Name: screening sperm for the rapid isolation of germline edits in zebrafish
Uploaded: 2023-02-10T12:10:00
Description: Watch this Scientific Journal Video about Screening Sperm for the Rapid Isolation of Germline Edits in Zebrafish at JoVE.com

We would like to thank Anna Hindes at Washington University School of Medicine for her initial efforts in obtaining good-quality sperm genomic DNA using the hot shot method. This work was funded by the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institutes of Health under Award (R01AR072009 to R.S.G.).

This study was carried out in line with the guidelines in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the University of Texas at Austin Animal Care and Use Committee (AUP-2021-00254).
1. Designing the sgRNA for CRISPR mutagenesis
<ol>
	<li>Obtain the exon sequence containing the targeted loci.</li>
	<li>Design a synthetic guide RNA (sgRNA) with a protospacer adjacent motif (PAM) site that is specific...

<ol>
	<li>Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+CRISPR/Cas9-mediated+knock-in+in+zebrafish+by+homology-independent+DNA+repair.">Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair.</a> Genome Research. 24 (1), 142-153 (2014).</li><li>Hwang, W. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+editing+in+zebrafish+using+a+CRISPR-Cas+system.">Efficient genome editing in zebrafish using a CRISPR-Cas system.</a> Nature Biotechnology. 31 (3), 227-229 (2013).</li><li>Jao, L. E., Wente, S. R., Chen, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+multiplex+biallelic+zebrafish+genome+editing+using+a+CRISPR+nuclease+system.">Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (34), 13904-13909 (2013).</li><li>Troutwine, B. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Reissner+fiber+is+highly+dynamic+in+vivo+and+controls+morphogenesis+of+the+spine.">The Reissner fiber is highly dynamic in vivo and controls morphogenesis of the spine.</a> Current Biology. 30 (12), 2353-2362 (2020).</li><li>Xu, Y., Li, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas+systems:+Overview,+innovations+and+applications+in+human+disease+research+and+gene+therapy.">CRISPR-Cas systems: Overview, innovations and applications in human disease research and gene therapy.</a> Computational and Structural Biotechnology Journal. 18, 2401-2415 (2020).</li><li>Creaser, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+technic+of+handling+the+zebrafish+(Brachydanio+rerio)+for+the+production+of+eggs+which+are+favorable+for+embryological+research+and+are+available+at+any+specified+time+throughout+the+year.">The technic of handling the zebrafish (Brachydanio rerio) for the production of eggs which are favorable for embryological research and are available at any specified time throughout the year.</a> Copeia. 1930 (4), 159-161 (1934).</li><li>Carmichael, C., Westerfiel, M., Varga, Z. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryopreservatin+and+in+vitro+fertilization+at+the+zebrafish+international+resource+center.">Cryopreservatin and in vitro fertilization at the zebrafish international resource center.</a> Methods in Molecular Biology. 546, 45-65 (2009).</li><li>Wang, Y., Troutwine, B. R., Zhang, H., Gray, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+axonemal+dynein+heavy+chain+10+gene+is+essential+for+monocilia+motility+and+spine+alignment+in+zebrafish.">The axonemal dynein heavy chain 10 gene is essential for monocilia motility and spine alignment in zebrafish.</a> Developmental Biology. 482, 82-90 (2021).</li><li>Gray, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Postembryonic+screen+for+mutations+affecting+spine+development+in+zebrafish.">Postembryonic screen for mutations affecting spine development in zebrafish.</a> Developmental Biology. 471, 18-33 (2021).</li><li>Brocal, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+identification+of+CRISPR/Cas9-induced+insertions/deletions+by+direct+germline+screening+in+zebrafish.">Efficient identification of CRISPR/Cas9-induced insertions/deletions by direct germline screening in zebrafish.</a> BMC Genomics. 17, 259 (2016).</li><li>Davis, M. W., Jorgensen, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ApE,+A+Plasmid+Editor:+A+freely+available+DNA+manipulation+and+visualization+program.">ApE, A Plasmid Editor: A freely available DNA manipulation and visualization program.</a> Frontiers in Bioinformatics. 2, 816619 (2022).</li><li>Labun, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CHOPCHOP+v3:+Expanding+the+CRISPR+web+toolbox+beyond+genome+editing.">CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing.</a> Nucleic Acids Research. 47, 171-174 (2019).</li><li>Hill, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly+Peak+Parser:+Method+and+software+for+identification+of+unknown+indels+using+sanger+sequencing+of+polymerase+chain+reaction+products.">Poly Peak Parser: Method and software for identification of unknown indels using sanger sequencing of polymerase chain reaction products.</a> Developmental Dynamics. 243 (12), 1632-1636 (2014).</li><li>Varshney, G. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+gene+targeting+and+phenotyping+in+zebrafish+using+CRISPR/Cas9.">High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9.</a> Genome Research. 25 (7), 1030-1042 (2015).</li><li>Liu, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hi-TOM:+A+platform+for+high-throughput+tracking+of+mutations+induced+by+CRISPR/Cas+systems.">Hi-TOM: A platform for high-throughput tracking of mutations induced by CRISPR/Cas systems.</a> Science China. Life Sciences. 62 (1), 1-7 (2019).</li><li>Sorlien, E. L., Witucki, M. A., Ogas, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+production+and+identification+of+CRISPR/Cas9-generated+gene+knockouts+in+the+model+system+Danio+rerio.">Efficient production and identification of CRISPR/Cas9-generated gene knockouts in the model system Danio rerio.</a> Journal of Visualized Experiments. (138), e56969 (2018).</li><li>Draper, B. W., Moens, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-throughput+method+for+zebrafish+sperm+cryopreservation+and+in+vitro+fertilization.">A high-throughput method for zebrafish sperm cryopreservation and in vitro fertilization.</a> Journal of Visualized Experiments. (29), e1395 (2009).</li><li>Parant, J. M., George, S. A., Pryor, R., Wittwer, C. T., Yost, H. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+and+efficient+method+of+genotyping+zebrafish+mutants.">A rapid and efficient method of genotyping zebrafish mutants.</a> Developmental Dynamics. 238 (12), 3168-3174 (2009).</li></ol>

This protocol describes a method for rapidly characterizing putative genome edits or targeted mutations using CRISPR-Cas technology by focused analysis on F0 male sperm genomes. This protocol should be amenable to other animal models where sperm is readily available for sampling without euthanasia. This method will increase the throughput of screening for desired edits and is especially useful for identifying rare HDR-mediated knock-in events. This approach also serves to reduce the number of experimental animals used to...

The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas system is a powerful tool to perform loci-specific mutagenesis and precise genome editing in the Danio rerio (zebrafish) model system1,2,3,4. The Cas-ribonucleoprotein (RNP) is comprised of two main components: a Cas endonuclease (commonly Cas9 or Cas12a) and a locus-specific synthetic guide RNA (sgRNA)5. Together, the Cas-RNP generates a double-stranded break (DSB) in the desired locus that can be repaired by one of two intrinsic repair mechanisms. The non-homologous end joining (NHEJ) repair mechanism is error-prone and often results in a variety of insertions or deletions (indels) around the DSB. These indels can be deleterious if they introduce a frameshift mutation or premature stop in the resultant protein sequence. Alternatively, the homology-directed repair (HDR) mechanism uses a donor template with regions of homology surrounding the DSB site to repair the damage. Researchers can take advantage of the HDR system to generate precise genomic edits. Specifically, they can co-inject a double-stranded DNA donor construct that contains the desired edits as well as regions of homology flanking the DSB site in the genome. The increased economy of scale for these commercially produced CRISPR components has greatly reduced the barriers to screening multiple loci and to setting up larger-scale efforts for precise genome editing. However, in sexually reproducing animal models, a major bottleneck is the identification and isolation of germline-stable mutant animals.
The zebrafish model system exhibits several key qualities that enhance its use in reverse genetic studies. They are easy to rear in large numbers with basic aquatic housing equipment, and females exhibit high fecundity all year round6. Moreover, their external egg-laying and fertilization make them amenable to the microinjection of CRISPR/Cas components. The Cas-RNP is commonly injected into one-cell stage zebrafish embryos to generate DSBs/repair that is, in theory, inherited by all the daughter cells. However, diploid genomes require two DSB/repair events to mutagenize both homologous chromosomes. Furthermore, although Cas-RNP is injected at the one-cell stage, the DSB/repair may not occur until later points in development. Together, these factors contribute to the mosaic nature of F0-injected fish. A common practice is to outcross F0-injected fish and screen the F1 progeny for indels/specific edits. However, since not all F0-injected fish possess germline mutations, this practice results in many unproductive crosses that do not generate the desired edit. Screening the F0 germline rather than F1 somatic tissue increases the probability of isolating the desired germline edit and reduces the number of animals required in this process.
Sperm can easily be collected from F0-injected zebrafish without the need for euthanasia. This feature allows for the cryopreservation and rederivation of frozen sperm stocks7 but can also be exploited to rapidly screen, identify, and isolate the germline carriers of desired genomic mutations8,9. Brocal et al. (2016) previously described a sequencing-based method for screening germline edits in F0-injected male zebrafish10. Although useful for identifying the mutated alleles present in the germline, this approach can become costly in high throughput and may not be accessible for all labs. In contrast, the current protocol offers an approachable and cost-effective electrophoresis-based strategy for identifying germline edits. Specifically, this protocol outlines a robust method for screening and isolating germline mutations at specific loci using high-resolution agarose gel electrophoresis. In addition, this protocol describes a similar strategy for identifying the successful integration of a donor construct containing specific edits. As always, if specific edits are desired, sequencing-based strategies can be performed in tandem with the protocol described below. Although this protocol is specific to the zebrafish model system, these principles should be adaptable to any model in which the collection of sperm is a routine procedure. Together, these strategies will allow for the identification of F0-injected males with germline indels/edits&#160;that can be resolved on a gel after standard polymerase chain reaction (PCR) and/or restriction digest.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Agarose powder&#160;</td>
			<td>Fisher BioReagents</td>
			<td>BP1356-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Breeding tanks</td>
			<td>Carolina Biological&#160;</td>
			<td>161937</td>
			<td></td>
		</tr>
		<tr>
			<td>BstNI Restriction Enzyme</td>
			<td>NEB</td>
			<td>R0168S</td>
			<td></td>
		</tr>
		<tr>
			<td>Cas9 Endonuclease</td>
			<td>IDT</td>
			<td>1081060</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA Ladder, 100 bp&#160;</td>
			<td>Thermo Scientific&#160;</td>
			<td>FERSM0241</td>
			<td></td>
		</tr>
		<tr>
			<td>dnah10 donor construct&#160;&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>DNA Oligo in Tube; 0.025 nM, standard desalt purification, dry. 
			Phosphorothioate bond on the donor at the first three phosphate bonds on both the 5&#8217; and 3&#8217; ends (5&#39;-CCTCTCTCCCTTTCAGAAGCTTC 
			TGCTCATCCGCTGCTTCTGCCT 
			GGACCGAGTGTACCGTGCCGTC 
			AGTGATTACGTCACGC-3&#39;)</td>
			<td></td>
		</tr>
		<tr>
			<td>dnah10 forward primer&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>DNA Oligo in Tube; 0.025 nM, standard desalt purification, dry (5&#39;-CATGGAACTCTTTCCTAATGAGT 
			TTGGC-3&#39;)</td>
			<td></td>
		</tr>
		<tr>
			<td>dnah10 reverse primer&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>DNA Oligo in Tube; 0.025 nM, standard desalt purification, dry (&#39;5-AGTAGAGATCACACATCAACAGA 
			ATACAGC-3&#39;)&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>dnah10 synthetic sgRNA&#160;</td>
			<td>Synthego&#160;</td>
			<td>Synthetic sgRNA, target sequence: 5&#39;-GCTCATCCGCTGCTTCAGGC-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Electrophoresis power supply</td>
			<td>Thermo Scientific&#160;</td>
			<td>105ECA-115</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter forceps</td>
			<td>Millipore</td>
			<td>XX6200006P</td>
			<td></td>
		</tr>
		<tr>
			<td>Fish (system) water</td>
			<td>Generic</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel electrophoresis system (including casting frame, comb, and electrophoresis chamber)&#160;</td>
			<td>Thermo Scientific&#160;</td>
			<td>B2</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel imaging light box&#160;</td>
			<td>Azure Biosystems</td>
			<td>AZI200-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel stain, 10000X&#160;</td>
			<td>Invitrogen</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass bowl, 250 mL&#160;</td>
			<td>Generic</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>Isolation tanks, 0.8 L&#160;</td>
			<td>Aquaneering</td>
			<td>ZT080</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcap capillary tube with bulb, 20 &#181;L&#160;</td>
			<td>Drummond</td>
			<td>1-000-0020/CA</td>
			<td></td>
		</tr>
		<tr>
			<td>Minicentrifuge</td>
			<td>Bio-Rad</td>
			<td>12011919EDU</td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipettes, various with appropriate tips</td>
			<td>Generic&#160;</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>Microwave&#160;</td>
			<td>Generic&#160;</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease free water</td>
			<td>Promega</td>
			<td>P119-C</td>
			<td></td>
		</tr>
		<tr>
			<td>Paper towels</td>
			<td>Generic</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR tubes, 0.2 mL</td>
			<td>Bioexpress</td>
			<td>T-3196-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Plastic spoon, with drilled holes/slots&#160;</td>
			<td>Generic</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>KCl solution, 0.2 M RNAse Free</td>
			<td>Sigma-Aldrich</td>
			<td>P9333</td>
			<td></td>
		</tr>
		<tr>
			<td>p2ry12 forward primer&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>DNA Oligo in Tube; 0.025 nM, standard desalt purification, dry (5&#39;-CCCAAATGTAATCCTGACCAGT 
			-3&#39;)</td>
			<td></td>
		</tr>
		<tr>
			<td>p2ry12 reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td>DNA Oligo in Tube; 0.025 nM, standard desalt purification, dry (5&#39;-CCAGGAACACATTAACCTGGAT 
			-3&#39;)&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>p2ry12 synthetic sgRNA&#160;</td>
			<td>Synthego&#160;</td>
			<td>Synthetic sgRNA, target sequence: 5&#39;-GGCCGCACGAGGTCTCCGCG-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Restriction Enzyme 10X Buffer</td>
			<td>NEB</td>
			<td>B6003SVIAL</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH solution, 50 mM&#160;</td>
			<td>Thermo Scientific&#160;</td>
			<td>S318; 424330010</td>
			<td></td>
		</tr>
		<tr>
			<td>Sponge, 1-inch x 1-inch cut with small oval divot</td>
			<td>Generic&#160;</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereomicroscope</td>
			<td>Zeiss</td>
			<td>Stemi 508</td>
			<td></td>
		</tr>
		<tr>
			<td>Taq polymerase master mix, 2X</td>
			<td>Promega</td>
			<td>M7122</td>
			<td></td>
		</tr>
		<tr>
			<td>TBE Buffer Concentrate, 10X</td>
			<td>VWR</td>
			<td>E442</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermal Cycler</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>Tissue paper</td>
			<td>Fisher Scientific</td>
			<td>06-666</td>
			<td></td>
		</tr>
		<tr>
			<td>Tricaine-methanesulfonate solution (Syncaine, MS-222), 0.016% in fish water (pH 7.0&#177;0.2)&#160;</td>
			<td>Syndel</td>
			<td>200-266</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris Base, 1M (Buffered with HCl to ph 8.0)&#160;</td>
			<td>Promega</td>
			<td>H5131</td>
			<td></td>
		</tr>
	</tbody>
</table>

screening sperm for the rapid isolation of germline edits in zebrafish

The advent of targeted CRISPR-Cas nuclease technologies has revolutionized the ability to perform precise genome editing in both established and emerging model systems. CRISPR-Cas genome editing systems use a synthetic guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to specific genomic DNA loci, where the Cas endonuclease generates a double-strand break. The repair of double-strand breaks by intrinsic error-prone mechanisms leads to insertions and/or deletions, disrupting the locus. Alternatively, the inclusion of double-stranded DNA donors or single-stranded DNA oligonucleotides in this process can elicit the inclusion of precise genome edits ranging from single nucleotide polymorphisms to small immunological tags or even large fluorescent protein constructs. However, a major bottleneck in this procedure can be finding and isolating the desired edit in the germline. This protocol outlines a robust method for screening and isolating germline mutations at specific loci in Danio rerio (zebrafish); however, these principles may be adaptable in any model where in vivo sperm collection is possible.

The experimental approaches described in this protocol allow for the more rapid identification of genome edits or putative deleterious alleles by focusing on the analysis of thousands of genomes derived from the collection of F0-injected male sperm. Figure 2 highlights how to interpret the results obtained using this protocol.
To generate mutations in the p2ry12 locus, one-cell stage zebrafish embryos were injected with Cas9 endonuclease and a p2ry12<...

Watch this Scientific Journal Video about Screening Sperm for the Rapid Isolation of Germline Edits in Zebrafish at JoVE.com

Screening Sperm for the Rapid Isolation of Germline Edits in Zebrafish

CRISPR-Cas technologies have revolutionized the field of genome editing. However, finding and isolating the desired germline edit remains a major bottleneck. Therefore, this protocol describes a robust method for quickly screening F0 CRISPR-injected zebrafish sperm for germline edits using standard PCR, restriction digest, and gel electrophoresis techniques.

The advent of targeted CRISPR-Cas nuclease technologies has revolutionized the ability to perform precise genome editing in both established and emerging ...

Research

JoVE Journal

Genetics

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the ...

Detection of Copy Number Alterations Using Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

Formaldehyde-assisted Isolation of Regulatory Elements to Measure Chromatin Accessibility in Mammalian Cells

Appropriate gene expression in response to extracellular cues, that is, tissue- and lineage-specific gene transcription, critically depends on highly ...

Mating-based Overexpression Library Screening in Yeast

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool ...

Isolation, Characterization and MicroRNA-based Genetic Modification of Human Dental Follicle Stem Cells

To date, several stem cell types at different developmental stages are in the focus for the treatment of degenerative diseases. Yet, certain aspects, such ...

Screening Cotton Genotypes for Reniform Nematode Resistance

A rapid non-destructive reniform nematode (Rotylenchulus reniformis) screening protocol is needed for the development of resistant cotton (Gossypium ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...