RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

Summary

The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

Abstract

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and forests. The immature stages of Trichogramma offspring develop within the host egg, exhibiting remarkable diminutiveness (approximately 0.5 mm in adult length). RNA-interference (RNAi) methodology has emerged as a crucial tool for elucidating gene functions in numerous organisms. However, manipulating RNAi in certain small parasitoid species, such as Trichogramma, has generally posed significant challenges. In this study, we present an efficient RNAi method in Trichogramma denrolimi. The outlined procedure encompasses the acquisition and isolation of individual T. dendrolimi specimens from host eggs, the design and synthesis of double-stranded RNA (dsRNA), the in vitro transplantation and cultivation of T. dendrolimi pupae, the micro-injection of dsRNA, and the subsequent assessment of target gene knockdown through RT-qPCR analysis. This study furnishes a comprehensive, visually detailed procedure for conducting RNAi experiments in T. dendrolimi, thereby enabling researchers to investigate the gene regulation in this species. Furthermore, this methodology is adaptable for RNAi studies or micro-injections in other Trichogramma species with minor adjustments, rendering it a valuable reference for conducting RNAi experiments in other endoparasitic species.

Introduction

Trichogramma spp. are a group of egg parasitoids that have been extensively utilized as highly efficient biological control agents against a wide spectrum of lepidopteran pests in agricultural and forest ecosystems worldwide^1,2,3,4. The application of mass-reared Trichogramma provides an environmentally friendly approach for the sustainable management of pests^5,6,7. Understanding the molecular biology of Trichogramma wasps provides valuable insights into enhancing the mass-rearing efficiency and field performance of these biological control agents^8,9by investigating the methodology of gene regulation and genome editing¹⁰.

Since the discovery of double-stranded RNA (dsRNA)-mediated specific genetic interference in Caenorhabditis elegans in 1998, the RNA-interference (RNAi) method has evolved into a vital genetic toolkit for exploring the regulatory mechanisms of organisms by suppressing the expression of target genes¹¹. RNAi experiments have become a standard methodology widely applied to study gene function in numerous insect species^12,13. Nevertheless, the manipulation of RNAi presents a formidable challenge in many parasitoid species, particularly among those belonging to the endoparasitic Chalcidoidea family^14,15,16. The RNAi method has been documented in at least 13 parasitoid species^{14,15,16,17,18,19}. Among these, the RNAi approach has been comprehensively conducted in Nasonia wasps and is applicable throughout the developmental stages, including embryos, larvae, pupae, and adults^14,15,16. It is noteworthy that Nasonia wasps are ectoparasitoids, with their offspring developing in the interstitial space between the host pupa and the puparium, enabling their cultivation in vitro and making them tolerate certain treatments, such as micro-injection. Unlike Nasonia wasps, Trichogramma individuals undergo their entire embryonic, larval, and pupal development inner the host egg. The layer at embryo and larva stages (which may impede dsRNA permeability), vulnerability to damage, and the difficulty in surviving in vitro present formidable obstacles^20,21,22. Additionally, the diminutive size of Trichogramma individuals, approximately ~0.5 mm in adult or pupal length, renders them exceedingly intricate to manipulate^20,21,22.

In the present study, we outline a comprehensive procedure for conducting RNA interference (RNAi) experiments in Trichogramma denrolimi Matsumura. This procedure encompasses the following procedures: (1) the design and synthesis of double-stranded RNA (dsRNA), (2) microinjection of T. denrolimi pupae, (3) the transplantation and in vitro incubation of these pupae, and (4) the detection of target gene knockdown through RT-qPCR analysis. The target gene selected for the RNAi experiment is the ferritin heavy chain homology (Ferhch). FerHCH, an iron-binding protein, contains a ferroxidase center endowed with antioxidant capabilities, facilitating the oxidation of Fe²⁺ to Fe³⁺. It plays an indispensable role in the growth and development of various organisms by maintaining redox equilibrium and iron homeostasis. Depletion of FerHCH can result in the overaccumulation of iron, leading to irreversible tissue damage, and often culminating in significant phenotypic alterations, including growth defects, deformities, and mortality^23,24. This study offers a step-by-step guide for conducting RNAi in T. denrolimi, which will be invaluable for investigating the gene functions within the broader context of Trichogramma wasps.

Protocol

NOTE: See the Table of Materials for details related to all materials, instruments, software, and reagents used in this protocol.

1. Collection and maintenance of insect culture

1. Adhere a group of ~5,000 eggs of Corcyra cephalonica (Stainton) onto a 9 cm by 16 cm card using a 1:5 (v/v) solution of gum arabic powder and water^25,26.
   NOTE: Avoid attaching too many host eggs to the card as overcrowding makes it impractical for subsequent transfer and dissection procedures.
2. To prevent the hatching of host eggs, subject the host egg cards to 30 min of ultraviolet (UV) irradiation (Figure 1-i). Subsequently, cut the paper with inactivated eggs into egg cards measuring 1 cm thick and 8 cm in diameter, each containing approximately 300-500 eggs (Figure 1-ii)^25,26,27.
3. Introduce a cohort of 80-120 T. denrolimi wasps into a glass tube measuring 2 cm in diameter and 8 cm in length. Seal the tube with cotton.
   NOTE: Maintain the wasps at a temperature of 25 ± 1 °C, with a light/dark cycle of 16 h of light and 8 h of darkness and maintain a relative humidity of approximately 75%.
4. Present a host egg card to the wasps for parasitization (Figure 1-ii). Permit the wasps to deposit their eggs into the host eggs for 6 h, after which promptly remove the wasps.
   ​NOTE: Avoid prolonging the parasitization period excessively as this can lead to overcrowding of T. denrolimi offspring within a host egg, resulting in increased offspring wasp mortality^28,29.

2. Synthesis of dsRNA

1. Design primer sets containing a T7 promoter for the synthesis of double-stranded RNA (dsRNA). Choose a 300-400 bp segment from the targeted gene (Ferhch) for dsRNA synthesis.
2. Acquire commercially synthesized primer sets for the production of dsRNA for the targeted gene and dsGFP for use as a negative control.
3. Extract RNA content from 100 T. denrolimi wasps using the referenced kit following the manufacturer's protocol⁹. Check the quality of RNA content; proceed if the value of OD260/OD280 ranges from 1.8 to 2.0⁹.
4. Purify the RNA content with 2 µL of 5x buffer (1 U/50 µL), 1 µL of DNAse (1 U/50 µL), and 6.5 µL of RNA (~100 ng/µL), 0.5 µL of H₂O at 42 °C for 2 min.
5. Perform reverse transcriptase polymerase chain reaction (RT-PCR) to generate a cDNA template with 10 µL of purified RNA (~100 ng/µL), 4 µL of 5x buffer (1 U/50 µL), 1 µL of Enzyme Mix I (1 U/50 µL), and 4 µL of H₂O. Perform RT-PCR using the following settings: 37 °C for 15 min, 85 °C for 5 s. Store the cDNA product at -4 °C until use.
6. Perform polymerase chain reaction (PCR) to amplify the dsRNA sequences in accordance with the referenced master mix (10 µL of Taq II [1 U/50 µL], 0.8 µL of forward primer [0.4 µM], 0.8 µL of reverse primer [0.4 µM], 0.8 µL of DNA template [40 ng/µL], and 7.6 µL of H₂O). Perform PCR using the following settings: 94 °C for 2 min; 35 cycles with 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30; 72 °C for 2 min.
7. Assess the quality of PCR products by electrophoresis on a 2.0% agarose gel^5,9 and confirm the target sequence through Sanger sequencing.
8. Purify the PCR product using the Gel Extraction Kit as per the manufacturer's guidelines^9,23.
9. Utilize an RNAi System to synthesize dsRNA for the target gene with 10 µL of 2x buffer (0.02 U/µL), 8 µL of DNA template (75 ng/µL), and 2 µL of enzyme mix (1 U/50 µL) with the following settings: 37 °C for 30 min, 70 °C for 10 min, and 25 °C for 20 min. Elute the synthesized dsRNA with 30 µL of Nuclease-Free Water.
10. Assess the quality of the dsRNA product by visualizing it on a 1.0% agarose gel^5,9. Dilute the dsRNA to 7,000 ng/µL. Check the quality of the dsRNA product; proceed if the value of OD260/OD280 ranges from 1.8 to 2.0⁹. Store the dsRNA product at -20 °C until use.

3. Transplantation of T. denrolimi pupae

1. Cultivate the parasitized host eggs for approximately 8 days at 25 ± 1°C, maintaining a 16 h light/8 h dark cycle and a relative humidity of ~75%. The parasitized host eggs will blacken after 5 days³⁰ (Figure 1-iv,v).
2. Transfer the host egg card to a dissecting microscope. Employ a pair of tungsten needles (Figure 1-vi) to meticulously remove the chorion from the host eggs (Figure 1-vii) and retrieve the pupa from within (Figure 1-viii)^5,17,18.
   NOTE: The tip of the dissecting needle should be less than 0.05 mm.
3. Prepare a clean plate for the substrate. Pour out 10-15 mL of a 15 g/L agar solution, allowing it to naturally cool (Figure 2-i).
   NOTE: Mix the agar solution with 0.5 g of streptomycin to inhibit the growth of contaminants in vitro.
4. Employ a disinfected graver to etch several grooves measuring 0.2-0.3 mm in depth and 0.4-0.8 mm in width (Figure 2-ii).
5. Use a small brush (Figure 2-iii) to transplant a pupa from the dissected host egg into one of the grooves on the agar substrate (Figure 2-iv).
6. Repeat steps 3.4 and 3.5, transplanting 100-300 pupae individually into the grooves one by one (Figure 2-v).

4. Micro-injecting dsRNA into T. denrolimi pupa

1. Use a glass needle puller to pull a glass capillary (Figure 3-i,ii). Set the Heat to 280, the Velocity to 170, the Delay to 250, and the Pull to 30 on a needle puller (Figure 3-iii). Prepare multiple capillary glass needles for microinjection (Figure 3-iv,v).
2. Bevel the tip of the glass needle using an abrasive plate (Figure 3-vi).
   NOTE: Ensure that the injection needle's tip remains sharp; otherwise, it may result in pupal mortality or impede reagent flow through the needle (Figure 3-vii).
3. Load approximately 2 µL of the dsRNA injection solution with 7,000 ng/µL into the prepared injection needle using a micro-injection pump (Figure 3-vii).
4. Transfer the agar substrate containing hundreds of pupae onto the platform of a compound microscope (Figure 3-viii).
5. Carefully insert the injection needle into the abdomen of a T. denrolimi pupa at a ~30° angle to the abdomen under the lens (Figure 3-ix).
6. Gradually inject ~5 nL of the injection solution (step 4.3) into the T. denrolimi pupa as gently as possible.
   NOTE: The T. denrolimi pupa may slightly swell as the dsRNA solution is injected. Injecting an excessive amount of solution into the pupa or using needles with overly large openings may result in premature pupal death. Change the needles when they become clogged after injecting several to tens of pupae.
7. Repeat steps 4.5 and 4.6, injecting dsRNA into 600 pupae one by one.
   ​NOTE: For reliable RT-qPCR analysis, RNA content should be isolated from at least 100 pupae. Inject at least 600 pupae for three replicates in the dsRNA treatment and three replicates in the dsGFP negative control⁹.

5. Incubation of T. denrolimi pupae

1. Transfer the substrate containing injected pupae to an incubator at 25 ± 1 °C with a 16 h/8 h light/dark cycle and ~75% RH.
2. Incubate approximately 700 T. denrolimi pupae per treatment for either 24 h or 48 h. Extract RNA content from a group of 100 pupae per replicate⁹.
   ​NOTE: Remove the shrunk pupae (dead pupae) from the samples; otherwise, it may result in errors in the detection of gene expression.
3. Incubate ~50 T. denrolimi pupae per treatment until the wasps emerge (Figure 3-x). Record the emergence rate and deformity rate.

6. Detection of targeted gene expression

1. Design the primer set for the target gene and reference genes for RT-qPCR using a design tool.
   NOTE: Ensure that the sequences of the RT-qPCR primers do not overlap with the targeted region of dsRNA.
2. Employ the gene forkhead box O (FoxO) as the reference gene in the RT-qPCR analysis; the primers of FoxO have been reported previously⁹.
3. Obtain commercially synthesized primer sets. Perform RT-qPCR with 10 µL of Taq II (1 U/50 µL), 0.8 µL of forward primer (0.4 µM), 0.8 µL of reverse primer (0.4 µM), 0.8 µL of template (10 ng/µL), and 7.6 µL of H₂O. Perform RT-qPCR using the following settings: 95 °C for 30 s; 35 cycles with 95 °C for 5 s, 57 °C for 30 s, 72 °C for 30; 95 °C for 10 s; 60 °C for 5 s, and 95 °C for 5 s.
4. Calculate the expression value of the targeted gene by using the 2^-ΔΔCt method^9,25.
5. Employ the Kruskal-Wallis test to analyze the expression of the target gene under the influence of different treatments (dsFerhch, dsGFP, non-injection).
   NOTE: Avoid using parametric tests (e.g., t-test) for post-hoc comparisons as the data's heteroscedasticity and non-normality may lead to erroneous conclusions²⁵.

Results

The emergence rate of T. denrolimi pupae injected with dsFerhch was significantly lower than that of those injected with dsGFP or those without injection (Table 1). Among the emerged wasps, 51.85% of T. denrolimi wasps subjected to dsFerhch developed deformed small wings. The deformed wasps were not observed in the wasps injected with dsGFP or without any injection (Table 1). Moreover, the abdomens of T. denrolimi pupae injec...

Discussion

Trichogramma wasps are recognized as effective biological control agents, specifically targeting a range of lepidopteran pests in agriculture and forestry¹. These diminutive wasps undergo their immature stages within the host egg, a characteristic that presents challenges in conducting RNAi experiments^5,18. This study offers a comprehensive visual guide for conducting RNAi experiments in T. denrolimi. Given the shared bio...

Materials

Name	Company	Catalog Number	Comments
2x ES Taq MasterMix (Dye)	Cowin Biotech, China	CW0690H	To amplify the dsRNA sequences
20x PBS Buffer, DEPC treated (7.2-7.6)	Sangon Biotech, China	B540627-0500	To dilute dsRNA
Agar strip	Shishi Globe Agar Industries Co.,Ltd, China	n/a	To make culture medium
Ampicillin sodium	Sangon Biotech, China	A610028	To make culture medium
Bioer Constant temperature metal bath	BIOER, China	MB-102	To synthesis dsRNA
Borosilicate glass capillary	WPI, USA	1B100-4	To pull capillary glass needle
Clean bench	Airtech, China	SW-CJ-1FD	To extract RNA
Double distilled water	Sangon Biotech, China	A500197-0500	To dilute cDNA
Environmental Testing chamber	Panasonic, Japan	MLR-352H-PC	To culture T. denrolimi
Eppendorf Centrifuge	Eppendrof, Germany	5418R	To store RNA content
Eppendorf FemtoJet 4i	Eppendrof, Germany	FemtoJet 4i	To inject T. denrolimi
Eppendorf Refrigerated Centrifuge	Eppendrof, Germany	5810R	Centrifuge
Ethanol solution (75%, RNase-free)	Aladdin, China	M052131-500ml	To extract RNA
Gel Extraction Kit	Omega, USA	D25000-02	To extract cDNA
GUM Arabic	Solarbio, China	CG5991-500g	To make egg card
Isopropyl alchohol	Aladdin, China	80109218	To extract RNA
Laser-Based Micropipette Puller	SUTTER, USA	P-2000	To pull capillary glass needle
Microloader	Eppendrof, Germany	20 µL	To load dsRNA
Multi-sample tissue grinder	LICHEN, China	LC-TG-24	To grind T. denrolimi
Needle Grinder	SUTTER, USA	BV-10-E	To grind capillary glass needle
Nuclease-Free Water	Sangon Biotech, China		To dilute RNA
OLYMPUS Microscope	OLYMPUS, Japan	XZX16	To observe T. denrolimi
PCR machine	Bio-rad, USA	S-1000	For DNA amplification
PowerPac Basic	Bio-rad, USA	PowerPacTM Basic	To detect the quality of dsRNA
Primer of dsGFP (Forward)			[TAATACGACTCACTATAGGG] ACAAACCAAGGCAAGTAATA
Primer of dsGFP (Reverse)			[TAATACGACTCACTATAGGG] CAGAGGCATCTTCAACG
Primer of Ferhch for qPCR (Forward)			TGAAGAGATTCTGCGTTCTGCT
Primer of Ferhch for qPCR (Reverse)			CTGTAGGAACATCAGCAGGCTT
Primer of Ferhch for RNAi (Reverse)			[TAATACGACTCACTATAGGG]AG TAGCCATCATCTTTCC
Primer of Ferhch for RNAi(Forward)			[TAATACGACTCACTATAGGG] ACACTGTCAATCGTCCTG
Primer of FoxO for qPCR (Forward)			CTACGCCGATCTCATAACGC
Primer of FoxO for qPCR (Reverse)			TGCTGTCGCCCTTGTCCT
PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time)	TaKaRa, Japan	RR047A
Quantitative Real-time PCR	Bio-rad, USA	CFX 96 Touch	To perform reverse transcriptase polymerase chain reaction (RT-PCR)
Real-time PCR (TaqMan) Primer and Probes Design Tool			https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool/
T7 RiBoMAX Express RNAi System	Promega, USA	P1700	To synthesis dsRNA  in vitro
TB Green Premix Ex TaqTM (Til RnaseH Plus)	TaKaRa, Japan	RR820A	To perform RT-qPCR
Trichloromethane	KESHI, China	GB/T682-2002	To extract RNA
TRIzol Reagent	Ambion, USA	15596018	To extract total RNA content from samples
Ultra-low Temperature Freezer	Thermo, USA	Forma 911