This work was supported by a Simons Foundation Bridge to Independence Award (SFARI Award #387972; J.J.Y.), a NARSAD Young Investigator Award from the Brain and Behavior Research Foundation (J.J.Y.), a Research Fellowship from the Alfred P. Sloan Foundation (J.J.Y.), and research grants from the Angelman Syndrome Foundation (J.J.Y.), the Whitehall Foundation (J.J.Y.), and the NIMH (R01MH122786; J.J.Y.).

1. Mutagenesis cloning to generate&#160;&#160;Ube3a variants
<ol>
	<li>Clone all Ube3a variants into the pCIG2 plasmid (Figure 1A), a bicistronic vector that contains a chicken-&#946;-actin promoter and an internal ribosome entry site (IRES) for EGFP expression19. Full-length Ube3a constructs contain an N-terminal Myc-tag sequence and are cloned into pCIG2 using a 5&#39; SacI site and a 3&#39; XmaI site. In addition, naturally occurring EcoRI, EcoRV, and PstI sites within the Ube3a coding sequence are also used to subclone fragments. 
	NOTE: De-identified variants for Ube3a can be obtained through the literature and in publicly accessible repositories such as the ClinVar database1. Additional unreported variants can be obtained through personal communication with medical centers.</li>
	<li>Use an adapted two-step megaprimer mutagenesis method20 to introduce mutations into the Ube3a reading frame. In the first step, design the mutagenic oligonucleotide that contains the desired mutation (the example shown in this protocol is to generate a UBE3A Q588E variant) flanked by at least 30 base pairs (bp) of homology 5&#8242; and 3&#8242; to the mutation (Figure 1B and Table 1).</li>
	<li>Use the mutagenic oligonucleotide along with a complementary oligonucleotide for the first round PCR to generate a 200-400 bp megaprimer containing the mutation (Figure 1C; Table 2 and Table 3). Use the entire 50 &#956;L of the PCR reaction volume for agarose gel electrophoresis using a 1% gel and subsequent gel purification (Table of Materials). Elute the PCR product in 30 &#956;L of deionized H2O (diH2O) for use in the second round PCR step below.</li>
	<li>Set up the second round PCR as indicated (Figure 1C; Table 2 and Table 3). This step will generate larger DNA fragments (typically ~1-1.5 kb in length) containing the mutation and terminal restriction sites suitable for sub-cloning (Figure 1C).</li>
	<li>After completion of the PCR reaction, purify the resulting product using a PCR purification kit (Table of Materials). Elute in 30 &#956;L and digest all of the purified product and the pCIG2 Ube3a WT construct with the appropriate restriction enzymes (the example shows digestion with EcoRI and XmaI).</li>
	<li>After 2 h of digestion at 37 &#176;C, resolve the digestion products through agarose gel electrophoresis (1% gel), and gel-purify the appropriate products. Set up ligations according to the manufacturer&#39;s protocol (Table of Materials), transform the ligation products into a DH10B bacterial strain (Table of Materials), and then plate with ampicillin (100 &#956;g/mL) selection.</li>
	<li>The next day, pick two to four colonies to inoculate 3 mL cultures containing Luria Broth (LB) and 100 &#956;g/mL ampicillin. Let the cultures grow overnight at 37 &#176;C in an orbital incubator with shaking (225 rpm).</li>
	<li>The following day, use 1-1.5 mL of the bacterial culture to miniprep the plasmid DNA (Table of Materials). Save the remaining culture by placing them at 4 &#176;C. Screen the miniprepped plasmids by Sanger sequencing using an oligonucleotide that binds ~200 bp from the desired mutation.</li>
	<li>Use the bacterial cultures saved at 4 &#176;C to re-inoculate 50 mL cultures to midiprep the correct plasmid (Table of Materials). Fully sequence the Ube3a coding sequence to validate the correct sequence of the DNA.</li>
	<li>Create working stocks of Ube3a variant plasmids, as well as the &#946;-catenin activated reporter (BAR)21, TK-Renilla luciferase, ligase-dead Ube3a (UBE3A C820A mutation), and pCIG2 empty vector at a concentration of 100 ng/&#956;L using sterile H2O for the subsequent transfection steps.</li>
</ol>
2. Preparation and transfection of human embryonic kidney 293T (HEK293T) cells
<ol>
	<li>Perform the assays in HEK293T cells grown in Dulbecco&#39;s modified Eagle medium (DMEM) pre-supplemented with glutamine, 10% fetal bovine serum (FBS), and antibiotic-antimycotic agent as described previously17. Grow the cells in a sterile, humidified incubator at 37 &#176;C with 5% CO2.</li>
	<li>Using a biosafety cabinet, first plate the suspended HEK293T cells onto tissue culture-treated 96-well flat-bottomed plates at a density of 2.2 &#215; 104 cells per well in 100 &#956;L of culture media and allow them to grow overnight.</li>
	<li>On the second day, transfect the cells in a biosafety cabinet with Firefly and Renilla luciferase reporter plasmids (Table 4) and Ube3a plasmids in triplicate. Perform the transfections in 10 &#956;L of total volume per well using a 10:1:8 ratio of plasmids (50 ng of BAR, 5 ng of TK-Renilla, and 40 ng of Ube3a plasmid per well, respectively), as previously described18, and 0.4 &#956;L of transfection reagent (Table 4). 
	NOTE: For each experiment, an empty vector (GFP only) and a plasmid encoding ligase-dead Ube3a are also transfected to serve as negative controls.</li>
	<li>Create a master mix for the transfections for each variant in a 1.5 mL microcentrifuge tube (Table 4) and incubate at room temperature (RT) for 15 min. After the incubation, gently agitate the transfection mixture by tapping the tube, and then add 10 &#956;L of the transfection mixture directly to the existing growth media in the wells.</li>
	<li>Afterward, return the cells to the incubator and allow the plasmids to express for 48 h. Replacement of the growth media is not necessary.</li>
	<li>Monitor the transfection efficiency by GFP fluorescence using a fluorescence microscope. HEK293T cells are efficiently transfected by this method, and &#62;80% of cells should express GFP after 48 h.</li>
</ol>
3. Measurement of luciferase activity
NOTE: Luciferase activity is assessed using a commercially available system that assays both Firefly and Renilla luciferase (Table of Materials) according to the manufacturer&#39;s protocol.
<ol>
	<li>Carefully aspirate the culture media from transfected HEK293T cells, and then wash the cells with cold phosphate-buffered saline (PBS). Aspirate the PBS and lyse the cells by adding 25 &#956;L of non-denaturing lysis buffer and incubate for 15 min with gentle rocking on ice.</li>
	<li>Afterward, add 20 &#956;L of the resulting lysate (no centrifugation is necessary) into a new 96-well assay plate containing 100 &#956;L of a Firefly luciferase substrate reagent. Mix the plate gently by tapping.</li>
	<li>Load the plate onto a plate reader and measure the luminescence using a top detector with a read height of 1 mm and an integration time of 1 s. 
	NOTE: The gain of the detector may need to be adjusted based on the strength of the signal.</li>
	<li>Immediately after reading the Firefly luciferase luminescence, add 100 &#181;L of Renilla luciferase substrate to the wells. This step simultaneously quenches the Firefly luciferase activity while assessing Renilla luciferase activity. Mix the samples by gentle agitation of the plate and measure the luminescence again to assess the Renilla luciferase activity. 
	NOTE: While other plates can be used for this assay, using plates with black frames and white wells will provide the most sensitive results as this amplifies the luciferase signal while minimizing noise.</li>
	<li>Quantify the reporter responses as the Firefly luciferase to Renilla luciferase ratio (Firefly/Renilla), and average the values of the triplicate measurements. Afterward, normalize the Firefly/Renilla value for each variant against the values for wild-type (WT) Ube3a expressing cells to compare the relative activity of variant proteins.</li>
</ol>

<ol>
	<li>Landrum, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ClinVar:+Public+archive+of+relationships+among+sequence+variation+and+human+phenotype.">ClinVar: Public archive of relationships among sequence variation and human phenotype.</a> Nucleic Acids Research. 42, 980-985 (2014).</li><li>Lek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein-coding+genetic+variation+in+60,706+humans.">Analysis of protein-coding genetic variation in 60,706 humans.</a> Nature. 536 (7616), 285-291 (2016).</li><li>Starita, L. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variant+interpretation:+Functional+assays+to+the+rescue.">Variant interpretation: Functional assays to the rescue.</a> American Journal of Human Genetics. 101 (3), 315-325 (2017).</li><li>Scheffner, M., Huibregtse, J. M., Vierstra, R. D., Howley, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+HPV-16+E6+and+E6-AP+complex+functions+as+a+ubiquitin-protein+ligase+in+the+ubiquitination+of+p53.">The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53.</a> Cell. 75 (3), 495-505 (1993).</li><li>Albrecht, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imprinted+expression+of+the+murine+Angelman+syndrome+gene,+Ube3a,+in+hippocampal+and+Purkinje+neurons.">Imprinted expression of the murine Angelman syndrome gene, Ube3a, in hippocampal and Purkinje neurons.</a> Nature Genetics. 17 (1), 75-78 (1997).</li><li>Rougeulle, C., Glatt, H., Lalande, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Angelman+syndrome+candidate+gene,+UBE3A/E6-AP,+is+imprinted+in+brain.">The Angelman syndrome candidate gene, UBE3A/E6-AP, is imprinted in brain.</a> Nature Genetics. 17 (1), 14-15 (1997).</li><li>Vu, T. H., Hoffman, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imprinting+of+the+Angelman+syndrome+gene,+UBE3A,+is+restricted+to+brain.">Imprinting of the Angelman syndrome gene, UBE3A, is restricted to brain.</a> Nature Genetics. 17 (1), 12-13 (1997).</li><li>Kishino, T., Lalande, M., Wagstaff, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UBE3A/E6-AP+mutations+cause+Angelman+syndrome.">UBE3A/E6-AP mutations cause Angelman syndrome.</a> Nature Genetics. 15 (1), 70-73 (1997).</li><li>Jiang, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutation+of+the+Angelman+ubiquitin+ligase+in+mice+causes+increased+cytoplasmic+p53+and+deficits+of+contextual+learning+and+long-term+potentiation.">Mutation of the Angelman ubiquitin ligase in mice causes increased cytoplasmic p53 and deficits of contextual learning and long-term potentiation.</a> Neuron. 21 (4), 799-811 (1998).</li><li>Mabb, A. M., Judson, M. C., Zylka, M. J., Philpot, B. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angelman+syndrome:+Insights+into+genomic+imprinting+and+neurodevelopmental+phenotypes.">Angelman syndrome: Insights into genomic imprinting and neurodevelopmental phenotypes.</a> Trends in Neuroscience. 34 (6), 293-303 (2011).</li><li>Hogart, A., Wu, D., LaSalle, J. M., Schanen, N. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+comorbidity+of+autism+with+the+genomic+disorders+of+chromosome+15q11.2-q13.">The comorbidity of autism with the genomic disorders of chromosome 15q11.2-q13.</a> Neurobiology of Disease. 38 (2), 181-191 (2010).</li><li>Urraca, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interstitial+duplication+15q11.2-q13+syndrome+includes+autism,+mild+facial+anomalies+and+a+characteristic+EEG+signature.">The interstitial duplication 15q11.2-q13 syndrome includes autism, mild facial anomalies and a characteristic EEG signature.</a> Autism Research. 6 (4), 268-279 (2013).</li><li>de la Torre-Ubieta, L., Won, H., Stein, J. L., Geschwind, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advancing+the+understanding+of+autism+disease+mechanisms+through+genetics.">Advancing the understanding of autism disease mechanisms through genetics.</a> Nature Medicine. 22 (4), 345-361 (2016).</li><li>Scheffner, M., Staub, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HECT+E3s+and+human+disease.">HECT E3s and human disease.</a> BMC Biochemistry. 8, (2007).</li><li>Cooper, E. M., Hudson, A. W., Amos, J., Wagstaff, J., Howley, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+analysis+of+Angelman+syndrome-associated+mutations+in+the+E3+ubiquitin+ligase+E6-associated+protein.">Biochemical analysis of Angelman syndrome-associated mutations in the E3 ubiquitin ligase E6-associated protein.</a> Journal of Biological Chemistry. 279 (39), 41208-41217 (2004).</li><li>Yi, J. J., Barnes, A. P., Hand, R., Polleux, F., Ehlers, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta+signaling+specifies+axons+during+brain+development.">TGF-beta signaling specifies axons during brain development.</a> Cell. 142 (1), 144-157 (2010).</li><li>Yi, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+autism-linked+UBE3A+T485A+mutant+E3+ubiquitin+ligase+activates+the+Wnt/beta-catenin+pathway+by+inhibiting+the+proteasome.">The autism-linked UBE3A T485A mutant E3 ubiquitin ligase activates the Wnt/beta-catenin pathway by inhibiting the proteasome.</a> Journal of Biological Chemistry. 292 (30), 12503-12515 (2017).</li><li>Weston, K. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+disease-linked+hyperactivating+mutations+in+UBE3A+through+large-scale+functional+variant+analysis.">Identification of disease-linked hyperactivating mutations in UBE3A through large-scale functional variant analysis.</a> Nature Communications. 12 (1), 6809 (2021).</li><li>Hand, R., Polleux, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurogenin2+regulates+the+initial+axon+guidance+of+cortical+pyramidal+neurons+projecting+medially+to+the+corpus+callosum.">Neurogenin2 regulates the initial axon guidance of cortical pyramidal neurons projecting medially to the corpus callosum.</a> Neural Development. 6, 30 (2011).</li><li>Karginov, A. V., Ding, F., Kota, P., Dokholyan, N. V., Hahn, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+allosteric+activation+of+kinases+in+living+cells.">Engineered allosteric activation of kinases in living cells.</a> Nature Biotechnology. 28 (7), 743-747 (2010).</li><li>Biechele, T. L., Moon, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assaying+beta-catenin/TCF+transcription+with+beta-catenin/TCF+transcription-based+reporter+constructs.">Assaying beta-catenin/TCF transcription with beta-catenin/TCF transcription-based reporter constructs.</a> Methods in Molecular Biology. , 99-110 (2008).</li><li>Yi, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Autism-linked+mutation+disables+phosphorylation+control+of+UBE3A.">An Autism-linked mutation disables phosphorylation control of UBE3A.</a> Cell. 162 (4), 795-807 (2015).</li><li>Kuhnle, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angelman+syndrome-associated+point+mutations+in+the+Zn(2+)-binding+N-terminal+(AZUL)+domain+of+UBE3A+ubiquitin+ligase+inhibit+binding+to+the+proteasome.">Angelman syndrome-associated point mutations in the Zn(2+)-binding N-terminal (AZUL) domain of UBE3A ubiquitin ligase inhibit binding to the proteasome.</a> Journal of Biological Chemistry. 293 (47), 18387-18399 (2018).</li><li>Yamamoto, Y., Huibregtse, J. M., Howley, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+E6-AP+gene+(UBE3A)+encodes+three+potential+protein+isoforms+generated+by+differential+splicing.">The human E6-AP gene (UBE3A) encodes three potential protein isoforms generated by differential splicing.</a> Genomics. 41 (2), 263-266 (1997).</li><li>Avagliano Trezza, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+nuclear+UBE3A+causes+electrophysiological+and+behavioral+deficits+in+mice+and+is+associated+with+Angelman+syndrome.">Loss of nuclear UBE3A causes electrophysiological and behavioral deficits in mice and is associated with Angelman syndrome.</a> Nature Neuroscience. 22 (8), 1235-1247 (2019).</li><li>Bossuyt, S. N. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+nuclear+UBE3A+activity+is+the+predominant+cause+of+Angelman+syndrome+in+individuals+carrying+UBE3A+missense+mutations.">Loss of nuclear UBE3A activity is the predominant cause of Angelman syndrome in individuals carrying UBE3A missense mutations.</a> Human Molecular Genetics. 30 (6), 430-442 (2021).</li></ol>

The authors have nothing to disclose.

The protocol described here provides an efficient and scalable method to assess the enzymatic activity of Ube3a variants. There are several technical details that warrant careful consideration when using this assay. One consideration is the choice of Wnt reporter plasmids used in this assay. The protocol described here specifically uses the &#946;-catenin activated reporter (BAR)21, a reporter that contains a concatemer of 12 T-cell factor (TCF) response elements separated by specifically designed linker sequences to minimize recombination and loss of TCF-binding sites. There are additional luciferase-based Wnt reporter plasmids described in the literature23, and although previous studies indicate that some can be used to assess UBE3A activity, the BAR plasmid has been most thoroughly characterized for this purpose17,18. Secondly, the choice of Renilla luciferase plasmid is critical. A plasmid encoding Renilla luciferase is included during the transfection step to normalize the transfection efficiency. The plasmid used in this protocol constitutively expresses Renilla luciferase under the control of a thymidine kinase (TK) promoter (TK-Renilla). The use of plasmids containing other promoters, such as the widely used cytomegalovirus (CMV) promoter, may lead to variable outcomes in Renilla luciferase expression.
A second consideration is the behavior of cells depending on the type and lot of FBS used for cell culture. For instance, FBS can variably affect the growth rate of HEK293T cells. The current protocol was optimized with cells exhibiting a typical doubling time of 18-24 h, making the cell density at the time of transfection approximately ~4 &#215; 104 cells per well. As cell density may affect transfection efficiencies, the cell growth rates should be carefully assessed by the user and the cell numbers adjusted accordingly at the time of plating. Additionally, the UBE3A-dependent BAR response requires some amount of Wnt ligand to be present during the experiment. In most standard conditions, there is enough Wnt in the FBS to drive this response; however, this response can also vary. The titration of plasmid ratios used for transfection is recommended to ensure the BAR response is measured within the appropriate linear range. An alternative approach is to stimulate Wnt signaling using a recombinant Wnt ligand or Wnt-supplemented growth media17.
An advantage of the BAR assay is that it can report the ubiquitin ligase activity of all Ube3a isoforms. Humans express three isoforms of Ube3a that differ at their extreme N-termini due to the use of alternative transcriptional start sites24. The BAR assay provides the same readout agnostic to isoforms, and thus, this assay can be used to assess all Ube3a variants. In addition, the large-scale characterization of Ube3a variants provides deep structure-function data that can uncover novel domains and mechanisms that are critical for enzyme function. A previous study utilized variant data to discover a ubiquitin-binding domain within UBE3A that facilitates ubiquitin chain elongation18. Additional structure-function studies will likely provide new insights into the biochemical mechanisms of UBE3A that may be leveraged for therapeutic development.
There are some limitations to the BAR assay that warrant careful consideration when determining the pathogenicity of a variant. Due to the epigenetic imprinting of Ube3a in neurons, this assay cannot discriminate maternal and paternal alleles, and additional genetic evidence must be weighed alongside functional data to determine the pathogenicity of a variant. Moreover, additional variables beyond the ubiquitin ligase activity of UBE3A must be considered in the context of disease. For example, previous work showed that nuclear-localized UBE3A contributes to Angelman syndrome pathology25 and that some variants perturb this localization pattern of the enzyme26. Thus, additional downstream characterizations must be performed to gain a complete understanding of the contribution of Ube3a variants to neurodevelopmental pathology.

Recent technological advances have made the sequencing of exomes and genomes routine in clinical settings1,2. This has led to the discovery of a large number of genetic variants, including millions of missense variants that typically change one amino acid in a protein. Understanding the functional significance of these variants remains a challenge, and only a small fraction (~2%) of the known missense variants have a clinical interpretation1,3.
A prominent example of this problem is Ube3a, a gene that encodes an E3 ubiquitin ligase that targets substrate proteins for degradation4. Ube3a resides within chromosome 15q11-13 and is expressed exclusively from the maternally inherited allele5,6,7. Observations from disease genetics strongly suggest that insufficient or excessive activity of the UBE3A enzyme causes distinct neurodevelopmental disorders. Deletion of maternal chromosome 15q11-13 causes Angelman syndrome (AS)8, a disorder characterized by severe intellectual disability, motor impairments, seizures, a happy demeanor with frequent smiling, and dysmorphic facial features8,9,10. In contrast, duplication or triplication of maternal chromosome 15q11-13 causes Dup15q syndrome, a heterogeneous condition recognized as one of the most prevalent syndromic forms of autism11,12,13. In addition, there are hundreds of missense variants identified in Ube3a, the majority of which are considered variants of uncertain significance (VUS) as their functional and clinical significance are unknown. Thus, there is considerable interest in developing methods that can empirically assess Ube3a variants to determine whether they contribute to neurodevelopmental disease.
The UBE3A enzyme belongs to the HECT (homologous to E6-AP C-terminus) domain family of E3 ubiquitin ligases that all possess the eponymous HECT domain, which contains the biochemical machinery necessary to accept activated ubiquitin from E2 enzymes and transfer it to substrate proteins14. Historically, the characterization of E3 enzymes has relied on reconstituted in vitro systems that require an ensemble of purified proteins4,15,16. Such methods are slow and labor-intensive and not amenable to assessing the activity of a large number of variants. In previous work, UBE3A was identified to activate the Wnt pathway in HEK293T cells by modulating the function of the proteasome to slow the degradation of &#946;-catenin17. This insight allows the use of Wnt pathway reporters as an efficient and rapid method to identify both loss- and gain-of-function variants of Ube3a18. The protocol below describes in detail a method to generate Ube3a variants as well as a luciferase-based reporter to assess changes in the activity of Ube3a variants.

<table><tbody><tr><td>0.05% Trypsin-EDTA (1x), phenol red</td><td>Gibco</td><td>25300-054</td><td></td></tr><tr><td>1 Kb DNA ladder</td><td>Lambda Biotech</td><td>M108-S</td><td></td></tr><tr><td>100 bp DNA Ladder</td><td>Lambda Biotech</td><td>M107</td><td></td></tr><tr><td>10x Buffer for T4 DNA Ligase with 10 mM ATP</td><td>New England BioLabs</td><td>B0202A</td><td></td></tr><tr><td>5x Phusion HF Reaction Buffer</td><td>New England BioLabs</td><td>B0518S</td><td></td></tr><tr><td>Antibiotic-Antimycotic Solution</td><td>Corning</td><td>30004CI</td><td></td></tr><tr><td>Black/White Isoplate-96 Black Frame White Well plate</td><td>PerkinElmer</td><td>6005030</td><td></td></tr><tr><td>Carbenicillin Disodium Salt</td><td>Midwest Scientific</td><td>KCC46000-5</td><td></td></tr><tr><td>Countess cell counting chamber&amp;nbsp; slides</td><td>Invitrogen by Thermo Fisher Scientific</td><td>C10283</td><td></td></tr><tr><td>Countess II Automated Cell Counter&amp;nbsp;</td><td>life technologies</td><td></td><td>Cell counting machine</td></tr><tr><td>Custom DNA oligos</td><td>Integrated DNA Technologies (IDT)</td><td></td><td></td></tr><tr><td>Deoxynucleotide (dNTP) Solution Mix</td><td>New England BioLabs</td><td>N0447S</td><td></td></tr><tr><td>DMEM, high glucose, GlutaMAX Supplement, pyruvate</td><td>Gibco</td><td>10569044</td><td>Basal medium for supporting the growth of HEK293T cell line</td></tr><tr><td>DPBS (1x)</td><td>Gibco</td><td>14190-136</td><td></td></tr><tr><td>Dual-Luciferase Reporter Assay System</td><td>Promega</td><td>E1910</td><td></td></tr><tr><td>EcoRI-HF&amp;nbsp;</td><td>New England BioLabs</td><td>R3101S</td><td>Restriction enzyme</td></tr><tr><td>Fetal Bovine Serum, qualified, heat inactivated</td><td>Gibco</td><td>16140071</td><td>Fetal bovine serum</td></tr><tr><td>Fisherbrand Surface Treated Tissue Culture Dishes</td><td>Fisherbrand</td><td>FB012924</td><td></td></tr><tr><td>FuGENE 6 Transfection Reagent</td><td>Promega</td><td>E2691</td><td></td></tr><tr><td>Gel Loading Dye Purple (6x)</td><td>New England BioLabs</td><td>B7024A</td><td></td></tr><tr><td>HEK293T cells</td><td>ATCC</td><td>CRL-3216</td><td></td></tr><tr><td>High Efficiency ig 10B Chemically Competent Cells</td><td>Intact Genomics</td><td>1011-12</td><td>E. coli DH10B cells</td></tr><tr><td>HiSpeed Plasmid Midi Kit</td><td>Qiagen</td><td>12643</td><td>Midi prep</td></tr><tr><td>pCIG2 plasmid</td><td></td><td></td><td></td></tr><tr><td>pGL3 BAR plasmid</td><td></td><td></td><td></td></tr><tr><td>Phusion HF DNA Polymerase</td><td>New England BioLabs</td><td>M0530L</td><td>DNA polymerase</td></tr><tr><td>ProFlex 3 x 32 well PCR System</td><td>Applied biosystems by life technologies</td><td></td><td>Thermocycler</td></tr><tr><td>pTK Renilla plasmid</td><td></td><td></td><td></td></tr><tr><td>QIAprep Spin Miniprep Kit (250)</td><td>Qiagen</td><td>27106</td><td>Mini prep</td></tr><tr><td>QIAquick Gel Extraction Kit (250)</td><td>Qiagen</td><td>28706</td><td>Gel purification</td></tr><tr><td>QIAquick PCR Purification Kit (250)</td><td>Qiagen</td><td>28106</td><td>PCR purification</td></tr><tr><td>rCutSmart Buffer</td><td>New England BioLabs</td><td>B6004S</td><td></td></tr><tr><td>SacI-HF</td><td>New England BioLabs</td><td>R3156S</td><td>Restriction enzyme</td></tr><tr><td>Synergy HTX Multi-Mode Reader</td><td>BioTek</td><td></td><td>&amp;nbsp;Plate reader runs Gen5 software v3.08 (BioTek)</td></tr><tr><td>T4 DNA Ligase</td><td>New England BioLabs</td><td>M0202L</td><td>Ligase</td></tr><tr><td>TAE Buffer, Tris-Acetate-EDTA, 50x Solution, Electrophoresis</td><td>Fisher Scientific</td><td>BP13324</td><td></td></tr><tr><td>Tissue Culture Plate 96 wells, Flat Bottom</td><td>Fisherbrand</td><td>FB012931</td><td></td></tr><tr><td>UltraPure Ethidium Bromide Solution</td><td>Invitrogen by Thermo Fisher Scientific</td><td>15585011</td><td></td></tr><tr><td>XmaI</td><td>New England BioLabs</td><td>R0180S</td><td>Restriction enzyme</td></tr></tbody></table>

a scalable, cell-based method for the functional assessment of ube3a variants

The increased use of sequencing in medicine has identified millions of coding variants in the human genome. Many of these variants occur in genes associated with neurodevelopmental disorders, but the functional significance of the vast majority of variants remains unknown. The present protocol describes the study of variants for Ube3a, a gene that encodes an E3 ubiquitin ligase linked to both autism and Angelman syndrome. Duplication or triplication of Ube3a is strongly linked to autism, whereas its deletion causes Angelman syndrome. Thus, understanding the valence of changes in UBE3A protein activity is important for clinical outcomes. Here, a rapid, cell-based method that pairs Ube3a variants with a Wnt pathway reporter is described. This simple assay is scalable and can be used to determine the valence and magnitude of activity changes in any Ube3a variant. Moreover, the facility of this method allows the generation of a wealth of structure-function information, which can be used to gain deep insights into the enzymatic mechanisms of UBE3A.

Large-scale functional screening of Ube3a missense variants identifies a broad landscape of loss- and gain-of-function mutations 
Previous work with Ube3a mutants suggested that the Wnt response can serve as a reporter of cellular UBE3A protein activity. These observations were expanded, and additional validation experiments were performed to investigate whether the BAR assay is suitable to report a range of UBE3A activities in the cell. First, HEK293T cells were transfected with varying amounts of plasmid DNA encoding human WT Ube3a. This experiment demonstrated that the BAR response changes linearly with the quantity of Ube3a transfected into cells (Figure 2A). Secondly, the BAR assay was tested using plasmid DNA encoding disease-linked variants previously characterized in the literature22. Among these were benign variants (R39H and A178T), one autism-linked gain-of-function variant (T458A), and a collection of confirmed Angelman syndrome-linked variants that cause a loss of UBE3A function through various mechanisms15,22. The BAR assay correctly identified each variant (Figure 2B), including all loss-of-function variants, demonstrating the accuracy and generality of this method18.
The BAR assay was used to screen 152 missense variants, most of which were identified from the ClinVar database. Similar to genetic evidence regarding copy number variations in Ube3a-dependent disorders, the functional impact of missense variants was broad and included benign variants as well as both loss-of-function and gain-of-function variants (Figure 3)18. Of particular interest, the gain-of-function variants identified using this method were all novel, and subsequent validation strongly suggested that they define a sub-class of Ube3a-dependent disorders with phenotypes that differ from classic Angelman syndrome18.
The effect of missense variants is often unpredictable, underscoring the need for functional assessment 
An intriguing observation from the functional screening of Ube3a variants is that changes at some amino acid positions produce drastically different effects, thereby underscoring the importance of empirical variant assessment18. For example, three individuals were identified with variants at the glutamine 588 (Q588) position in UBE3A that included a gain-of-function glutamate substitution (Q588E), a loss-of-function arginine substitution (Q588R), and another loss-of-function proline substitution (Q588P; Figure 4A). A comprehensive mutation approach was used to mutate the Q588 position to every possible amino acid. When the activity of these variants was measured using the BAR assay, it showed that any negatively charged amino acid at the 588 position produces a hyperactive enzyme (Figure 4B). This insight provided important functional clues that allowed the discovery of a novel site within the HECT domain of UBE3A that facilitates ubiquitin chain elongation18.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/64454/64454fig01.jpg" /> 
Figure 1: PCR-dependent mutagenesis of Ube3a. (A) Representation of the Ube3a expression vector indicating relevant restriction sites. (B) The DNA sequence encoding UBE3A is shown at the top. The Q588 codon is indicated by bold lettering. The Q588E mutagenesis primer (Mut. primer) is shown aligned to the UBE3A sequence. The red lettering indicates the mutagenized site. (C) A schematic of the PCR to generate the megaprimer and the DNA fragment used to subclone the Q588E fragment is shown. The position of the Q588E mutation is indicated by the red asterisk. <a href="https://www.jove.com/files/ftp_upload/64454/64454fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/64454/64454fig02.jpg" /> 
Figure 2: Validation of the BAR assay as a reporter of UBE3A ubiquitin ligase activity. (A) HEK293T cells transfected with increasing amounts of plasmid encoding WT UBE3A show a linear increase in the BAR response. Mean values are shown for Firefly/Renilla luciferase ratios &#177; standard error (SE). N= 3 independent experiments. (B) Previously characterized Ube3a variants were tested in the BAR assay. Responses were normalized to WT UBE3A, and the values are shown as the mean &#177; SE. The number of experiments (n) and p-values calculated using a one-sample t-test (two-tailed) with Benjamini-Hochberg multiple comparisons correction (FDR = 0.05) are as follows: GFP, n = 19, ***p = 1.733 &#215; 10&#8722;31; WT UBE3A, n = 19; UBE3A LD, n = 19, ***p = 1.519 &#215; 10&#8722;31; R39H, n = 3, p = 0.567; A178T, n = 4, p = 0.828; T485A, n = 5, *p = 0.019; C21Y, n = 3, ***p = 8.725 &#215; 10&#8722;6; C117R, n = 3, ***p = 3.419 &#215; 10&#8722;4; N243K, n = 3, **p = 0.0072; E269G, n = 3, **p = 7.787 &#215; 10&#8722;4; L273F, n = 3, **p = 0.0052; S349P, n = 3, **p = 0.0016; L502P, n = 3, **p = 0.0033; R506C, n = 3, **p = 0.0033; T106K, n = 6, **p = 0.0.0078; T106P, n = 3, **p = 0.0013; I130T, n = 6, *p = 0.016; R477P, n = 3, ***p = 4.24 &#215; 10&#8722;4; M478I, n = 3, ***p = 3.39 &#215; 10&#8722;4; R482P, n = 3, **p = 5.82 &#215; 10&#8722;4; I329T, n = 5, ***p = 1.22 &#215; 10&#8722;5; E550L, n = 3, *p = 0.0013. Data reprinted with permission from Weston et al.18. <a href="https://www.jove.com/files/ftp_upload/64454/64454fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/64454/64454fig03.jpg" /> 
Figure 3: UBE3A variants encompassing a wide range of functional effects. BAR assay screen of 152 Ube3a variants showing benign (gray), loss-of-function (blue), and gain-of-function (red) mutations relative to WT UBE3A. Significance was determined using a one-sample t-test (two-tailed) with Benjamini-Hochberg multiple comparisons correction (FDR = 0.05). Red, gain-of-function; Gray, no change from WT UBE3A; Blue, loss-of-function. Data reprinted with permission from Weston et al.18. <a href="https://www.jove.com/files/ftp_upload/64454/64454fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/64454/64454fig04.jpg" /> 
Figure 4: UBE3A variants encompassing a wide range of functional effects. (A) BAR assay results of variants at position 588 of UBE3A showing both loss- and gain-of-function substitutions. Q588E, n = 6; Q588P, n = 3; Q588R, n = 4; ***p &#60; 0.0005, One-sample t-test (two-tailed) with Benjamini-Hochberg multiple comparison correction (FDR = 0.05). (B) Heat plot showing normalized BAR results for comprehensive mutational analysis at position 588 in UBE3A. The white shading represents WT UBE3A activity levels, the blue shading indicates loss-of-function, and the red shading indicates gain-of-function. The scale bar shows the percent change relative to WT UBE3A. N = 3 independent experiments for Q588S, Q588T, Q588N, Q588K, Q588P, Q588M, Q588G, Q588A, Q588F, Q588Y, Q588W, Q588L, Q588V, Q588I, Q588C; n = 8 for Q588E, n = 6 for Q588D, n = 5 for Q588R, n = 4 for Q588H, *p &#60; 0.05, **p &#60; 0.005, ***p &#60; 0.0005. One-sample t-test (two-tailed) with Benjamini-Hochberg multiple comparisons correction (FDR = 0.05). Data reprinted with permission from Weston et al.18. <a href="https://www.jove.com/files/ftp_upload/64454/64454fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td colspan="2">Sequence</td>
			<td>Used for</td>
		</tr>
		<tr>
			<td>Primer 1</td>
			<td colspan="2">GATTATATTATGACAATAGAA 
			TTCGCATGTACAGTGAAC</td>
			<td>Ube3a EcoRI sense</td>
		</tr>
		<tr>
			<td>Mut. Primer</td>
			<td colspan="2">CCAGACCCAGTACTATGCCAAT 
			CAGAGTAAACTCACCCTCAGTT 
			TCAAAAGAAGATGGATTAAACC</td>
			<td>UBE3A Q588E mutagenesis antisense</td>
		</tr>
		<tr>
			<td>Primer 2</td>
			<td colspan="2">ATTATATTCCCGGGTTACAGCAT 
			GCCAAATCCTTTGG</td>
			<td>Ube3a XmaI antisense</td>
		</tr>
	</tbody>
</table>
Table 1: Primers used for UBE3A Q588E mutagenesis.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1st Round PCR</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Reaction Quantity</td>
		</tr>
		<tr>
			<td>5x high-fidelity buffer</td>
			<td>10 &#181;L</td>
		</tr>
		<tr>
			<td>dNTP (10 mM stock)</td>
			<td>1 &#181;L</td>
		</tr>
		<tr>
			<td>Primer 1 (10 mM stock)</td>
			<td>1 &#181;L&#160;</td>
		</tr>
		<tr>
			<td>Primer 2 (10 mM stock)</td>
			<td>1 &#181;L&#160;</td>
		</tr>
		<tr>
			<td>WT-Ube3a DNA (150 ng/&#181;L stock)</td>
			<td>1 &#181;L&#160;</td>
		</tr>
		<tr>
			<td>H2O</td>
			<td>35 &#181;L</td>
		</tr>
		<tr>
			<td>High-fidelity DNA polymerase</td>
			<td>1 &#181;L</td>
		</tr>
		<tr>
			<td>Total Volume</td>
			<td>50 &#181;L</td>
		</tr>
		<tr>
			<td>2nd Round PCR</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Reaction Quantity</td>
		</tr>
		<tr>
			<td>5x high-fidelity buffer</td>
			<td>10 &#181;L</td>
		</tr>
		<tr>
			<td>dNTP (10 mM stock)</td>
			<td>1 &#181;L</td>
		</tr>
		<tr>
			<td>Primer 3 (10 mM stock)</td>
			<td>1 &#181;L&#160;</td>
		</tr>
		<tr>
			<td>Purified PCR product (Megaprimer)</td>
			<td>30 &#181;L</td>
		</tr>
		<tr>
			<td>WT-Ube3a DNA (150 ng/&#181;L stock)</td>
			<td>1 &#181;L&#160;</td>
		</tr>
		<tr>
			<td>H2O</td>
			<td>6 &#181;L&#160;</td>
		</tr>
		<tr>
			<td>High-fidelity DNA polymerase</td>
			<td>1 &#181;L</td>
		</tr>
		<tr>
			<td>Total Volume</td>
			<td>50 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 2: PCR parameters for mutagenesis.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1st Round PCR</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Step</td>
			<td>Temperature</td>
			<td>Time</td>
		</tr>
		<tr>
			<td>Initial denaturation</td>
			<td>95 &#176;C</td>
			<td>2 min</td>
		</tr>
		<tr>
			<td colspan="3">(1 cycle)</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>95 &#176;C</td>
			<td>30 s</td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>50 &#176;C</td>
			<td>20 s</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>72 &#176;C</td>
			<td>15 s</td>
		</tr>
		<tr>
			<td colspan="3">(30 cycles)</td>
		</tr>
		<tr>
			<td>Final extension</td>
			<td>72 &#176;C</td>
			<td>1 min</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>4 &#176;C</td>
			<td>Infinite</td>
		</tr>
		<tr>
			<td>2nd Round PCR</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Step</td>
			<td>Temperature</td>
			<td>Time</td>
		</tr>
		<tr>
			<td>Initial denaturation</td>
			<td>95 &#176;C</td>
			<td>2 min</td>
		</tr>
		<tr>
			<td colspan="3">(1 cycle)</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>95 &#176;C</td>
			<td>30 s</td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>50 &#176;C</td>
			<td>20 s</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>72 &#176;C</td>
			<td>35 s</td>
		</tr>
		<tr>
			<td colspan="3">(30 cycles)</td>
		</tr>
		<tr>
			<td>Final extension</td>
			<td>72 &#176;C</td>
			<td>1 min</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>4 &#176;C</td>
			<td>Infinite</td>
		</tr>
	</tbody>
</table>
Table 3: PCR Program Parameters for Mutagenesis.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>Working concentration</td>
			<td>1x transfection</td>
			<td>3.5x master mix</td>
		</tr>
		<tr>
			<td>pGL3 BAR plasmid</td>
			<td>100 ng/&#181;L</td>
			<td>0.5 &#181;L</td>
			<td>1.75&#160; &#181;L</td>
		</tr>
		<tr>
			<td>pTK Renilla plasmid</td>
			<td>100 ng/&#181;L</td>
			<td>0.05 &#181;L</td>
			<td>0.175&#160; &#181;L</td>
		</tr>
		<tr>
			<td>Ube3a plasmid</td>
			<td>100 ng/&#181;L</td>
			<td>0.4 &#181;L</td>
			<td>1.4 &#181;L</td>
		</tr>
		<tr>
			<td>DMEM supplemented with glutamine</td>
			<td></td>
			<td>8.65 &#181;L</td>
			<td>30.275 &#181;L</td>
		</tr>
		<tr>
			<td>Transfection reagent</td>
			<td></td>
			<td>0.4 &#181;L</td>
			<td>1.4 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 4: Transfection mixtures.

Watch this Scientific Journal Video about A Scalable, Cell-Based Method for the Functional Assessment of Ube3a Variants at JoVE.com

A Scalable, Cell-Based Method for the Functional Assessment of Ube3a Variants

A simple and scalable method was developed to assess the functional significance of missense variants in Ube3a, a gene whose loss and gain of function are linked to both Angelman syndrome and autism spectrum disorder.

A Scalable, Cell-Based Method for the Functional Assessment of Ube3a Variants

The increased use of sequencing in medicine has identified millions of coding variants in the human genome. Many of these variants occur in genes ...

a-scalable-cell-based-method-for-functional-assessment-ube3a

Nanyang Technological University

Research

JoVE Journal

Neuroscience

1.9K Views.  Washington University School of Medicine. A simple and scalable method was developed to assess the functional significance of missense variants in Ube3a, a gene whose loss and gain of function are linked to both Angelman syndrome and autism spectrum disorder.

Video: A Scalable, Cell-Based Method for the Functional Assessment of Ube3a Variants

In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila

Advances in sequencing technology have made whole-genome and whole-exome datasets more accessible for both clinical diagnosis and cutting-edge human genetics research. Although a number of in silico algorithms have been developed to predict the pathogenicity of variants identified in these datasets, functional studies are critical to determining how specific genomic variants affect protein function, especially for missense variants. In the Undiagnosed Diseases Network (UDN) and other rare disease research consortia, model organisms (MO) including Drosophila, C. elegans, zebrafish, and mice are actively used to assess the function of putative human disease-causing variants. This protocol describes a method for the functional assessment of rare human variants used in the Model Organisms Screening Center Drosophila Core of the UDN. The workflow begins with gathering human and MO information from multiple public databases, using the MARRVEL web resource to assess whether the variant is likely to contribute to a patient&#39;s condition as well as design effective experiments based on available knowledge and resources. Next, genetic tools (e.g., T2A-GAL4 and UAS-human cDNA lines) are generated to assess the functions of variants of interest in Drosophila. Upon development of these reagents, two-pronged functional assays based on rescue and overexpression experiments can be performed to assess variant function. In the rescue branch, the endogenous fly genes are &#34;humanized&#34;&#160;by replacing the orthologous Drosophila gene with reference or variant human transgenes. In the overexpression branch, the reference and variant human proteins are exogenously driven in a variety of tissues. In both cases, any scorable phenotype (e.g., lethality, eye morphology, electrophysiology) can be used as a read-out, irrespective of the disease of interest. Differences observed between reference and variant alleles suggest a variant-specific effect, and thus likely pathogenicity. This protocol allows rapid, in vivo assessments of putative human disease-causing variants of genes with known and unknown functions.

In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila

The goal of this protocol is to outline the design and performance of in vivo experiments in Drosophila melanogaster to assess the functional consequences of rare gene variants associated with human diseases.

Advances in sequencing technology have made whole-genome and whole-exome datasets more accessible for both clinical diagnosis and cutting-edge human ...

Genetics

Functional Assessment of BRCA1 variants using CRISPR-Mediated Base Editors

Recent studies have investigated the risks associated with BRCA1 gene mutations using various functional assessment methods such as fluorescent reporter assays, embryonic stem cell viability assays, and therapeutic drug-based sensitivity assays. Although they have clarified a lot of BRCA1 variants, these assays involving the use of exogenously expressed BRCA1 variants are associated with overexpression issues and cannot be applied to post-transcriptional regulation. To resolve these limitations, we previously reported a method for functional analysis of BRCA1 variants via CRISPR-mediated cytosine base editor that induce targeted nucleotide substitution in living cells. Using this method, we identified variants whose functions remain ambiguous, including c.-97C&#62;T, c.154C&#62;T, c.3847C&#62;T, c.5056C&#62;T, and c.4986+5G&#62;A, and confirmed that CRISPR-mediated base editors are useful tools for reclassifying the variants of uncertain significance in BRCA1. Here, we describe a protocol for functional analysis of BRCA1 variants using CRISPR-based cytosine base editor. This protocol provides guidelines for the selection of target sites, functional analysis and evaluation of BRCA1 variants.

Functional Assessment of BRCA1 variants using CRISPR-Mediated Base Editors

People with BRCA1 mutations have a higher risk of developing cancer, which warrants accurate evaluation of the function of BRCA1 variants. Herein, we described a protocol for functional assessment of BRCA1 variants using CRISPR-mediated cytosine base editors that enable targeted C:G to T:A conversion in living cells.

Recent studies have investigated the risks associated with BRCA1 gene mutations using various functional assessment methods such as fluorescent reporter ...

Cancer Research

Profiling Ubiquitin and Ubiquitin-like Dependent Post-translational Modifications and Identification of Significant Alterations

Ubiquitin (ub) and ubiquitin-like (ubl) dependent post-translational modifications of proteins play fundamental biological regulatory roles within the cell by controlling protein stability, activity, interactions, and intracellular localization. They enable the cell to respond to signals and to adapt to changes in its environment. Alterations within these mechanisms can lead to severe pathological situations such as neurodegenerative diseases and cancers. The aim of the technique described here is to establish ub/ubls dependent PTMs profiles, rapidly and accurately, from cultured cell lines. The comparison of different profiles obtained from different conditions allows the identification of specific alterations, such as those induced by a treatment for example. Lentiviral mediated cell transduction is performed to create stable cell lines expressing a two-tags (6His and Flag) version of the modifier (ubiquitin or a ubl such as SUMO1 or Nedd8). These tags permit the purification of ubiquitin and therefore of ubiquitinated proteins from the cells. This is done through a two-step purification process: The first one is performed in denaturing conditions using the 6His tag, and the second one in native conditions using the Flag tag. This leads to a highly specific and pure isolation of modified proteins which are subsequently identified and semi-quantified by liquid chromatography followed by tandem mass spectrometry (LC-MS/MS) technology. Easy informatics analysis of MS data using Excel software enables the establishment of PTM profiles by eliminating background signals. These profiles are compared between each condition in order to identify specific alterations which will then be studied more specifically, starting with their validation by standard biochemistry techniques.

This protocol aims at establishing ubiquitin (Ub) and ubiquitin-likes (Ubls) specific proteomes in order to identify alterations of these kind of post-translational modifications (PTMs), associated with a specific condition such as a treatment or a phenotype.

Ubiquitin (ub) and ubiquitin-like (ubl) dependent post-translational modifications of proteins play fundamental biological regulatory roles within the ...

Biochemistry

A Reporter Based Cellular Assay for Monitoring Splicing Efficiency

During gene expression, the vital step of pre-mRNA splicing involves accurate recognition of splice sites and efficient assembly of spliceosomal complexes to join exons and remove introns prior to cytoplasmic export of the mature mRNA. Splicing efficiency can be altered by the presence of mutations at splice sites, the influence of trans-acting splicing factors, or the activity of therapeutics. Here, we describe the protocol for a cellular assay that can be applied for monitoring the splicing efficiency of any given exon. The assay uses an adaptable plasmid encoded 3-exon/2-intron minigene reporter, which can be expressed in mammalian cells by transient transfection. Post-transfection, total cellular RNA is isolated, and the efficiency of exon splicing in the reporter mRNA is determined by either primer extension or semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). We describe how the impact of disease associated 5&#8242; splice-site mutations can be determined by introducing them in the reporter; and how the suppression of these mutations can be achieved by co-transfection with U1 small nuclear RNA (snRNA) construct carrying compensatory mutations in its 5&#8242; region that basepairs with the 5&#8242;-splice sites at exon-intron junctions in pre-mRNAs. Thus, the reporter can be used for the design of therapeutic U1 particles to improve recognition of mutant 5&#8242; splice-sites. Insertion of cis-acting&#160;regulatory sites, such as splicing enhancer or silencer sequences, into the reporter can also be used to examine the role of U1 snRNP in regulation mediated by a specific alternative splicing factor. Finally, reporter expressing cells can be incubated with small molecules to determine the effect of potential therapeutics on constitutive pre-mRNA splicing or on exons carrying mutant 5&#8242; splice sites. Overall, the reporter assay can be applied to monitor splicing efficiency in a variety of conditions to study fundamental splicing mechanisms and splicing-associated diseases.

This protocol describes a minigene reporter assay to monitor the impact of 5&#180;-splice site mutations on splicing and develops suppressor U1 snRNA for the rescue of mutation-induced splicing inhibition. The reporter and suppressor U1 snRNA constructs are expressed in HeLa cells, and splicing is analyzed by primer extension or RT-PCR.

During gene expression, the vital step of pre-mRNA splicing involves accurate recognition of splice sites and efficient assembly of spliceosomal complexes ...

Evaluation of Substrate Ubiquitylation by E3 Ubiquitin-ligase in Mammalian Cell Lysates

Ubiquitylation is a post-translational modification which occurs in eukaryotic cells that is critical for several biological pathways' regulation, including cell survival, proliferation, and differentiation. It is a reversible process that consists of a covalent attachment of ubiquitin to the substrate through a cascade reaction of at least three different enzymes, composed of E1 (Ubiquitin-activation enzyme), E2 (Ubiquitin-conjugating enzyme), and E3 (Ubiquitin-ligase enzyme). The E3 complex plays an important role in substrate recognition and ubiquitylation. Here, a protocol is described to evaluate substrate ubiquitylation in mammalian cells using transient co-transfection of a plasmid encoding the selected substrate, an E3 ubiquitin ligase, and a tagged ubiquitin. Before lysis, the transfected cells are treated with the proteasome inhibitor MG132 (carbobenzoxy-leu-leu-leucinal) to avoid substrate proteasomal degradation. Furthermore, the cell extract is submitted to small-scale immunoprecipitation (IP) to purify the polyubiquitylated substrate for subsequent detection by western blotting (WB) using specific antibodies for ubiquitin tag. Hence, a consistent and uncomplicated protocol for ubiquitylation assay in mammalian cells is described to assist scientists in addressing ubiquitylation of specific substrates and E3 ubiquitin ligases.

We provide a detailed protocol for a ubiquitylation assay of a specific substrate and an E3 ubiquitin-ligase in mammalian cells. HEK293T cell lines were used for protein overexpression, the polyubiquitylated substrate was purified from cell lysates by immunoprecipitation, and resolved in SDS-PAGE. Immunoblotting was used to visualize this post-translational modification.

Ubiquitylation is a post-translational modification which occurs in eukaryotic cells that is critical for several biological pathways' regulation, ...

Assessing DUB Variants in Neurodevelopmental Disorders Using a Cleavage Assay

Measuring Enzymatic Activity of Neurodevelopmental Disorder-Associated Deubiquitylating Enzymes via an In Vitro Ubiquitin Chain Cleavage Assay

Neurodevelopmental disorders (NDDs) are associated with impairments in nervous system function but often remain poorly understood at the molecular level. Discrete disorders caused by single genes provide models to investigate mechanisms driving atypical neurodevelopment. Variants of genes encoding deubiquitylating enzyme (DUB) family proteins are associated with several NDDs, but there is a need to determine the pathogenic mechanisms of disorders driven by these gene variants. The impact of gene variants on DUB activity can be experimentally determined using a substrate-independent in vitro ubiquitin cleavage assay. This assay does not require knowledge of downstream substrates to directly measure catalytic activity. Here, the protocol for determining the impact of gene variants on enzymatic activity is modeled using the DUB Ubiquitin Specific Protease 27, X-linked (USP27X), which is mutated in X-linked intellectual disability 105 (XLID105). This experimental pipeline can be used to clarify the mechanisms underlying neurodevelopmental disorders driven by variants in DUB genes.

This protocol explains how to measure the effect of genetic variation associated with neurodevelopmental disorders on deubiquitylating enzyme activity by combining recombinant protein purification with ubiquitin chain cleavage assays.

Neurodevelopmental disorders (NDDs) are associated with impairments in nervous system function but often remain poorly understood at the molecular level. ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Biology

Reporter-based Growth Assay for Systematic Analysis of Protein Degradation

Protein degradation by the ubiquitin-proteasome system (UPS) is a major regulatory mechanism for protein homeostasis in all eukaryotes. The standard approach to determining intracellular protein degradation relies on biochemical assays for following the kinetics of protein decline. Such methods are often laborious and time consuming and therefore not amenable to experiments aimed at assessing multiple substrates and degradation conditions. As an alternative, cell growth-based assays have been developed, that are, in their conventional format, end-point assays that cannot quantitatively determine relative changes in protein levels.
Here we describe a method that faithfully determines changes in protein degradation rates by coupling them to yeast cell-growth kinetics. The method is based on an established selection system where uracil auxotrophy of URA3-deleted yeast cells is rescued by an exogenously expressed reporter protein, comprised of a fusion between the essential URA3 gene and a degradation determinant (degron). The reporter protein is designed so that its synthesis rate is constant whilst its degradation rate is determined by the degron. As cell growth in uracil-deficient medium is proportional to the relative levels of Ura3, growth kinetics are entirely dependent on the reporter protein degradation.
This method accurately measures changes in intracellular protein degradation kinetics. It was applied to: (a) Assessing the relative contribution of known ubiquitin-conjugating factors to proteolysis (b) E2 conjugating enzyme structure-function analyses (c) Identification and characterization of novel degrons. Application of the degron-URA3-based system transcends the protein degradation field, as it can also be adapted to monitoring changes of protein levels associated with functions of other cellular pathways.

Here we describe a robust biological assay for quantifying the relative rate of proteolysis by the ubiquitin-proteasome system. The assay readout is yeast growth rate in liquid culture, which is dependent on the cellular levels of a reporter protein comprising a degradation signal fused to an essential metabolic marker.

Protein degradation by the ubiquitin-proteasome system (UPS) is a major regulatory mechanism for protein homeostasis in all eukaryotes. The standard ...

Method for Measuring the Activity of Deubiquitinating Enzymes in Cell Lines and Tissue Samples

The ubiquitin-proteasome system has recently been implicated in various pathologies including neurodegenerative diseases and cancer. In light of this, techniques for studying the regulatory mechanism of this system are essential to elucidating the cellular and molecular processes of the aforementioned diseases. The use of hemagglutinin derived ubiquitin probes outlined in this paper serves as a valuable tool for the study of this system. This paper details a method that enables the user to perform assays that give a direct visualization of deubiquitinating enzyme activity. Deubiquitinating enzymes control proteasomal degradation and share functional homology at their active sites, which allows the user to investigate the activity of multiple enzymes in one assay. Lysates are obtained through gentle mechanical cell disruption and incubated with active site directed probes. Functional enzymes are tagged with the probes while inactive enzymes remain unbound. By running this assay, the user obtains information on both the activity and potential expression of multiple deubiquitinating enzymes in a fast and easy manner. The current method is significantly more efficient than using individual antibodies for the predicted one hundred deubiquitinating enzymes in the human cell.

The current protocol details a method for measuring the activity of functionally homologous deubiquitinating enzymes. Specialized probes covalently modify the enzyme and allow for detection. This method holds the potential to identify new therapeutic targets.

The ubiquitin-proteasome system has recently been implicated in various pathologies including neurodegenerative diseases and cancer. In light of this, ...

Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA)

Population and family-based genetic studies typically result in the identification of genetic variants that are statistically associated with a clinical disease or phenotype. For many diseases and traits, most variants are non-coding, and are thus likely to act by impacting subtle, comparatively hard to predict mechanisms controlling gene expression. Here, we describe a general strategic approach to prioritize non-coding variants, and screen them for their function. This approach involves computational prioritization using functional genomic databases followed by experimental analysis of differential binding of transcription factors (TFs) to risk and non-risk alleles. For both electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genetic variants, a synthetic DNA oligonucleotide (oligo) is used to identify factors in the nuclear lysate of disease or phenotype-relevant cells. For EMSA, the oligonucleotides with or without bound nuclear factors (often TFs) are analyzed by non-denaturing electrophoresis on a tris-borate-EDTA (TBE) polyacrylamide gel. For DAPA, the oligonucleotides are bound to a magnetic column and the nuclear factors that specifically bind the DNA sequence are eluted and analyzed through mass spectrometry or with a reducing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blot analysis. This general approach can be widely used to study the function of non-coding genetic variants associated with any disease, trait, or phenotype.

Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay EMSA and DNA-affinity Precipitation Assay DAPA

We present a strategic plan and protocol for identifying non-coding genetic variants affecting transcription factor (TF) DNA binding. A detailed experimental protocol is provided for electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genotype-dependent TF DNA binding.

Population and family-based genetic studies typically result in the identification of genetic variants that are statistically associated with a clinical ...

A Scalable, Cell-Based Method for the Functional Assessment of Ube3a Variants

Summary

Explore More Videos

Chapters in this video

In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila

Functional Assessment of BRCA1 variants using CRISPR-Mediated Base Editors

Profiling Ubiquitin and Ubiquitin-like Dependent Post-translational Modifications and Identification of Significant Alterations

A Reporter Based Cellular Assay for Monitoring Splicing Efficiency

Evaluation of Substrate Ubiquitylation by E3 Ubiquitin-ligase in Mammalian Cell Lysates

Measuring Enzymatic Activity of Neurodevelopmental Disorder-Associated Deubiquitylating Enzymes via an In Vitro Ubiquitin Chain Cleavage Assay

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Reporter-based Growth Assay for Systematic Analysis of Protein Degradation

Method for Measuring the Activity of Deubiquitinating Enzymes in Cell Lines and Tissue Samples

Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA)