This work was supported by the National Institute of Agricultural, Forestry, and Livestock Research (INIFAP). We thank Jerzayn Fraustro Esquivel for his collaboration in the development of the video associated with this document.

This study was approved by and conducted in strict accordance with the recommendations for the use of animals provided by the Institutional Animal Care and Use Committee (IACUC) of the Centro Nacional de Investigaci&#243;n Disciplinaria en Microbiolog&#237;a Animal (CENID-MA).
1. Samples
<ol>
	<li>Use different areas of the brain dissected from 6 different rabies-positive bovine brains for RT-PCR analysis.</li>
</ol>
2. Direct fluorescent antibodies (DFAs) to confirm rabies
NOTE: Detection of the rabies antigen by DFA is a qualitative method to determine the presence of the rabies nucleoprotein using fluorescein-labeled antibodies. The test was performed using the protocol provided by Dean et al. (1966)20, as described below.
<ol>
	<li>Make two impressions from each tissue dissected from different brain structures on a sterile slide of approximately 15 mm diameter. Use a wooden applicator to smear an approximately 3 mm3 portion of the tissue onto the sterile slide. To create the smear, gently press the wooden applicator against the slide manually.</li>
	<li>Fix the sample smear slides by submersing the slides in 100% acetone for 1 h at -20 &#176;C. After incubation, dry the slides on a dry cloth at 21 &#176;C for 30 min.</li>
	<li>Add 50 &#181;L of the fluorescein-labeled anti-nucleoprotein antibody to each brain smear at a 1:10 dilution by dispensing through a syringe.</li>
	<li>Incubate the slides with the conjugate in a humid chamber at 37 &#176;C for 1 h.</li>
	<li>After incubation, wash the slides twice with water and with PBS to eliminate excess conjugate. Allow the slides to dry at 21 &#176;C. Carefully blot to remove excess liquid and then briefly air-dry prior to mounting.</li>
	<li>Add a drop of 50% phosphate glycerin to cover the surface of the section, and then cover with a coverslip. Observe the sections under an epifluorescence microscope at 40x magnification.
	<ol>
		<li>Process and observe the positive and negative controls (positive control: mouse brains inoculated with RABV; negative controls: RABV-negative bovine brains) in the same manner as the samples.</li>
	</ol>
	</li>
</ol>
3. Generating positive control for RT-PCR
<ol>
	<li>Obtain BHK-21 cells from the germplasm bank. Use cells up to the 70th passage to replicate the RABV Evelyn-Rokitnicki-Abelseth (ERA) strain using passage 2.</li>
	<li>Maintain and propagate BHK-21 cells in bottles containing minimum essential medium (MEM) supplemented with 10% fetal calf serum (FCS) at 37 &#176;C in the presence of CO2 (5%) and under humid conditions. Grow the cells in 25 cm2 culture flasks until they reach 80% confluence and then subculture.</li>
	<li>Remove the culture medium from the cells and wash the bottle with phosphate buffered saline (PBS). Inoculate the culture with 105 TCID/mL of RABV strain ERA. Incubate the viral inoculum for 2 h under constant shaking at 37 &#176;C in the presence of CO2 (5%) and under humid conditions.</li>
	<li>Remove the infection medium and add MEM supplemented with 5% (serum fetal bovine) SFB. Incubate for 72 h at 37 &#176;C in the presence of CO2 (5%) in humid conditions.</li>
	<li>Harvest RABV 3 days after inoculation when the cells exhibit cytopathic effects. Freeze the infected cells and then thaw them at 4 &#176;C to lyse the cells. Collect the medium from the bottle, and then place the cells into a centrifuge tube for centrifugation at 1,050 x g for 10 min at 4 &#176;C.</li>
	<li>Store the supernatants from RABV at -80 &#176;C, and prepare working aliquots for storage at -70 &#176;C.</li>
	<li>Intracerebrally inoculate the virus obtained in the previous step into 21 day old female CD1 mice. Use a 1 mL syringe to inoculate 50 &#956;L of solutions containing 106 MICLD50 (mouse infectious culture lethal dose 50%) doses into mice22.</li>
</ol>
4. RNA extraction
NOTE: Total RNA was extracted directly from bovine brains using an organic extraction method according to following protocol.
<ol>
	<li>Use 100 mg of brain tissue from each anatomical structure to extract total RNA using a commercially available reagent containing guanidium isothiocyanate.</li>
	<li>Manually homogenize a total of 100 mg of tissue from each structure in 1 mL of the guanidium isothiocyanate reagent by vortexing using a Dounce homogenizer with a small pestle inside the microtube for 15 s at maximum speed.</li>
	<li>Incubate the samples on ice for 5 min, and then add 200 &#956;L of chloroform. Mix the samples vigorously for 15 s, incubate on ice for 2 to 3 min, and then centrifuge at 12,000 x g for 15 min at 4 &#176;C.</li>
	<li>Transfer the aqueous phase to a clean tube and add 500 &#956;L of isopropyl alcohol. Incubate the samples for 15 min at 21 &#176;C.</li>
	<li>Centrifuge the samples at 12,000 x g for 10 min at 4 &#176;C. Aspirate the aqueous supernatant by pipetting. The isolated RNA will be present as a pellet in the tube.</li>
	<li>Next, wash the RNA pellet with 1 mL of 75% ethanol by pipetting, and centrifuge at 7500 x g for 5 min at 4 &#176;C.</li>
	<li>Decant the supernatant and air-dry the RNA pellet at room temperature (21 &#176;C). Next, dilute the pellet in 50 &#956;L of nuclease-free water.</li>
	<li>Determine the RNA concentration and quality at 260 nm using a spectrophotometer. Store RNA at -80 &#176;C until use.</li>
	<li>Remove DNA from RNA samples by digestion with DNase I. Add 2 U of DNase I per 1 &#181;g of RNA extracted in the previous step. Next, add 5 &#181;L of 10x reaction buffer and then incubate at 37 &#176;C for 30 min. Inactivate the DNase I by adding 1 &#956;L of EDTA to the mixture followed by incubation for 10 min at 65 &#176;C.</li>
</ol>
5. cDNA synthesis and PCR
<ol>
	<li>Synthesize first-strand cDNA using oligo dT and reverse transcriptase. For every 1 &#956;g of RNA, add 1 &#956;L of oligo DT (500 &#956;g/mL), 1 &#956;L of 10 mM dNTP mix, and nuclease-free distilled water to a final volume of 12 &#956;L. Incubate the mixture at 65 &#176;C for 5 min.</li>
	<li>Chill the reaction mixture to 4 &#176;C. Centrifuge the tube for 30 s at 1,050 x g, and then add 4 &#956;L of reaction buffer, 2 &#956;L 0.1 M DTT, and 1 &#956;L of ribonuclease inhibitor (40 U/&#956;L).</li>
	<li>Incubate the reaction mixture at 37 &#176;C for 2 min, and then add 1 &#181;L of reverse transcriptase (200 U). Next, incubate the reaction mixture for 50 min at 37 &#176;C, and then inactivate the reaction at 70 &#176;C for 15 min.</li>
	<li>Store the cDNA at -20 &#176;C prior to use. 
	NOTE: To verify the quality of the synthesized cDNA, perform the amplification of a 761 bp fragment of the RABV N gene prior to performing the synthesis in vitro. Use the protocol described by Loza-Rubio et al.11 as described in step 5.5 below.</li>
	<li>Perform PCR using Taq DNA polymerase under the following conditions. Perform the reaction set up as follows: 10x Taq buffer containing 20 mM MgCl2, 0.2 mM dNTPs, 1 U Taq polymerase, 10 &#956;M of each primer (SuEli+: 5&#8242; cgtrgaycaatatgagtaca 3&#8242; and SuEli-: 5&#8242; caggctcraacattcttctta 3&#8242;), 2.5 &#956;L of cDNA, and ultrapure water to a final volume of 50 &#181;L.</li>
	<li>Perform the amplification in a thermocycler using the following cycling conditions: 95 &#176; C for 3 min; 35 cycles of 95 &#176; C for 30 s, 60 &#176;C for 30 s, and 72 &#176;C for 1 min; one cycle of 72 &#176;C for 7 min.</li>
	<li>Assess the presence of the 761 bp PCR products using a 1% agarose gel.</li>
</ol>
6. In vitro transcription
NOTE: In vitro transcription generates mRNA of a target gene. Use a primer pair that amplifies the complete RABV N gene and one that is used as a positive control for the qRT-PCR assay. These primers are designed to amplify the complete RABV N gene and to add a promoter that recognizes the T7 polymerase (TAATACGACTCACTATAG).
<ol>
	<li>To amplify the whole N gene RABV, use the primers Trans-Nrab forward (5&#697; gatgagtcactcgaatatgtctt 3&#697;) and reverse (5&#697; caataatacgactcactatagggatggatgccgacaagatt 3&#697;) and a high-fidelity PCR kit.
	<ol>
		<li>For each reaction, prepare a PCR master mix by adding to a clean PCR tube reaction buffer 10x, 2 mM DMSO, 25 mM MgCl2, 10 mM dNTPs, 10 &#956;M of each primer, 0.5 U of high-fidelity polymerase, 1.5 &#956;L of cDNA (prepared in step 5), and ultrapure water to a final volume of 50 &#181;L.</li>
		<li>Use a thermocycler set to the following conditions for amplification: 94 &#176;C for 1 min; 4 cycles of 94 &#176;C for 1 min, 40 &#176;C for 1 min, and 72 &#176;C for 2 min; 35 cycles of 94 &#176;C for 1 min, 60 &#176;C for 1 min, and 72 &#176;C for 2 min; final extension of 72 &#176;C for 2 min.</li>
	</ol>
	</li>
	<li>To use the PCR product as a template for the in vitro synthesis and to remove components of the enzymatic reaction from step 6.1.2, purify the PCR product using a column-based concentrator kit according to the manufacturer&#39;s instructions, and then quantify using a spectrophotometer.</li>
	<li>For RNA synthesis, use an in vitro transcription kit with the following reaction mixture: 5 &#956;L T7 Transcription 5x buffer, 1.9 &#956;L of each triphosphate nucleotide, 10 &#956;g of purified RABV N DNA VP2 DNA, and 2.5 &#956;L of the enzyme mixture. Next, incubate the mixture at 37 &#176;C for 4 h. Then, add 1 &#956;L of 1 U/&#956;g RNase-Free DNase to the reaction mixture and incubate for 15 min at 37 &#176;C to eliminate DNA contamination.</li>
	<li>Purify the in vitro transcribed RNA and then concentrate it using phenol:chloroform:isoamyl alcohol (25:24:1).</li>
	<li>Resuspend the purified RNA pellet into 70 &#956;L of TE buffer, and then store at -80 &#176;C until use.</li>
	<li>Repeat the PCR protocol from step 6.1 until approximately 5 &#956;g of PCR product is obtained. After purification and concentration, the in vitro transcribed N gene mRNA will be present at a concentration of 4.711 &#956;g/&#956;L.</li>
	<li>Confirm that the in vitro transcribed mRNA corresponds to the N gene following step 5 of this protocol and use this as a positive control for the real-time reverse transcription polymerase chain reaction (qRT-PCR).</li>
</ol>
7. Real-time reverse transcription polymerase chain reaction (qRT-PCR)
<ol>
	<li>For qRT-PCR, use an in vitro mRNA transcript encoding the complete N gene as a positive control along with a commercial one-step qRT-PCR kit using hybridization probes according to the manufacturer&#39;s instructions. Use the probe and primers described by Carneiro et al. (2010)23 to detect a conserved region of the RABV gene N (BRDesrot-Rev: 5&#8242; aaactcaagagaaggccaacca 3&#8242;, BRDesrot-Fwd: 5&#8242; cgtactgatgtggaagggaattg 3&#8242;, and BRDesrot-Probe: 5&#8242;-FAM-acaagggaccctactgtttcagagcatgc-3&#8242;-BHQ).</li>
	<li>Use the following thermal cycling conditions: 1 cycle of 50 &#176;C for 10 min and 95 &#176;C for 2 min; 40 cycles of 95 &#176;C for 15 s and 50 &#176;C for 30 s.</li>
</ol>
8. Calibration curve or standard curve
<ol>
	<li>Perform serial dilutions of the in vitro transcribed mRNA by serially pipetting 1 &#956;g/&#956;L of mRNA into tubes until six decuple dilutions are obtained. Prepare tubes at a 100 &#956;L volume in triplicate for use in creating the standard curve. Perform qRT-PCR as described in step 7.</li>
	<li>Perform qRT-PCR in a thermocycler with a rotor by processing the various brain samples simultaneously with the running reactions for creating the standard curve and using positive controls, negative controls, and supernatants isolated from cell culture.</li>
	<li>To evaluate the limit of detection, test efficacy, and sensitivity of the test, use a standard curve in triplicate under the same conditions.</li>
</ol>
9. qRT-PCR of biological samples
<ol>
	<li>For the detection of RABV gene N, use the RNA from field samples, positive controls, negative controls, and cell culture supernatants to perform qRT-PCR using the PCR kit described in step 7.</li>
	<li>To determine the number of copies of the RABV genome present in the bovine brain samples, obtain Ct data from the standard curve and biological samples and from those interpolated from the calibration curve equation.</li>
</ol>

<ol>
	<li>Subramaniam, M. R., Madhusudana, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+diagnosis+of+human+rabies:+recent+advances.">Laboratory diagnosis of human rabies: recent advances.</a> ScientificWorld Journal. 2013 (569712), 1-10 (2013).</li><li>. CDC Available from: <a target="_blank" href="https://www.cdc.gov/rabies/diagnosis/animals-humans.html">https://www.cdc.gov/rabies/diagnosis/animals-humans.html</a> (2019)</li><li>Dean, D. J., Abelseth, M. K., Atanasiu, W., Meslin, F. X., Kaplan, M. M., Koprowski, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fluorescent+antibody+technique+in+rabies.">The fluorescent antibody technique in rabies.</a> Laboratory techniques in rabies. , (1996).</li><li>Prabhu, K. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+and+comparative+evaluation+of+fluorescent+antibody,+immunohistochemistry,+and+reverse+transcription+polymerase+chain+reaction+tests+for+the+detection+of+rabies+virus+antigen+or+nucleic+acid+in+brain+samples+of+animals+suspected+of+rabies+in+India.">Application and comparative evaluation of fluorescent antibody, immunohistochemistry, and reverse transcription polymerase chain reaction tests for the detection of rabies virus antigen or nucleic acid in brain samples of animals suspected of rabies in India.</a> Veterinary Science. 5 (1), 24 (2018).</li><li>Woldehiwet, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+laboratory+advances+in+the+detection+of+rabies+virus.">Clinical laboratory advances in the detection of rabies virus.</a> Clinica Chimica Acta. 351 (1-2), 49-63 (2005).</li><li>Singh, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rabies+-+epidemiology,+pathogenesis,+public+health+concerns+and+advances+in+diagnosis+and+control:+a+comprehensive+review.">Rabies - epidemiology, pathogenesis, public health concerns and advances in diagnosis and control: a comprehensive review.</a> Veterinary Quarterly. 37 (1), 212-251 (2017).</li><li>David, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+the+RT-PCR+method+in+ante-mortem+&amp;+post-mortem+rabies+diagnosis.">Role of the RT-PCR method in ante-mortem &amp; post-mortem rabies diagnosis.</a> Indian Journal of Medical Research. 135 (6), 809-811 (2012).</li><li>Biswal, M., Ratho, R. K., Mishra, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+reverse+transcriptase+polymerase+chain+reaction+for+the+diagnosis+of+human+rabies.">Role of reverse transcriptase polymerase chain reaction for the diagnosis of human rabies.</a> Indian Journal of Medical Research. 135, 837-842 (2012).</li><li>Wacharapluesadee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+detection+of+rabies+RNA+by+NASBA,+real-time+PCR+and+conventional+PCR.">Comparative detection of rabies RNA by NASBA, real-time PCR and conventional PCR.</a> Journal of Virological Methods. 175 (2), 278-282 (2011).</li><li>Mani, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Utility+of+real-time+Taqman+PCR+for+ante+mortem+and+post-mortem+diagnosis+of+human+rabies.">Utility of real-time Taqman PCR for ante mortem and post-mortem diagnosis of human rabies.</a> Journal of Medical Virology. 86 (10), 1804-1812 (2014).</li><li>Loza-Rubio, E., Rojas-Anaya, E., Banda-Ruiz, V. M., Nadin-Davis, S. A., Cortez-Garcia, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+multiple+strains+of+rabies+virus+RNA+using+primers+designed+to+target+Mexican+vampire+bat+variants.">Detection of multiple strains of rabies virus RNA using primers designed to target Mexican vampire bat variants.</a> Epidemiology and Infection. 133 (5), 927-934 (2005).</li><li>Dedkov, V. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+evaluation+of+a+RT-qPCR+assay+for+fast+and+sensitive+rabies+diagnosis.">Development and evaluation of a RT-qPCR assay for fast and sensitive rabies diagnosis.</a> Diagnostic Microbiology and Infectious Disease. 90, 18-25 (2018).</li><li>Boldbaatar, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+rabies+virus+by+reverse+transcription+loop-mediated+isothermal+amplification.">Rapid detection of rabies virus by reverse transcription loop-mediated isothermal amplification.</a> Japanese Journal Infectious Diseases. 62, 187-191 (2009).</li><li>Rojas Anaya, E., Loza Rubio, E., Banda Ruiz, V., Hern&#225;ndez-Baumgarten, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+reverse+transcription-polymerase+chain+reaction+to+determine+the+stability+of+rabies+virus+genome+in+brains+kept+at+room+temperature.">Use of reverse transcription-polymerase chain reaction to determine the stability of rabies virus genome in brains kept at room temperature.</a> Journal of Veterinary Diagnostic Investigation. 18 (1), 98-101 (2006).</li><li>Dacheux, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+combined+Real-Time+reverse+transcription+polymerase+chain+reaction+assay+for+the+diagnosis+of+Lyssavirus+infection.">Dual combined Real-Time reverse transcription polymerase chain reaction assay for the diagnosis of Lyssavirus infection.</a> PLoS Neglected Tropical Diseases. 10 (7), 004812 (2016).</li><li>Tamay De Dios, L., Ibarra, C., Velasquillo, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fundamentos+de+la+reacci&#243;n+en+cadena+de+la+polimerasa+(PCR)+y+de+la+PCR+en+tiempo+real.">Fundamentos de la reacci&#243;n en cadena de la polimerasa (PCR) y de la PCR en tiempo real.</a> Investigigaci&#243;n en Discapacidad. 2 (2), 70-78 (2013).</li><li>Chapter 2.1.17. Rabies (infection with rabies virus and other Lyssaviruses. OIE Available from: <a target="_blank" href="https://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/2.01.17_RABIES.p">https://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/2.01.17_RABIES.p</a> (2018)</li><li>Wacharapluesadee, S., Hemchudha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ante-and+post-mortem+diagnosis+of+rabies+using+nucleic+acid-amplification+tests.">Ante-and post-mortem diagnosis of rabies using nucleic acid-amplification tests.</a> Expert Reviews of Molecular Diagnostics. 10 (2), 207-218 (2010).</li><li>Protocol for Postmortem Diagnosis of Rabies in Animals by Direct Fluorescent Antibody Testing. CDC Available from: <a target="_blank" href="https://www.cdc.gov/rabies/pdf/rabiesdfaspv2.pdf">https://www.cdc.gov/rabies/pdf/rabiesdfaspv2.pdf</a> (2017)</li><li>Dean, D. J., Abelseth, M. K., Atanasiu, W., Meslin, F. X., Kaplan, M. M., Koprowski, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fluorescent+antibody+technique+in+rabies.">The fluorescent antibody technique in rabies.</a> Laboratory techniques in rabies. , (1996).</li><li>Cuevas-Romero, S., Colmenares, V. G., Batalla, C. D., Hern&#225;ndez, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selecci&#243;n+de+un+virus+r&#225;bico+de+origen+vampiro+para+utilizarse+como+cepa+de+desaf&#237;o+en+bovino.">Selecci&#243;n de un virus r&#225;bico de origen vampiro para utilizarse como cepa de desaf&#237;o en bovino.</a> Veterinaria M&#233;xico. 20, 271-275 (1989).</li><li>Mendez-Ojeda, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+rabies+virus+in+organs+unrelated+to+the+central+nervous+system+of+experimentally+inoculated+vampire+bats.">Detection of rabies virus in organs unrelated to the central nervous system of experimentally inoculated vampire bats.</a> Revista M&#233;xicana de Ciencias Pecuarias. 9 (3), 435-450 (2018).</li><li>Carneiro, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rabies+virus+RNA+in+naturally+infected+vampire+bats,+Northeastern+Brazil.">Rabies virus RNA in naturally infected vampire bats, Northeastern Brazil.</a> Emerging Infectious Diseases. 16, 2004-2006 (2010).</li><li>Beltran, F. J., Dohmen, F. G., Del Pietro, H., Cisterna, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnosis+and+molecular+typing+of+rabies+virus+in+samples+stored+in+inadequate+conditions.">Diagnosis and molecular typing of rabies virus in samples stored in inadequate conditions.</a> The Journal of Infection in Developing Countries. 13 (8), 1016-1021 (2018).</li><li>Finke, S., Cox, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+transcription+attenuation+of+rabies+virus+genes+by+intergenic+regions:+generation+of+recombinant+viruses+overexpressing+the+polymerase+gene.">Differential transcription attenuation of rabies virus genes by intergenic regions: generation of recombinant viruses overexpressing the polymerase gene.</a> Journal of Virology. 74 (16), 7261-7269 (2000).</li><li>Fooks, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Rabies. 3, 1-18 (2017).</li><li>Bingham, J., Van Der, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+rabies+antigen+in+infected+brain+material:+determining+the+reliability+of+different+regions+of+the+brain+for+the+rabies+fluorescent+antibody+test.">Distribution of rabies antigen in infected brain material: determining the reliability of different regions of the brain for the rabies fluorescent antibody test.</a> Journal Virological Methods. 101 (1-2), 85-94 (2002).</li></ol>

The authors have no conflicts of interest to declare.

Previous studies have shown that DFA can only detect RABV within seven days of the sample being stored at room temperature (21 &#176;C)14. In contrast, this work demonstrated that the sensitivity of RT-PCR begins to decrease after the samples have been exposed to room temperature for 12 days. Therefore, the RABV genome can be detected by qRT-PCR in samples exposed to room temperature for up to 23 days. This demonstrates that the sensitivity of qRT-PCR is relatively higher for more highly decompose...

Rabies can be confirmed ante-mortem and post-mortem by various techniques that enable the detection of viral nucleic acids in the brain, skin, urine, or saliva1. Detection of the rabies virus nucleoprotein (N) gene is primarily used for rabies diagnosis by molecular tests. This gene is also used for viral genotyping. Rabies can be diagnosed in animals using any portion of the affected brain; however, to exclude the possibility of rabies, tissue from at least two regions in the brain must be tested2. Several diagnostic methods exist for rabies detection in animals; however, the direct immunofluorescence test remains the standard reference technique3. Other tests include biological tests that incorporate mouse inoculation, infection in tissue culture, and polymerase chain reaction (PCR)4. All these techniques are recommended by the World Health Organization (WHO) and World Organization of Animal Health (OIE) for the diagnosis of rabies in humans and animals, respectively5.
Nucleic acid detection and amplification techniques have revolutionized the diagnosis of rabies in recent years6 and these techniques play an important role in the ante mortem diagnosis of human rabies. Several PCR-based tests have been evaluated to complement conventional tests for ante-mortem and post-mortem rabies diagnoses7,8,9,10. Most assays target rabies viral nucleoprotein gene for amplification which is the most highly conserved region in the viral genome1,11. In the last 20 years, various molecular assays have been developed to diagnose RABV, and some of these assays have been used for virus characterization. Most trials have aimed to detect conserved genes within the viral genome, most commonly by using conventional or quantitative real-time polymerase chain reaction (qRT-PCR) assays12,13.
PCR is a highly sensitive diagnostic technique that can detect the genome of a given pathogen within tissues, even when these tissues are decomposed. Using PCR-based approaches, minimal quantities of an infectious agent can be detected in a clinical sample through the selective and repetitive amplification of a DNA nucleotide sequence14. qRT-PCR that incorporates fluorescent probes (e.g., TaqMan) or DNA binding dyes (e.g., SYBR Green) has been used in trials to diagnose RABV both ante- and post- mortem with high sensitivity; however, such an approach requires specialized equipment. To overcome this limitation, reverse transcription loop-mediated isothermal amplification (RT-LAMP) has been suggested, based on its low cost, simplicity, and desirable characteristics for the detection of RABV. This assay is particularly important as it can be used in developing countries15.
qRT-PCR is based on the detection and quantification of a molecule, where fluorescent signal increases are in direct proportion to the amount of PCR product in a single reaction. As the number of copies of the nucleic acid target increases, so does the fluorescence. Non-specific intercalating dyes such as the SYBR Green DNA-binding dye or sequence-specific oligonucleotide probes carrying a fluorophore and a quencher are commonly used to provide the fluorescent readout in qRT-PCR. This assay offers advantages over conventional RT-PCR that include a shorter test time (2&#8211;4 h), reduced risk of contamination due to the closed tube system (lack of post-PCR manipulation of amplified products), and the ability to detect different targets simultaneously16. qRT-PCR can be used to diagnose rabies ante-mortem from saliva and other samples. This assay can also be used as a universal real-time test for the detection of different Lyssavirus species or lineages of RABV15. In this combo RT-PCR approach, two reactions are used. The first detects different genetic linages of RABV, and the second detects the Lyssavirus species. Both steps involve qRT-PCR assays, where the first uses hybridization probes and the second uses dyes15. Owing to the large number of tests that have demonstrated successful molecular detection of RABV using this technique, the current OIE Terrestrial Manual (2018) recommends the use of PCR for the molecular detection of RABV17.
Mexico is a country with considerable livestock potential. The states with the highest livestock production contain both humid tropical regions and dry regions that are at risk for rabies outbreaks due to the presence of the vampire bat Desmodus rotundus, the main transmitter of rabies. Therefore, it is essential to develop more tools for the prevention and control of bovine paralytic rabies (BPR) in M&#233;xico. Based on this, the aim of this study was to use quantitative qRT-PCR to determine the number of viral particles in different anatomical structures of bovine brains following death due to rabies infection.
Six brains obtained from RABV-positive bovines were donated by an external laboratory for the use in the development of qRT-PCR protocol described below. The bovine brain structure samples were cold-chain transported to the INIFAP CENID-MA laboratory BSL-2 facility and stored at -80 &#176;C until use. Brains were obtained from animals from the states of Campeche, Yucat&#225;n, and Quer&#233;taro. Prior to the receipt, various structures were dissected from the brains. These structures included the Ammon&#8217;s horn, cerebellum, cortex, medulla, pons, and thalamus18,19. Genetic material was extracted as described below. RABV diagnosis was confirmed using direct fluorescent antibodies (DFA)20. As a positive control, mouse brains that were inoculated with RABV21 were used. Additionally, four RABV-negative cattle brains (as determined by DFA) were used as negative controls.

<table>
	<tbody>
		<tr>
			<td>Chloroform</td>
			<td>SIGMA</td>
			<td>C7559</td>
			<td>Facilitates recovery of the aqueous phase of PCRs which have been overlaid with mineral oil.</td>
		</tr>
		<tr>
			<td>DNA Clean &#38; Concentrator-500</td>
			<td>Zimo</td>
			<td>D4031</td>
			<td>The DNA Clean &#38; Concentrator-500 (DCC-500) is designed for the rapid, large format purification and concentration of up to 500 &#181;g of high quality DNA from samples including large-scale restriction endonuclease digestions and impure DNA preparations.</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Amresco</td>
			<td>193-500</td>
			<td>Purification of nucleic acids</td>
		</tr>
		<tr>
			<td>FastStart High Fidelity PCR System kit, dNTPack</td>
			<td>Roche</td>
			<td>3553400001</td>
			<td>High fidelity enzyme for the amplification of PCR products avoiding random base changes</td>
		</tr>
		<tr>
			<td>GelDoc XR</td>
			<td>BioRad</td>
			<td>XR+</td>
			<td>Analyzes larger protein and DNA gels</td>
		</tr>
		<tr>
			<td>GelRed</td>
			<td>Biotium</td>
			<td>41003</td>
			<td>A new generation of nucleic acid gel stains, they possess novel chemical features designed to minimize the chance for the dyes to interact with nucleic acids in living cells.</td>
		</tr>
		<tr>
			<td>iCycler Thermal Cycler Gradient</td>
			<td>BioRad</td>
			<td>582BR</td>
			<td>Temperature can be monitored and controlled by instrument algorithm, in-sample probe, or sample block modes</td>
		</tr>
		<tr>
			<td>iTaq Universal Probes One-Step Kit</td>
			<td>BioRad</td>
			<td>1725141</td>
			<td>Reaction mixture to carry out PCR reactions in real time using TaqMan type hybridization probes</td>
		</tr>
		<tr>
			<td>Isopropyl alcohol</td>
			<td>Amresco</td>
			<td>0918-500</td>
			<td>Precipitation of nucleic acids</td>
		</tr>
		<tr>
			<td>QIAquick gel extraction kit</td>
			<td>Qiagen</td>
			<td>28706</td>
			<td>QIAquick Kits contain a silica membrane assembly for binding of DNA in high-salt buffer and elution with low-salt buffer or water. The purification procedure removes primers, nucleotides, enzymes, mineral oil, salts, agarose, ethidium bromide, and other impurities from DNA samples</td>
		</tr>
		<tr>
			<td>M-MLV Reverse Transcriptase</td>
			<td>Invitrogen</td>
			<td>28025-021</td>
			<td>Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) uses singlestranded RNA or DNA in the presence of a primer to synthesize a complementary 
			DNA strand.</td>
		</tr>
		<tr>
			<td>NanoDrop 2000</td>
			<td>Thermo-Scientific</td>
			<td>ND2000</td>
			<td>Microvolume Spectrophotometer</td>
		</tr>
		<tr>
			<td>Oligo(dT)18 primer</td>
			<td>Invitrogen</td>
			<td>SO132</td>
			<td>The oligo (dT)18 primer is a synthetic single-stranded 18-mer oligonucleotide with 5&#39;- and 3&#39;-hydroxyl ends.</td>
		</tr>
		<tr>
			<td>RiboMAX Large Scale RNA Production Systems kit SP6 and T7</td>
			<td>Promega</td>
			<td>P1300</td>
			<td>In vitro transcription reactions are used to synthesize microgram amounts of RNA probes from recombinant DNA templates. Most transcription reactions designed to generate RNA probes are optimized to maximize incorporation of radiolabeled ribonucleotides rather than to produce large amounts of RNA</td>
		</tr>
		<tr>
			<td>Taq DNA Polymerase</td>
			<td>Invitrogen</td>
			<td>#EP0402</td>
			<td>Taq DNA Polymerase is a highly thermostable DNA polymerase of the thermophilic bacterium Thermus aquaticus. The enzyme catalyzes 5&#8217; and 3&#8217; synthesis of DNA 
			&#160;</td>
		</tr>
		<tr>
			<td>TRIzol reagent</td>
			<td>Invitrogen</td>
			<td>15596026</td>
			<td>The TRIzol reagent is a complete, ready-to-use reagent, designed for the isolation of high quality total RNA or the simultaneous isolation of RNA, DNA and proteins from a variety of biological samples.</td>
		</tr>
	</tbody>
</table>

quantitation of rabies virus in various bovine brain structures

Bovine paralytic rabies (BPR) is a form of viral encephalitis that is of substantial economic importance throughout Latin America, where it poses a major zoonotic risk. Here, our objective was to utilize a laboratory protocol to determine the relative copy number of the rabies virus (RABV) genome in different bovine brain anatomical structures using quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). qRT-PCR quantifies the specific number of gene copies present in a sample based on fluorescence emitted after amplification that is directly proportional to the amount of target nucleic acid present in the sample. This method is advantageous owing to its short duration, reduced risk of contamination, and potential to detect viral nucleic acids in different samples more easily compared to other techniques. The brains of six rabid animals were divided into six anatomical structures, namely the Ammon&#8217;s horn, cerebellum, cortex, medulla, pons, and thalamus. All brains were identified as positive for RABV antigens based on a direct immunofluorescence test. The same anatomical structures from the brains of four RABV-negative bovines were also assessed. RNA was extracted from each structure and used for qRT-PCR. An assay was performed to determine the copy numbers of RABV genes using an in vitro transcribed nucleoprotein gene. The standard curve used to quantify viral RNA exhibited an efficiency of 100% and linearity of 0.99. Analysis revealed that the cortex, medulla, and thalamus were the ideal CNS portions for use in RABV detection, based on the observation that these structures possessed the highest levels of RABV. The test specificity was 100%. All samples were positive, no false positives were detected. This method can be used to detect RABV in samples that contain low levels of RABV during diagnosis of BPR.

DFA results showed 100%, 100%, 83.3%, 66%, and 50% positivity for RABV in the cortex, thalamus, medulla, pons, and horn, respectively. These results confirmed the previous results, and at least three of the structures dissected from each brain were positive for RABV. A representative positive DAF staining is shown in Figure 1.
Figure 2 shows the amplification of a fragment of the RABV N gene (step 5.5) with the primers first ones repo...

Watch this Scientific Journal Video about Quantitation of Rabies Virus in Various Bovine Brain Structures at JoVE.com

Quantitation of Rabies Virus in Various Bovine Brain Structures

This protocol presents a qRT-PCR-based approach for determining the rabies virus nucleoprotein (N) gene copy number within various bovine brain anatomical structures using in vitro transcription.

Bovine paralytic rabies (BPR) is a form of viral encephalitis that is of substantial economic importance throughout Latin America, where it poses a major ...

quantitation-of-rabies-virus-in-various-bovine-brain-structures

Research

JoVE Journal

Immunology and Infection

3.4K Views.  Centro Nacional de Investigación Disciplinaria en Microbiología Animal (CENID-MA), INIFAP. This protocol presents a qRT-PCR-based approach for determining the rabies virus nucleoprotein (N) gene copy number within various bovine brain anatomical structures using in vitro transcription.

Video: Quantitation of Rabies Virus in Various Bovine Brain Structures

Visualizing Dengue Virus through Alexa Fluor Labeling

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that influence this interaction could lead to improved understanding of disease pathogenesis and thus influence vaccine or therapeutic design. Hence, the development 
of methods to probe this interaction would be useful. Recent advancements in fluorophores development1-3 and imaging technology4 can be exploited to 
improve our current knowledge on dengue pathogenesis and thus pave the way to reduce the millions of dengue infections occurring annually.

The enveloped dengue virus has an external scaffold consisting of 90 envelope glycoprotein (E) dimers protecting the nucleocapsid shell, 
which contains a single positive strand RNA genome5. The identical protein subunits on the virus surface can thus be labeled with an amine reactive dye and visualized 
through immunofluorescent microscopy. Here, we present a simple method of labeling of dengue virus with Alexa Fluor succinimidyl ester dye dissolved directly in a sodium 
bicarbonate buffer that yielded highly viable virus after labeling. There is no standardized procedure for the labeling of live virus and existing manufacturer&#x2019;s protocol 
for protein labeling usually requires the reconstitution of dye in dimethyl sulfoxide. The presence of dimethyl sulfoxide, even in minute quantities, can block 
productive infection of virus and also induce cell cytotoxicity6. The exclusion of the use of dimethyl sulfoxide in this protocol thus reduced this possibility. 
Alexa Fluor dyes have superior photostability and are less pH-sensitive than the common dyes, such as fluorescein and rhodamine2, making them ideal for 
studies on cellular uptake and endosomal transport of the virus. The conjugation of Alexa Fluor dye did not affect the recognition of labeled dengue 
virus by virus-specific antibody and its putative receptors in host cells7. This method could have useful applications in virological studies.

Taking advantage of the advancements in fluorophore development and imaging technology, a simple method of Alexa Fluor labeling of dengue virus was devised to visualize the early interactions between virus and cell.

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) resulting in cognitive and motor impairment. Experimental autoimmune encephalomyelitis (EAE) is a useful animal model of MS, because it is also characterized by lesion formation in the CNS, motor impairment and is also driven by autoimmune and inflammatory reactions. One of the EAE models is induced with a peptide derived from the myelin oligodendrocyte protein (MOG)35-55 in mice. The EAE mice develop a progressive disease course. This course is divided into three phases: the preclinical phase (day 0 - 9), the disease onset (day 10 - 11) and the acute phase (day 12 - 14). MS and EAE are induced by autoreactive T cells that infiltrate the CNS. These T cells secrete chemokines and cytokines which lead to the recruitment of further immune cells. Therefore, the immune cell distribution in the spinal cord during the three disease phases was investigated. To highlight the time point of the disease at which the activation/proliferation/accumulation of T cells, B cells and monocytes starts, the immune cell distribution in lymph nodes, spleen and blood was also assessed. Furthermore, the levels of several cytokines (IL-1&#946;, IL-6, IL-23, TNF&#945;, IFN&#947;) in the three disease phases were determined, to gain insight into the inflammatory processes of the disease. In conclusion, the data provide an overview of the functional profile of immune cells during EAE pathology.

This manuscript describes the methods for induction and scoring of the experimental autoimmune encephalomyelitis (EAE) model, together with the assessment of immune cell distribution and mRNA cytokine levels in lymph nodes, spleen, blood and spinal cord using flow cytometry and quantitative PCR, respectively, at various disease phases.

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Single-cell Quantitation of mRNA and Surface Protein Expression in Simian Immunodeficiency Virus-infected CD4+ T Cells Isolated from Rhesus macaques

Single-cell analysis is an important tool for dissecting heterogeneous populations of cells. The identification and isolation of rare cells can be difficult. To overcome this challenge, a methodology combining indexed flow cytometry and high-throughput multiplexed quantitative polymerase chain reaction (qPCR) was developed. The objective was to identify and characterize simian immunodeficiency virus (SIV)-infected cells present within rhesus macaques. Through quantitation of surface protein by fluorescence-activated cell sorting (FACS) and mRNA by qPCR, virus-infected cells are identified by viral gene expression, which is combined with host gene and protein measurements to create a multidimensional profile. We term the approach, targeted Single-Cell Proteo-transcriptional Evaluation, or tSCEPTRE. To perform the method, viable cells are stained with fluorescent antibodies specific for surface markers used for FACS isolation of a cell subset and/or downstream phenotypic analysis. Single cells are sorted followed by immediate lysis, multiplex reverse transcription (RT), PCR pre-amplification, and high throughput qPCR of up to 96 transcripts. FACS measurements are recorded at the time of sorting and subsequently linked to the gene expression data by well position to create a combined protein and transcriptional profile. To study SIV-infected cells directly ex vivo, cells were identified by qPCR detection of multiple viral RNA species. The combination of viral transcripts and the quantity of each provide a framework for classifying cells into distinct stages of the viral life cycle (e.g., productive versus non-productive). Moreover, tSCEPTRE of SIV+ cells were compared to uninfected cells isolated from the same specimen to assess differentially expressed host genes and proteins. The analysis revealed previously unappreciated viral RNA expression heterogeneity among infected cells as well as in vivo SIV-mediated post-transcriptional gene regulation with single-cell resolution. The tSCEPTRE method is relevant for the analysis of any cell population amenable to identification by expression of surface protein marker(s), host or pathogen gene(s), or combinations thereof.

Single-cell Quantitation of mRNA and Surface Protein Expression in Simian Immunodeficiency Virus-infected CD4+ T Cells Isolated from Rhesus macaques

Described is a methodology to quantitate the expression of 96 genes and 18 surface proteins by single cells ex vivo, allowing for the identification of differentially expressed genes and proteins in virus-infected cells relative to uninfected cells. We apply the approach to study SIV-infected CD4+ T cells isolated from rhesus macaques.

Single-cell analysis is an important tool for dissecting heterogeneous populations of cells. The identification and isolation of rare cells can be ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...

Identification of Coding and Non-coding RNA Classes Expressed in Swine Whole Blood

The advent of innovative and increasingly powerful next generation sequencing techniques has opened new avenues into the ability to examine the underlying gene expression related to biological processes of interest. These innovations not only allow researchers to observe expression from the mRNA sequences that code for genes that effect cellular function, but also the non-coding RNA (ncRNA) molecules that remain untranslated, but still have regulatory functions. Although researchers have the ability to observe both mRNA and ncRNA expression, it has been customary for a study to focus on one or the other. However, when studies are interested in both mRNA and ncRNA expression, many times they use separate samples to examine either coding or non-coding RNAs due to the difference in library preparations. This can lead to the need for more samples which can increase time, consumables, and animal stress. Additionally, it may cause researchers to decide to prepare samples for only one analysis, usually the mRNA, limiting the number of biological questions that can be investigated. However, ncRNAs span multiple classes with regulatory roles that effect mRNA expression. Because ncRNA are important to fundamental biologic processes and disorder of these processes in during infection, they may, therefore, make attractive targets for therapeutics. This manuscript demonstrates a modified protocol for the generation mRNA and non-coding RNA expression libraries, including viral RNA, from a single sample of whole blood. Optimization of this protocol, improved RNA purity, increased ligation for recovery of methylated RNAs, and omitted&#160;size selection, to allow capture of more RNA species.

Here, we present a protocol optimized for the processing of coding (mRNA) and non-coding&#160;(ncRNA) globin reduced RNA-seq libraries from a single whole blood sample.

The advent of innovative and increasingly powerful next generation sequencing techniques has opened new avenues into the ability to examine the underlying ...

In Vitro ELISA Test to Evaluate Rabies Vaccine Potency

The growing global concern for the animal welfare is encouraging manufacturers and the National Control Laboratories (OMCLs) to follow the 3Rs strategy for the Replacement, Reduction, and Refinement of the laboratory animal testing. The development of in vitro approaches is recommended at the WHO and European levels as alternatives to the NIH test for evaluating the rabies vaccine potency. At the surface of the rabies virus (RABV) particle, trimers of glycoprotein constitute the major immunogen to induce Viral Neutralizing Antibodies (VNAbs). An ELISA test, where Neutralizing Monoclonal Antibodies (mAb-D1) recognize the trimeric form of the glycoprotein, has been developed to determine the contents of the native folded trimeric glycoprotein along with the production of the vaccine batches. This in vitro potency test demonstrated a good concordance with the NIH test and has been found suitable in collaborative trials by RABV vaccine manufacturers and OMCLs. Avoidance of animal use is an achievable objective in the near future.
The method presented is based on an indirect ELISA sandwich immunocapture using the mAb-D1 which recognizes the antigenic sites III (aa 330 to 338) of the trimeric RABV glycoprotein, i.e., the immunogenic RABV antigen. mAb-D1 is used for both coating and detection of glycoprotein trimers present in the vaccine batch. Since the epitope is recognized because of its conformational properties, the potentially denatured glycoprotein (less immunogenic) cannot be captured and detected by the mAb-D1. The vaccine to be tested is incubated in a plate sensitized with the mAb-D1. Bound trimeric RABV glycoproteins are identified by adding the mAb-D1 again, labeled with peroxidase and then revealed in the presence of substrate and chromogen. Comparison of the absorbance measured for the tested vaccine and the reference vaccine allows for the determination of the immunogenic glycoprotein content.

Here we describe an indirect ELISA sandwich immunocapture to determine the immunogenic glycoprotein contents in rabies vaccines. This test uses a neutralizing Monoclonal Antibody (mAb-D1) recognizing glycoprotein trimers. It is an alternative to the in vivo NIH test to follow the consistency of vaccine potency during production.

The growing global concern for the animal welfare is encouraging manufacturers and the National Control Laboratories (OMCLs) to follow the 3Rs strategy ...

Growth, Purification, and Titration of Oncolytic Herpes Simplex Virus

Oncolytic viruses (OVs), such as&#160;the&#160;oncolytic herpes simplex virus (oHSV), are a rapidly growing treatment strategy in the field of cancer immunotherapy. OVs, including oHSV, selectively replicate in and kill cancer cells (sparing healthy/normal cells) while inducing anti-tumor immunity. Because of these unique properties, oHSV-based treatment strategies are being increasingly used for the treatment of cancer, preclinically and clinically, including FDA-approved talimogene laherparevec (T-Vec). Growth, purification, and titration are three essential laboratory techniques for any OVs, including oHSVs, before they can be utilized for experimental studies. This paper describes a simple step-by-step method to amplify oHSV in Vero cells. As oHSVs multiply, they produce a cytopathic effect (CPE) in Vero cells. Once 90-100% of the infected cells show a CPE, they are gently harvested, treated with benzonase and magnesium chloride (MgCl2), filtered, and subjected to purification using the sucrose-gradient method. Following purification, the number of infectious oHSV (designated as plaque-forming units or PFUs) is determined by a &#34;plaque assay&#34; in Vero cells. The protocol described herein can be used to prepare high-titer oHSV stock for in vitro studies in cell culture and in vivo animal experiments.

In this manuscript, we describe a simple method of growth, purification, and titration of the oncolytic herpes simplex virus for preclinical use.

Oncolytic viruses (OVs), such as&#160;the&#160;oncolytic herpes simplex virus (oHSV), are a rapidly growing treatment strategy in the field of cancer ...

Mesenchymal Stem Cell Regulation of Macrophage Phagocytosis; Quantitation and Imaging

Mesenchymal stem cells (MSC) have traditionally been studied for their regenerative properties, but more recently, their immunoregulatory characteristics have been at the forefront. They interact with and regulate immune cell activity. The focus of this study is the MSC regulation of macrophage phagocytic activity. Macrophage (M&#934;) phagocytosis is an important part of the innate immune system response to infection, and the mechanisms through which MSC modulate this response are under active investigation. Presented here is a method to study M&#934; phagocytosis of non-opsonized zymosan particles conjugated to a pH-sensitive fluorescent molecule while in co-culture with MSC. As phagocytic activity increases and the labeled zymosan particles are enclosed within the acidic environment of the phagolysosome, the fluorescence intensity of the pH-sensitive molecule increases. With the appropriate excitation and emission wavelengths, phagocytic activity is measured using a fluorescent spectrophotometer and kinetic data is presented as changes in relative fluorescent units over a 70 min period. To support this quantitative data, the change in the phagocytic activity is visualized using dynamic imaging. Results using this method demonstrate that when in co-culture, MSC enhance M&#934; phagocytosis of non-opsonized zymosan of both naive and IFN-&#947; treated M&#934;. These data add to the current knowledge of MSC regulation of the innate immune system. This method can be applied in future investigations to fully delineate the underlying cellular and molecular mechanisms.

Presented here is a protocol to quantify and produce dynamic images of mesenchymal stem cell (MSC) mediated regulation of macrophage (M&#934;) phagocytosis of non-opsonized yeast (zymosan) particles that are conjugated to a pH-sensitive fluorescent molecule.

Mesenchymal stem cells (MSC) have traditionally been studied for their regenerative properties, but more recently, their immunoregulatory characteristics ...