnetic beads two times with 400 microliters of 1X Tween buffer and rotate the samples for three minutes on a rotating wheel.At the end of the incubation, resuspend the beads in 300 microliters of 2X no Tween buffer and mix with 300 microliters of Hi-C material for a 30-minute rotation on a rotating wheel. At the end of the incubation, wash the beads with 400 microliters of 0.5X Tween buffer for a three-minute incubation at 55 degrees Celsius and 750 revolutions per minute, followed by two washes in 200 microliters of 1X restriction buffer per wash. After the second wash, resuspend the beads in 100 microliters of dATP tailing mix for a 30-minute incubation at 37 degrees Celsius.At the end of the incubation, resuspend the beads in 50 microliters of 1X ligation buffer and transfer the suspension to a new tube containing four microliters pre-annealed paired end adapters and two microliters of T4 ligase. After two hours at room temperature, remove the supernatant and wash the beads two times with 400 microliters of Tween buffer, then wash the beads one time with 200 microliters of no Tween buffer and one time with 100 microliters of restriction buffer before re-suspending the beads in 40 microliters of 1X restriction buffer. A smear of 200 to 1, 000 base pairs is observed when restriction with Mbo1 is successful.If the ligation is successful, a high molecular weight band is observed at the top of the gel. Digestion efficiency can also be confirmed by quantitative PCR. An acceptable digestion efficiency is 80%or higher.As illustrated, the amplification of a known medium range interaction in Hi-C ligation products can be estimated by digestion of the PCR product recovered in the amplification. A digestion efficiency of more than 70%is recommended to avoid having a large proportion of non-useful reads for the libraries after sequencing. The number of PCR cycles for the final amplification should be one cycle less than the number of cycles for which the smear is visible.The level of digestion of the library indicates the abundance of valid Hi-C pairs and reflects the proportion of useful reads that will be obtained from the library. Using the unique valid Hi-C pairs, basic analysis of the pair distribution can be performed. As observed in this representative example, the NOTCH gene locus can be seen along with the architectural proteins, domains one and two, and histone modifications along the locus.Upon deletion of the region containing both the CTCF and M1BP DNA binding sites, a dramatic change in chromatin contacts can be observed. After Hi-C experiment, a can be performed to reach a specific set of contacts, for example, from promoter regions. This is particularly useful when assessing large genomes.As demonstrated, combining the Hi-C protocol with genetic addition can be used to assess the structural and regulatory function of genomic elements.

Research

JoVE Journal

Genetics

3.9K vues.  Universidad Nacional Autónoma de México. Les protocoles Hi-C du noyau permettent l’exploration de la confirmation chromosomique à différentes résolutions pour la caractérisation des boucles de chromatine, des domaines et des compartiments organisant le génome. Ce protocole fournit un profilage à haute résolution des interactions génomiques à différentes échelles, ce qui permet une couverture plus cohérente sur toute la gamme des distances et des données génomiques avec moins de bruit technique. La combinaison de ce p...