Cost-Efficient Transcriptomic-Based Drug Screening

Summary

This protocol describes a workflow from ex vivo or in vitro cell cultures to transcriptomic data pre-processing for cost-effective transcriptome-based drug screening.

Abstract

Transcriptomics allows to obtain comprehensive insights into cellular programs and their responses to perturbations. Despite a significant decrease in the costs of library production and sequencing in the last decade, applying these technologies at the scale necessary for drug screening remains prohibitively expensive, obstructing the immense potential of these methods. Our study presents a cost-effective system for transcriptome-based drug screening, combining miniaturized perturbation cultures with mini-bulk transcriptomics. The optimized mini-bulk protocol provides informative biological signals at cost-effective sequencing depth, enabling extensive screening of known drugs and new molecules. Depending on the chosen treatment and incubation time, this protocol will result in sequencing libraries within approximately 2 days. Due to several stopping points within this protocol, the library preparation, as well as the sequencing, can be performed time-independently. Processing simultaneously a high number of samples is possible; measurement of up to 384 samples was tested without loss of data quality. There are also no known limitations to the number of conditions and/or drugs, despite considering variability in optimal drug incubation times.

Introduction

The development of new drugs is a complex and time-consuming process that involves identifying potential drugs and their targets, optimizing and synthesizing drug candidates, and testing their efficacy and safety in preclinical and clinical trials¹. Traditional methods for drug screening, i.e., the systematic assessment of libraries of candidate compounds for therapeutic purposes, involve the use of animal models or cell-based assays to test the effects on specific targets or pathways. While these methods have been successful in identifying drug candidates, they often did not provide sufficient insights into the complex molecular mechanisms und....

Protocol

This protocol follows the guidelines of the local ethics committees of the University of Bonn.

1. Preparation of buffers, solutions, and equipment

1. Prepare the solutions and gather the materials described in Table of Materials.
2. Heat up the water bath to 37 °C and warm up the complete growth medium (RPMI-1640 + 10% fetal calf serum (FCS) + 1% penicillin/streptomycin).
3. For cell harvesting, use ice-cold phosphate-buffered salin.......

Discussion

Drug discovery and drug development can greatly benefit from the holistic view of cellular processes that bulk transcriptomics can provide. Nevertheless, this approach is often limited by the high cost of the experiment with standard bulk RNA-seq protocol, prohibiting its application in academic settings as well as its potential for industrial scalability.

The most critical steps of the protocol are cell thawing and the initial steps of library preparation. Ensuring high viability of the cells.......

Materials

Name	Company	Catalog Number	Comments
50 mL conical tube	fisher scientific	10203001
Adhesive PCR Plate Seals	Thermo Fisher Scientific	AB0558
Amplicon Tagment Mix (ATM)	Illumina	FC-131-1096	Nextera XT DNA Library Prep Kit (96 samples)
AMPure XP beads	Beckman Coulter	A 63881
Betaine	Sigma-Aldrich	61962
Cell culture grade 96-well plates	Thermo Fisher Scientific	260860
Cell culture vacuum pump (VACUSAFE)	Integra Bioscience	158300
Deoxynucleotide triphosphates (dNTPs) mix 10 mM each	Fermentas	R0192
DMSO	Sigma-Aldrich	276855
DTT (100 mM)	Invitrogen	18064-014
EDTA	Sigma-Aldrich	798681	for adherent cells
Ethanol	Sigma-Aldrich	51976
Fetal Bovine Serum	Thermo Fisher Scientific	26140079
Filter tips (10 µL)	Gilson	F171203
Filter tips (100 µL)	Gilson	F171403
Filter tips (20 µL)	Gilson	F171303
Filter tips (200 µL)	Gilson	F171503
Guanidine Hydrochloride	Sigma-Aldrich	G3272
ISPCR primer (10 µM)	Biomers.net GmbH	SP10006	5′-AAGCAGTGGTATCAACGCAGAG T-3′
KAPA HiFi HotStart ReadyMix (2X)	KAPA Biosystems	KK2601
Magnesium chloride (MgCl2)	Sigma-Aldrich	M8266
Magnetic stand 96	Ambion	AM10027
Neutralize Tagment (NT) Buffer	Illumina	FC-131-1096	Nextera XT DNA Library Prep Kit (96 samples), alternatively 0.2 % SDS
Nextera-compatible indexing primer	Illumina
Nuclease-free water	Invitrogen	10977049
PBS	Thermo Fisher Scientific	AM9624
PCR 96-well plates	Thermo Fisher Scientific	AB0600
PCR plate sealer	Thermo Fisher Scientific	HSF0031
Penicillin / Streptomycin	Thermo Fisher Scientific	15070063
Qubit 4 fluorometer	Invitrogen	15723679
Recombinant RNase inhibitor (40 U/ul)	TAKARA	2313A
RPMI-1640 cell culture medium	Gibco	61870036	If not working with PBMCs, adjust to cell type
SMART dT30VN primer	Sigma-Aldrich		5' Bio-AAGCAGTGGTATCAACGCAGAG TACT30VN-3
Standard lab equipment	various	various	e.g. centrifuge, ice machine, ice bucket, distilled water, water bath
SuperScript II Reverse Transcriptase (SSRT II)	Thermo Fisher Scientific	18064-014
SuperScript II Reverse Transcriptase (SSRT II) buffer (5x)	Thermo Fisher Scientific	18064-014
Tagment DNA Buffer (TD)	Illumina	FC-131-1096	Nextera XT DNA Library Prep Kit (96 samples)
TapeStation system 4200	Agilent	G2991BA
Thermocycler (S1000)	Bio-Rad	1852148
TSO-LNA (100 uM)	Eurogentec		5' Biotin AAGCAGTGGTATCAACGCAGAG TACAT(G)(G){G
Vortex-Genie 2 Mixer	Sigma-Aldrich	Z258415