This work was supported by US National Institutes of Health (1K22CA23763201 to H.Z., GM118510 to D.M.C.) and Charles E. Kaufman foundation to H.Z. The authors would like to thank Jason Tones for proofreading the manuscript.

1. Production of transient cell lines
<ol>
	<li>Culture U2OS acceptor cells on 22 x 22 mm glass coverslips (for live imaging) or 12 mm diameter circular coverslips (for IF or FISH) coated with poly-D-lysine in 6-well plate with growth medium (10% fetal bovine serum and 1% Penicillin-Streptomycin solution in DMEM) until they reach 60-70% confluency.</li>
	<li>Replace growth medium with 1 mL transfection medium (growth medium without Penicillin-Streptomycin solution) prior to transfection.</li>
	<li>For each transfection well, add 4 &#956;L transfection reagent to 150 &#956;L reduced serum media, vortex for 10 seconds and then incubate for 5 mins.</li>
	<li>For each well, add Halo construct plasmid (Halo-GFP-TRF1 or Halo-TRF1) and eDHFR construct plasmid (mCherry-eDHFR-SIM or mCherry-eDHFR-SIM mutant) at a 1:1 mass ratio (0.5 &#956;g Halo construct plasmid with 0.5 &#956;g eDHFR construct plasmid) to 150 &#956;L reduced serum media, dropwise, mix by pipetting. 
	NOTE: The tags are relatively small (Halo 33 kD, eDHFR 28 kD, mCherry 30 kD, eGFP 27 kD) and no effect on phase separation was observed. However, using mutants such as SIM mutant used here to make sure that the phase behavior is sensitive to the mutations not the tags is advised. SIM is from &#65279;PIASx28,30. SIM sequence is AAAGTCGATGTAATTGACTTAACGATCGAATCTAGCAGCGATGAAGAAGAAGATCCACCGGCTAAACGT. SIM mutant is generated by mutating SIM amino acids VIDL to VADA28, and the sequence is AAAGTCGATGTAGCCGACGCCACGATCGAATCTAGCAGCGATGAAGAAGAAGATCCACCGGCTAAACGT. We deposited our plasmids to addgene: #164644 3XHalo-GFP-TRF1; #164646 mCherry-eDHFR-SIM; #164649 mCherry-eDHFR-SIM mutant.</li>
	<li>Add 150 &#956;L of transfection reagent -reduced serum media mixture to 150 &#956;L reduced serum media with DNA, dropwise, mix by pipetting, incubate for 5 mins.</li>
	<li>Add the 300 &#956;L of transfection reagent-DNA mixture to cells, dropwise and then place cells back to incubator.</li>
	<li>Wait 24-48 hours before live imaging, immunofluorescence (IF) or fluorescence in situ hybridization (FISH).</li>
</ol>
2. Dimerization on telomeres
<ol>
	<li>Dissolve dimerizers in dimethyl sulphoxide at 10&#8201;mM and store in plastic microcentrifuge tubes at &#8722;80&#8201;&#176;C for long term storage. 
	NOTE: Instead of using the dimerizer with TMP directly linked to Halo (TMP-Halo, TH), dimerizer TMP-NVOC-Halo (TNH) that has a photosensitive linker, 6-nitroveratryl oxycarbonyl (NVOC), between TMP and Haloligand is used31. This is because it takes less time for TNH (~5 mins) to diffuse into the cell than TH (~20 mins). Results shown here can also be obtained using TH. When using TNH, be careful not to expose the dimerizer to light to avoid NOVC cleavage. Handle TNH in a dark room with a dim red-light lamp, store the dimerizer in amber plastic tubes and wrap the container containing TNH or treated cells with aluminum foil. Imaging TNH with DIC is safe.</li>
	<li>Take an aliquot of 10 mM dimerizer from &#8722;80 &#176;C and dilute in imaging medium to a stock concentration of 10 &#956;M and store at &#8722;20&#8201;&#176;C.</li>
	<li>When ready to use, dilute dimerizers from 10 &#956;M stock solution to a final working concentration of 100&#8201;nM in growth medium (for fixed imaging) or imaging medium. Treat cells with 100 nM dimerizers (final concentration) on stage for live imaging or incubate for 4-5 hours for immunofluorescence (IF) and fluorescence in situ hybridization (FISH). 
	NOTE: The concentration of dimerizers used affects dimerization efficiency and thus phase separation. The dimerizer concentration allowing maximum dimerization efficiency depends on cell type and anchor protein concentration, so it will need to be determined for different experiments. One simple way is to incubate cells expressing the anchor protein and mCherry-eDHFR (without fusing to the phase separating protein or fused to a non-phase separating mutant) and identify the dimerizer concentration at which the highest mCherry intensity at the anchor is achieved. A more systematic approach is to incubate cells expressing the anchor only with different concentrations of dimerizers and then with a Halo binding dye to help determine the dimerizer concentration at which the Halo binding dye intensity starts to plateau (i.e., all Halo-fused anchors are occupied by the dimerizer and no more left for the Halo binding dye)32.</li>
	<li>To reverse dimerization, incubate cells with dimerizers for 2-5 hours (with or without live imaging) or until desired droplet size is achieved and add 100 &#956;M free TMP (final concentration) diluted in imaging medium to cells.</li>
</ol>
3. Immunofluorescence (IF) 
<ol>
	<li>Seed 105 cells on 12 mm diameter circular cover glasses coated with poly-D-lysine in 6-well plate. Then transfect the two plasmids (Halo-GFP-TRF1 with mCherry-eDHFR-SIM or mCherry-eDHFR-SIM mutant) and wait for 24-48 hours before proceeding to immunofluorescence. 
	NOTE: Wait more than one day after transfection can obtain higher expression. &#160;</li>
	<li>Dilute dimerizers with growth medium to reach a final concentration of 100 nM, add diluted dimerizers to cells and incubate at 37&#8201;&#176;C for 4-5 hours. 
	NOTE: Phase separation is quickly induced after adding dimerizers (&#60; 30 mins). Longer incubation helps droplets coarsen into larger sizes. Following droplet growth with live imaging can be used to determine the time it takes for droplets to reach a desired state.</li>
	<li>Fix cells in PBS solution containing 4% formaldehyde and 0.1% Triton X-100 for 10 mins at room temperature to permeabilize cells. Wash cells 3 times with PBS. 
	NOTE: After this step, it can be paused and cells can be stored at 4&#8201;&#176;C for up to a week. 
	Caution: Formaldehyde is harmful by inhalation and if swallowed, it also irritates eyes, respiratory system and skin and is a possible cancer hazard. Need to wear personal protective equipment, use only in a chemical fume hood. Also put it in a waste container after use, do not dispose it in the sink.</li>
	<li>Wash coverslips two times with 50 &#956;L TBS-Tx and once with 50 &#956;L Antibody Dilution Buffer (AbDil). TBS-Tx was made by TBS, 0.1% Triton X-100 and 0.05% Na-azide. AbDil was made by TBS-Tx, 2% BSA and 0.05% Na-azide.</li>
	<li>Incubate each coverslip with 50 &#956;L primary anti-PML (1:50 dilution in AbDil) / anti-SUMO1 (1:200 dilution in AbDil) / anti-SUMO2/3 antibody (1:200 dilution in AbDil) at 4 &#176;C in a humidified chamber overnight. mCherry antibody can also be used (1:200 dilution in AbDil) to help detect mCherry signal for FISH. 
	NOTE: FISH quenches the mCherry fluorescent signal, which makes it difficult to differentiate cells transfected with mCherry plasmids from those not transfected in FISH experiments. Using mCherry antibody is advised. Alternatively, one can make a stable cell line expressing eDHFR containing protein.</li>
	<li>Wash coverslips 3 times with AbDil to remove unbound primary antibody.</li>
	<li>Incubate cells with secondary antibody [anti-mouse IgG (H+L) secondary antibody conjugated with Alexa Fluor 647 for PML and SUMO, anti-rabbit IgG (H+L) secondary antibody conjugated with Alexa Fluor 555 for mCherry, both at 1:1000 dilution in AbDil] for 1 hour in dark box at room temperature.</li>
	<li>Wash coverslips 3 times with TBS-Tx.</li>
	<li>Label slides, dilute DAPI in mounting media to reach DAPI final concentration of 1 &#956;g/mL. Then put 2 &#956;L diluted DAPI on the slide. Flip the coverslips over and place them onto DAPI drop, aspire extra fluid from the edge of the coverslip.</li>
	<li>Seal with nail polish, let it dry and rinse from top of the coverslip with water. Save in freezer for imaging.</li>
</ol>
4. Fluorescence in situ hybridization (FISH)
<ol>
	<li>Seed 105 cells on 12 mm diameter circular cover glasses coated with poly-D-lysine in 6-well plate. Transfect&#160;cells with Halo-TRF1 and mCherry-eDHFR-SIM or mCherry-eDHFR-SIM mutant plasmids and wait for 24-48 h before proceeding to FISH. The dimerization step is the same as described in 3.2. 
	NOTE: Here TRF1 is not fused with GFP so the green channel is freed up for telomere DNA probe.</li>
	<li>Fix cells with 4% formaldehyde for 10 mins at room temperature and wash 4 times with PBS. For IF-FISH, proceed to IF protocol from here and after washing off secondary antibody in IF (3.8), refix cells with 4% formaldehyde for 10 mins at room temperature and wash three times with PBS.</li>
	<li>Dehydrate coverslips in an ethanol series (70%, 80%, 90%, 2 mins each).</li>
	<li>Incubate coverslips with 488-telC PNA probe (1:2000 ratio) in 5 &#956;L hybridization solution at 75 &#176;C for 5 mins. Hybridization solution contains 70% deionized formamide, 10 mM Tris (pH 7.4), 0.5% blocking reagent. Then incubate overnight in a humidified chamber at room temperature.</li>
	<li>Wash coverslips with wash buffer (70% formamide, 10 mM Tris) 2 mins for 3 times at room temperature and mount with 1 &#956;g/mL DAPI in mounting media for imaging. 
	NOTE: The FISH protocol is a published protocol33&#8217;34.</li>
</ol>
5. Live imaging
<ol>
	<li>When cells are ready for imaging, mount coverslips in magnetic chambers with cells maintained in 1 mL imaging medium without phenol red on a heated stage in an environmental chamber.</li>
	<li>Set up microscope and environmental control apparatus. Images were acquired with a spinning disk confocal microscope with a 100x 1.4 NA objective, a Piezo Z-Drive, an electron multiplying charge-coupled device&#160;(EMCCD) camera, and a laser merge module equipped with 455, 488, 561, 594 and 647 nm lasers controlled by imaging software. Output powers for all lasers are 20 mW measured at the fiber end.</li>
	<li>Locate cells with bright GFP signal on telomeres and diffusively localized mCherry signal in the nucleoplasm. Find around 20 cells, memorize each position with x, y, z information and set up parameters for time lapse imaging with 0.5 &#956;m spacing for a total of 8 &#956;m in Z and 5-minute time interval for 2-4 hours for both GFP and mCherry channels. Use 30% of 594 nm and 50% of 488 nm power intensity, with exposure times of 200 ms and camera gain 300. 
	NOTE: The output power of laser units is 20 mW. Bright GFP foci indicate larger anchor size which can nucleate condensates more easily. Find cells with a wide range of mCherry signal because phase separation depends on SIM concentration in the cell. Cells with too dim or too bright mCherry signal may not phase separate. To avoid photobleaching, do not use too much laser power or too long exposure time.</li>
	<li>Start imaging and take one-time loop as pre-dimerization. Pause imaging, add 0.5 mL imaging media containing 15 &#956;L of 10 &#956;M dimerizer to the imaging chamber on the stage so that the final dimerizer concentration is 100 nM. Resume imaging.</li>
	<li>When ready to reverse dimerization, pause imaging, add 0.5 mL imaging media containing 2 &#956;L of 100 mM stock TMP to the imaging chamber on the stage to get 100 &#956;M TMP final concentration. Continue imaging cells for 1-2 hours.</li>
</ol>
6. Fixed imaging
<ol>
	<li>Same microscope set up as live imaging, stage heating is not needed. Use 488 nm to image telomere FISH, 561 nm for mCherry IF, and 647 nm for PML or SUMO IF. 
	NOTE: If not using a mCherry antibody, just directly image mCherry protein but signal maybe dim because of quenching in FISH.&#160; Still use 561 nm rather than 594 nm laser to image mCherry to avoid signal bleed-through of Cy5 to mCherry.</li>
	<li>Locate around 30-50 cells with red signal (mCherry or mCherry IF) to select for transfected cells.</li>
	<li>Images were taken with 0.3 &#181;m spacing for a total of 8 &#181;m in Z for collecting more signals. Use 80% of 647 nm, 80% of 561 nm, and 70% of 488 nm power intensity, with exposure times of 600 ms and camera gain 300.</li>
</ol>
7. Process time-lapse images
<ol>
	<li>Define binary for telomeres 
	Choose one cell with all time and z-stack information, choose only the GFP channel and create a binary layer by defining threshold. Adjust the lower and upper values of the threshold and use functions such as &#8220;Smooth&#8221;, &#8220;Clean&#8221; and &#8220;Fill holes&#8221; to see how well the threshold picks up the desired objects through all time points.</li>
	<li>Subtract background 
	Choose all channels, draw rectangle Region of Interest (ROI) on the background (aside from the cell). Define this ROI as background and then subtract background intensity.</li>
	<li>Link telomere binary to telomere intensity 
	Choose telomere binary and link it to GFP channel for calculating GFP intensity in the binary objects as telomere intensity.</li>
	<li>Calculate telomere number and intensity over time 
	Specify which information to be exported, such as time, object ID, mean intensity, sum intensity, and export data. Use figure plotting software to read the exported table and generate figures of telomere number and telomere intensity (summarize intensity over the volume in each telomere and then average over all telomeres in a cell) over time.</li>
</ol>
8. Process fixed-cell images
<ol>
	<li>Define binary for APBs 
	Choose transfected cells for analysis by looking for signal in 561nm channel. Following the procedure in 7.1, define threshold in both GFP (telomere DNA FISH) and Cy5 (PML or SUMO IF) channel to generate binary for telomeres and PML bodies or SUMO, respectively. Merge GFP and Cy5 binary layers and create a new layer containing particles that both have GFP and Cy5 signal to represent co-localization of PML body on telomeres, thus APBs.</li>
	<li>Calculate APB/SUMO number and intensity 
	Subtract image background following 7.2. Link APB/SUMO binary layer to Cy5 channel following 7.3. Calculate APB/SUMO number and intensity. Export and plot data following 7.4.</li>
</ol>

<ol>
	<li>Shin, Y., Brangwynne, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liquid+phase+condensation+in+cell+physiology+and+disease.">Liquid phase condensation in cell physiology and disease.</a> Science. 357 (6357), (2017).</li><li>Banani, S. F., Lee, H. O., Hyman, A. A., Rosen, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomolecular+condensates:+organizers+of+cellular+biochemistry.">Biomolecular condensates: organizers of cellular biochemistry.</a> Nature Reviews Molecular Cell Biology. 18 (5), 285-298 (2017).</li><li>Sabari, B. R., Dall'Agnese, A., Young, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomolecular+condensates+in+the+nucleus.">Biomolecular condensates in the nucleus.</a> Trends in Biochemical Sciences. , 1-17 (2020).</li><li>Strom, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phase+separation+drives+heterochromatin+domain+formation.">Phase separation drives heterochromatin domain formation.</a> Nature. 547 (7662), 241-245 (2017).</li><li>Larson, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liquid+droplet+formation+by+HP1&#945;+suggests+a+role+for+phase+separation+in+heterochromatin.">Liquid droplet formation by HP1&#945; suggests a role for phase separation in heterochromatin.</a> Nature. 547 (7662), 236-240 (2017).</li><li>Boija, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+factors+activate+genes+through+the+phase-separation+capacity+of+their+activation+domains.">Transcription factors activate genes through the phase-separation capacity of their activation domains.</a> Cell. 175 (7), 1842-1855 (2018).</li><li>Hur, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CDK-Regulated+phase+separation+seeded+by+histone+genes+ensures+precise+growth+and+function+of+histone+locus+bodies.">CDK-Regulated phase separation seeded by histone genes ensures precise growth and function of histone locus bodies.</a> Developmental Cell. 54 (3), 379-394 (2020).</li><li>McSwiggen, D. T., Mir, M., Darzacq, X., Tjian, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluating+phase+separation+in+live+cells:+diagnosis,+caveats,+and+functional+consequences.">Evaluating phase separation in live cells: diagnosis, caveats, and functional consequences.</a> Genes &amp; Development. 33 (23-24), 1619-1634 (2019).</li><li>Peng, A., Weber, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+and+against+liquid-liquid+phase+separation+in+the+nucleus.">Evidence for and against liquid-liquid phase separation in the nucleus.</a> Non-coding RNA. 5 (4), (2019).</li><li>Erdel, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+heterochromatin+adopts+digital+compaction+states+without+showing+hallmarks+of+HP1-driven+liquid-liquid+phase+separation.">Mouse heterochromatin adopts digital compaction states without showing hallmarks of HP1-driven liquid-liquid phase separation.</a> Molecular Cell. 78 (2), 236-249 (2020).</li><li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+body+phase+separation+drives+telomere+clustering+in+ALT+cancer+cells.">Nuclear body phase separation drives telomere clustering in ALT cancer cells.</a> Molecular Biology of the Cell. 31 (18), 2048-2056 (2020).</li><li>Ballister, E. R., Aonbangkhen, C., Mayo, A. M., Lampson, M. A., Chenoweth, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localized+light-induced+protein+dimerization+in+living+cells+using+a+photocaged+dimerizer.">Localized light-induced protein dimerization in living cells using a photocaged dimerizer.</a> Nature Communications. 5, 1-9 (2014).</li><li>Yeager, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Telomerase-negative+immortalized+human+cells+contain+a+novel+type+of+promyelocytic+leukemia+(PML)+body.">Telomerase-negative immortalized human cells contain a novel type of promyelocytic leukemia (PML) body.</a> Cancer Research. 59 (17), 4175-4179 (1999).</li><li>Zhang, J. M., Zou, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+lengthening+of+telomeres:+From+molecular+mechanisms+to+therapeutic+outlooks.">Alternative lengthening of telomeres: From molecular mechanisms to therapeutic outlooks.</a> Cell and Bioscience. 10 (1), 1-9 (2020).</li><li>Corpet, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PML+nuclear+bodies+and+chromatin+dynamics:+catch+me+if+you+can.">PML nuclear bodies and chromatin dynamics: catch me if you can.</a> Nucleic Acids Research. , 1-23 (2020).</li><li>Li, Y., Ma, X., Wu, W., Chen, Z., Meng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PML+nuclear+body+biogenesis,+carcinogenesis,+and+targeted+therapy.">PML nuclear body biogenesis, carcinogenesis, and targeted therapy.</a> Trends in Cancer. 6 (10), 889-906 (2020).</li><li>Dilley, R. L., Greenberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ALTernative+telomere+maintenance+and+cancer.">ALTernative telomere maintenance and cancer.</a> Trends in Cancer. 1 (2), 145-156 (2015).</li><li>Sobinoff, A. P., Pickett, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+lengthening+of+telomeres:+DNA+repair+pathways+converge.">Alternative lengthening of telomeres: DNA repair pathways converge.</a> Trends in Genetics. 33 (12), 921-932 (2017).</li><li>Draskovic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+PML+body+function+in+ALT+cells+reveals+spatiotemporal+requirements+for+telomere+recombination.">Probing PML body function in ALT cells reveals spatiotemporal requirements for telomere recombination.</a> Proceedings of the National Academy of Sciences. 106 (37), 15726 (2009).</li><li>Zhang, J. M., Yadav, T., Ouyang, J., Lan, L., Zou, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+lengthening+of+telomeres+through+two+distinct+break-induced+replication+pathways.">Alternative lengthening of telomeres through two distinct break-induced replication pathways.</a> Cell Reports. 26 (4), 955-968 (2019).</li><li>Loe, T. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Telomere+length+heterogeneity+in+ALT+cells+is+maintained+by+PML-dependent+localization+of+the+BTR+complex+to+telomeres.">Telomere length heterogeneity in ALT cells is maintained by PML-dependent localization of the BTR complex to telomeres.</a> Genes and Development. 34 (9-10), 650-662 (2020).</li><li>Potts, P. R., Yu, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SMC5/6+complex+maintains+telomere+length+in+ALT+cancer+cells+through+SUMOylation+of+telomere-binding+proteins.">The SMC5/6 complex maintains telomere length in ALT cancer cells through SUMOylation of telomere-binding proteins.</a> Nature Structural and Molecular Biology. 14 (7), 581-590 (2007).</li><li>Chung, I., Leonhardt, H., Rippe, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+assembly+of+a+PML+nuclear+subcompartment+occurs+through+multiple+pathways+and+induces+telomere+elongation.">De novo assembly of a PML nuclear subcompartment occurs through multiple pathways and induces telomere elongation.</a> Journal of Cell Science. 124 (21), 3603-3618 (2011).</li><li>Shen, T. H., Lin, H. K., Scaglioni, P. P., Yung, T. M., Pandolfi, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanisms+of+PML-nuclear+body+formation.">The mechanisms of PML-nuclear body formation.</a> Molecular Cell. 24 (3), 331-339 (2006).</li><li>Shima, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+SUMO+modification+system+is+required+for+the+accumulation+of+RAD51+at+sites+of+DNA+damage.">Activation of the SUMO modification system is required for the accumulation of RAD51 at sites of DNA damage.</a> Journal of Cell Science. 126 (22), 5284-5292 (2013).</li><li>Yal&#231;in, Z., Selenz, C., Jacobs, J. J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitination+and+SUMOylation+in+telomere+maintenance+and+dysfunction.">Ubiquitination and SUMOylation in telomere maintenance and dysfunction.</a> Frontiers in Genetics. 8, 1-15 (2017).</li><li>Sarangi, P., Zhao, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SUMO-mediated+regulation+of+DNA+damage+repair+and+responses.">SUMO-mediated regulation of DNA damage repair and responses.</a> Trends in Biochemical Sciences. 40 (4), 233-242 (2015).</li><li>Banani, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Compositional+control+of+phase-separated+cellular+bodies.">Compositional control of phase-separated cellular bodies.</a> Cell. 166 (3), 651-663 (2016).</li><li>Min, J., Wright, W. E., Shay, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clustered+telomeres+in+phase-separated+nuclear+condensates+engage+mitotic+DNA+synthesis+through+BLM+and+RAD52.">Clustered telomeres in phase-separated nuclear condensates engage mitotic DNA synthesis through BLM and RAD52.</a> Genes and Development. 33 (13-14), 814-827 (2019).</li><li>Song, J., Durrin, L. K., Wilkinson, T. A., Krontiris, T. G., Chen, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+SUMO-binding+motif+that+recognizes+SUMO-modified+proteins.">Identification of a SUMO-binding motif that recognizes SUMO-modified proteins.</a> Proceedings of the National Academy of Sciences of the United States of America. 101 (40), 14373-14378 (2004).</li><li>Zhang, H., Chenoweth, D. M., Lampson, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+7+-+Optogenetic+control+of+mitosis+with+photocaged+chemical+dimerizers.">Chapter 7 - Optogenetic control of mitosis with photocaged chemical dimerizers.</a> Mitosis and Meiosis Part A. 144, 157-164 (2018).</li><li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optogenetic+control+of+kinetochore+function.">Optogenetic control of kinetochore function.</a> Nature Chemical Biology. 13 (10), 1096-1101 (2017).</li><li>Cho, N. W., Dilley, R. L., Lampson, M. A., Greenberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interchromosomal+homology+searches+drive+directional+ALT+telomere+movement+and+synapsis.">Interchromosomal homology searches drive directional ALT telomere movement and synapsis.</a> Cell. 159 (1), 108-121 (2014).</li><li>Dilley, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Break-induced+telomere+synthesis+underlies+alternative+telomere+maintenance.">Break-induced telomere synthesis underlies alternative telomere maintenance.</a> Nature. 539 (7627), 54-58 (2016).</li><li>Aonbangkhen, C., Zhang, H., Wu, D. Z., Lampson, M. A., Chenoweth, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reversible+control+of+protein+localization+in+living+cells+using+a+photocaged-photocleavable+chemical+dimerizer.">Reversible control of protein localization in living cells using a photocaged-photocleavable chemical dimerizer.</a> Journal of the American Chemical Society. 140 (38), 11926-11930 (2018).</li><li>Shin, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatiotemporal+control+of+intracellular+phase+transitions+using+light-activated+optoDroplets.">Spatiotemporal control of intracellular phase transitions using light-activated optoDroplets.</a> Cell. 168 (1-2), 159-171 (2017).</li><li>Shin, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liquid+nuclear+condensates+mechanically+sense+and+restructure+the+genome.">Liquid nuclear condensates mechanically sense and restructure the genome.</a> Cell. 175 (6), 1481-1491 (2018).</li><li>Xiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-mediated+gene+tagging:+a+step-by-step+protocol.">CRISPR/Cas9-mediated gene tagging: a step-by-step protocol.</a> Methods in Molecular Biology. 1961, 255-269 (2019).</li></ol>

The authors have nothing to disclose.

This protocol demonstrated the formation and dissolution of condensates on telomeres with a chemical dimerization system. Kinetics of phase separation and droplet-fusion-induced telomere clustering are monitored with live imaging. Condensate localization and composition are determined with DNA FISH and protein IF.&#160;
There are two critical steps in this protocol. The first is to determine protein and dimerizer concentration. The success in inducing local phase separation at a genomic locus ...

Many proteins and nucleic acids undergo liquid-liquid phase separation (LLPS) and self-assemble into biomolecular condensates to organize biochemistry in cells1,2. LLPS of chromatin-binding proteins leads to the formation of condensates that are associated with specific genomic loci and are implicated in various local chromatin functions3. For example, LLPS of HP1 protein underlies the formation of heterochromatin domains to organize the genome4,5, LLPS of transcription factors forms transcription centers to regulate transcription6, &#65279; LLPS of nascent mRNAs and multi-sex combs protein generates histone locus bodies to regulate the transcription and processing of histone mRNAs7. &#160;However, despite many examples of chromatin-associated condensates being discovered, the underlying mechanisms of condensate formation, regulation and function remain poorly understood. In particular, not all chromatin-associated condensates are formed through LLPS and careful evaluations of condensate formation in live cells are still needed8,9. For example, &#65279; HP1 protein in mouse is shown to have only a weak capacity to form liquid droplets in live cells and &#65279;heterochromatin foci behave as collapsed polymer globules10. Therefore, tools to induce de novo condensates on chromatin in living cells are desirable, particularly those that allow the use of live imaging and biochemical assays to monitor the kinetics of condensate formation, the physical and chemical properties of the resulting condensates, and the cellular consequences of condensate formation.
This protocol reports a chemical dimerization system to induce protein condensates on chromatin11 (Figure 1A). The dimerizer consists of two linked protein-interacting ligands: trimethoprim (TMP) and Halo ligand and can dimerize proteins fused to the cognate receptors: Escherichia coli dihydrofolate reductase (eDHFR) and a bacterial alkyldehalogenase enzyme (Halo enzyme), respectively12. The interaction between Halo ligand and Halo enzyme is covalent, allowing &#160;Halo enzyme to be used as an anchor by fusing it to a chromatin-binding protein to recruit a phase-separating protein fused to eDHFR to chromatin. After the initial recruitment, increased local concentration of the phase separating protein passes the critical concentration needed for phase separation and thus nucleates a condensate at the anchor (Figure 1B). By fusing fluorescent proteins (e.g. mCherry and eGFP) to eDHFR and Halo, nucleation and growth of condensates can be visualized in real time with fluorescence microscopy. Because the interaction between eDHFR and TMP is non-covalent, excess free TMP can be added to compete with the dimerizer for eDHFR binding. This will then release the phase separation protein from the anchor and dissolve the chromatin-associated condensate.
We used this tool to induce de novo promyelocytic leukemia (PML) nuclear body formation on telomeres in telomerase-negative cancer cells that use an alternative lengthening of telomeres&#160;(ALT) pathway for telomere maintenance13,14. &#160;PML nuclear bodies are membrane-less compartments involved in many nuclear processes15,16 and are uniquely localized to ALT telomeres to form APBs, for ALT telomere-associated PML bodies17,18. Telomeres cluster within APBs, presumably to provide repair templates for homology-directed telomere DNA synthesis in ALT19. Indeed, telomere DNA synthesis has been detected in APBs and APBs play essential roles in enriching DNA repair factors on telomeres20,21. However, the mechanisms underlying APB assembly and telomere clustering within APBs were unknown. Since telomere proteins in ALT cells are uniquely modified by small ubiquitin-like modifier (SUMOs)22, many APB components contain sumoylation sites 22,23,24,25 and/or SUMO-interacting motifs (SIMs)26,27 and SUMO-SIM interactions drive phase separation28, we hypothesized that sumoylation on telomeres leads to enrichment of SUMO/SIM containing proteins and SUMO-SIM interactions between those proteins lead to phase separation. &#160;PML protein, which has three sumoylation sites and one SIM site, can be recruited to sumoylated telomeres to form APBs and coalescence of liquid APBs leads to telomeres clustering. To test this hypothesis, we used the chemical dimerization system to mimic sumoylation-induced APB formation by recruiting SIM to telomeres (Figure 2A)11. GFP is fused to Haloenzyme for visualization and to the telomere-binding protein TRF1 to anchor the dimerizer to telomeres. SIM is fused to eDHFR and mCherry. Kinetics of condensate formation and droplet fusion-induced telomere clustering are followed with live cell imaging. &#160;Phase separation is reversed by adding excess free TMP to compete with eDHFR binding. Immunofluorescence (IF) and fluorescence in situ hybridization (FISH) are used to determine condensate composition and telomeric association. Recruiting SIM enriches SUMO on telomeres and the induced condensates contain PML and therefore are APBs. Recruiting a SIM mutant that cannot interact with SUMO does not enrich SUMO on telomeres or induce phase separation, indicating that the fundamental driving force for APB condensation is SUMO-SIM interaction. Agreeing with this observation, polySUMO-polySIM polymers that fused to a TRF2 binding factor RAP1 can also induce APB formation29. Compared to the polySUMO-polySIM fusion system where phase separation occurs as long as enough proteins are produced, the chemical dimerization approach presented here induces phase separation on demand and thus offers better temporal resolution to monitor the kinetics of phase separation and telomere clustering process. In addition, this chemical dimerization system permits the recruitment of other proteins to assess their ability in inducing phase separation and telomere clustering. For example, a disordered protein recruited to telomeres can also form droplets and cluster telomeres without inducing APB formation, suggesting telomere clustering is independent of APB chemistry and only relies on APB liquid property11.&#160;

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >0.25% Trypsin, 0.1% EDTA in HBSS w/o Calcium, Magnesium and Sodium Bicarbonate</td>
			<td >Corning</td>
			<td >MT25053CI</td>
			<td ></td>
		</tr>
		<tr >
			<td >16% Formaldehyde (w/v), Methanol-free</td>
			<td >Thermo Scientific</td>
			<td >28906</td>
			<td >Prepare 1% in 1x PBS</td>
		</tr>
		<tr >
			<td >6 Well Culture Plate</td>
			<td >VWR</td>
			<td >10861-554</td>
			<td ></td>
		</tr>
		<tr >
			<td >Aluminum Foil</td>
			<td >Fisher Scientific</td>
			<td >01-213-101</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-mCherry antibody</td>
			<td >Abcam</td>
			<td >Ab183628</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-PML antibody</td>
			<td >Santa Cruz</td>
			<td >sc966</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SUMO1 antibody</td>
			<td >Abcam</td>
			<td >Ab32058</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SUMO2/3 antibody</td>
			<td >Cytoskeleton</td>
			<td >Asm23</td>
			<td ></td>
		</tr>
		<tr >
			<td >Blocking Reagent</td>
			<td >Roche</td>
			<td >11096176001</td>
			<td ></td>
		</tr>
		<tr >
			<td >Bovine Serum Albumin (BSA)</td>
			<td >Fisher Scientific</td>
			<td >BP9706100</td>
			<td ></td>
		</tr>
		<tr >
			<td >BTX Tube micro 1.5ML&#160;</td>
			<td >VWR</td>
			<td >89511-258</td>
			<td ></td>
		</tr>
		<tr >
			<td >Circle Cover Slips</td>
			<td >Thermo Scientific</td>
			<td >3350</td>
			<td ></td>
		</tr>
		<tr >
			<td >Confocal microscope&#160;</td>
			<td >Nikon</td>
			<td >MQS31000</td>
			<td ></td>
		</tr>
		<tr >
			<td >DAPI</td>
			<td >Fisher Scientific</td>
			<td >D1306</td>
			<td></td>
		</tr>
		<tr >
			<td >Dimethyl Sulphoxide&#160;</td>
			<td >Sigma-Aldrich</td>
			<td >472301</td>
			<td ></td>
		</tr>
		<tr >
			<td >DMEM with L-Glutamine, 4.5g/L Glucose and Sodium Pyruvate</td>
			<td >Corning</td>
			<td >MT10017CV</td>
			<td ></td>
		</tr>
		<tr >
			<td >EMCCD Camera</td>
			<td >iXon Life&#160;</td>
			<td >897</td>
			<td ></td>
		</tr>
		<tr >
			<td >Ethanol</td>
			<td >Fisher Scientific</td>
			<td >4355221</td>
			<td ></td>
		</tr>
		<tr >
			<td >Fetal Bovine Serum, Qualified, USDA-approved Regions</td>
			<td >Gibco</td>
			<td >A4766801</td>
			<td ></td>
		</tr>
		<tr >
			<td >Formamide, Deionized</td>
			<td >MilliporeSigma</td>
			<td >46-101-00ML</td>
			<td ></td>
		</tr>
		<tr >
			<td >Goat anti-Mouse IgG (H+L), Recombinant Secondary Antibody, Alexa Fluor 647</td>
			<td >Invitrogen</td>
			<td >A28181</td>
			<td ></td>
		</tr>
		<tr >
			<td >Goat anti-Rabbit IgG (H+L), Recombinant Secondary Antibody, Alexa Fluor 647</td>
			<td >Invitrogen</td>
			<td >A32733</td>
			<td ></td>
		</tr>
		<tr >
			<td >High Precision Straight Tapered Ultra Fine Point Tweezers/Forceps</td>
			<td >Fisher Scientific</td>
			<td >12-000-122</td>
			<td ></td>
		</tr>
		<tr >
			<td >Laser merge module&#160;</td>
			<td >Nikon</td>
			<td >NIIMHF47180</td>
			<td ></td>
		</tr>
		<tr >
			<td >Leibovitz&#39;s L-15 Medium</td>
			<td >Gibco</td>
			<td >21083027</td>
			<td ></td>
		</tr>
		<tr >
			<td >Lipofectamine 2000 Transfection Reagent</td>
			<td >Invitrogen</td>
			<td >11668027</td>
			<td ></td>
		</tr>
		<tr >
			<td >Figure plotting software, MATLAB</td>
			<td >The MathWorks</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Microscope Slide Box</td>
			<td >Fisher Scientific</td>
			<td >34487</td>
			<td ></td>
		</tr>
		<tr >
			<td >Nail Polish</td>
			<td >Fisher Scientific</td>
			<td >50-949-071</td>
			<td ></td>
		</tr>
		<tr >
			<td >Imaging software, NIS-Elements&#160;</td>
			<td >Nikon</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Opti-MEM Reduced Serum Media</td>
			<td >Gibco</td>
			<td >51985091</td>
			<td ></td>
		</tr>
		<tr >
			<td >Parafilm</td>
			<td >Bemis</td>
			<td >13-374-12</td>
			<td></td>
		</tr>
		<tr >
			<td >PBS 10x, pH 7.4</td>
			<td >Fisher Scientific</td>
			<td >70-011-044</td>
			<td ></td>
		</tr>
		<tr >
			<td >Penicillin-Streptomycin Solution,100X</td>
			<td >Gibco</td>
			<td >15140122</td>
			<td ></td>
		</tr>
		<tr >
			<td >Piezo Z-Drive&#160;</td>
			<td >Physik Instrumente (PI)</td>
			<td >91985</td>
			<td ></td>
		</tr>
		<tr >
			<td >Pipet Tips</td>
			<td >VWR</td>
			<td >10017</td>
			<td ></td>
		</tr>
		<tr >
			<td >Plain and Frosted Clipped Corner Microscope Slides</td>
			<td >Fisher Scientific</td>
			<td >22-037-246</td>
			<td ></td>
		</tr>
		<tr >
			<td >Poly-D-Lysine solution</td>
			<td >Sigma-Aldrich</td>
			<td >A-003-E</td>
			<td></td>
		</tr>
		<tr >
			<td >Sodium Azide</td>
			<td >Fisher Scientific</td>
			<td >BP922I-500</td>
			<td ></td>
		</tr>
		<tr >
			<td >Spinning disk</td>
			<td >Yokogawa</td>
			<td >CSU-X1</td>
			<td ></td>
		</tr>
		<tr >
			<td >Square Cover Slips</td>
			<td >Thermo Scientific</td>
			<td >3305</td>
			<td ></td>
		</tr>
		<tr >
			<td >TBS 10x solution</td>
			<td >Fisher Scientific</td>
			<td >BP2471500</td>
			<td ></td>
		</tr>
		<tr >
			<td >TelC-Alexa488</td>
			<td >PNA Bio</td>
			<td >F1004</td>
			<td ></td>
		</tr>
		<tr >
			<td >TMP</td>
			<td >Synthesized by Chenoweth lab</td>
			<td ></td>
			<td >Available upon request</td>
		</tr>
		<tr >
			<td >TNH</td>
			<td >Synthesized by Chenoweth lab</td>
			<td ></td>
			<td >Available upon request</td>
		</tr>
		<tr >
			<td >Tris Solution</td>
			<td >Fisher Scientific</td>
			<td >92-901-00ML</td>
			<td></td>
		</tr>
		<tr >
			<td >Triton X-100 10% Solution</td>
			<td >MilliporeSigma</td>
			<td >64-846-350ML</td>
			<td >Prepare 0.5% in 1x PBS</td>
		</tr>
		<tr >
			<td >U2Os cell line</td>
			<td >From E.V. Makayev lab (Nanyang Technological University, Singapore)</td>
			<td >HTB-96</td>
			<td ></td>
		</tr>
		<tr >
			<td >VECTASHIELD Antifade Mounting Medium</td>
			<td >Vector Laboratories</td>
			<td >NC9524612</td>
			<td ></td>
		</tr>
	</tbody>
</table>

chemical dimerization-induced protein condensates on telomeres

Chromatin-associated condensates are implicated in many nuclear processes, but the underlying mechanisms remain elusive. This protocol describes a chemically-induced protein dimerization system to create condensates on telomeres. The chemical dimerizer consists of two linked ligands that can each bind to a protein: Halo ligand to Halo-enzyme and trimethoprim (TMP) to E. coli dihydrofolate reductase (eDHFR), respectively. Fusion of Halo enzyme to a telomere protein anchors dimerizers to telomeres through covalent Halo ligand-enzyme binding. Binding of TMP to eDHFR recruits eDHFR-fused phase separating proteins to telomeres and induces condensate formation. Because TMP-eDHFR interaction is non-covalent, condensation can be reversed by using excess free TMP to compete with the dimerizer for eDHFR binding. An example of inducing promyelocytic leukemia (PML) nuclear body formation on telomeres and determining condensate growth, dissolution, localization and composition is shown. This method can be easily adapted to induce condensates at other genomic locations by fusing Halo to a protein that directly binds to the local chromatin or to dCas9 that is targeted to the genomic locus with a guide RNA. By offering the temporal resolution required for single cell live imaging while maintaining phase separation in a population of cells for biochemical assays, this method is suitable for probing both the formation and function of chromatin-associated condensates.

Representative images of telomeric localization of SUMO identified by telomere DNA FISH and SUMO protein IF are shown in Figure 2. Cells with SIM recruitment enriched SUMO1 and SUMO 2/3 on telomeres compared to cells with SIM mutant recruitment. This indicates that SIM dimerization-induced SUMO enrichment on telomeres depends on SUMO-SIM interactions.
A representative time lapse movie of TRF1 and SIM after dimerization is shown in Video 1. Snapsho...

Watch this Scientific Journal Video about Chemical Dimerization-Induced Protein Condensates on Telomeres at JoVE.com

Chemical Dimerization-Induced Protein Condensates on Telomeres

This protocol illustrates a chemically induced protein dimerization system to create condensates on chromatin.&#160; The formation of promyelocytic leukemia (PML) nuclear body on telomeres with chemical dimerizers is demonstrated. Droplet growth, dissolution, localization and composition are monitored with live cell imaging, immunofluorescence (IF) and fluorescence in situ hybridization (FISH).

Chromatin-associated condensates are implicated in many nuclear processes, but the underlying mechanisms remain elusive. This protocol describes a ...

chemical-dimerization-induced-protein-condensates-on-telomeres

Research

JoVE Journal

Biology

3.0K Views.  Carnegie Mellon University. This protocol illustrates a chemically induced protein dimerization system to create condensates on chromatin.  The formation of promyelocytic leukemia (PML) nuclear body on telomeres with chemical dimerizers is demonstrated. Droplet growth, dissolution, localization and composition are monitored with live cell imaging, immunofluorescence (IF) and fluorescence in situ hybridization (FISH).

Video: Chemical Dimerization-Induced Protein Condensates on Telomeres

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents (Methanol, Ethanol or 2-Propanol) and acetic acid are used for fixation, staining and destaining of proteins in a gel after SDS-PAGE. To speed up the procedure, heating the staining solution in the microwave oven for a short time is frequently used. This usually results in evaporation of toxic or hazardous Methanol, Ethanol or 2-Propanol and a strong smell of acetic acid in the lab which should be avoided due to safety considerations. In a protocol originally published in two patent applications by E.M. Wondrak (US2001046709 (A1), US6319720 (B1)), an alternative composition of the staining solution is described in which no organic solvent or acid is used. The CBB is dissolved in bidistilled water (60-80mg of CBB G-250 per liter) and 35 mM HCl is added as the only other compound in the staining solution. The CBB staning of the gel is done after SDS-PAGE and thorough washing of the gel in bidistilled water. By heating the gel during the washing and staining steps, the process can be finished faster and no toxic or hazardous compunds are evaporating. The staining of proteins occurs already within 1 minute after heating the gel in staining solution and is fully developed after 15-30 min with a slightly blue background that is destained completely by prolonged washing of the stained gel in bidistilled water, without affecting the stained protein bands.

A short protocol for protein staining with Coomassie Brilliant Blue (CBB) G-250 in polyacrylamide gels is described without using organic solvents or acetic acid as in the classical staining procedures with CBB.

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

Using the GELFREE 8100 Fractionation System for Molecular Weight-Based Fractionation with Liquid Phase Recovery

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based fractionation. The system is comprised of single-use, 8-sample capacity cartridges and a benchtop GELFREE Fractionation Instrument. During separation, a constant voltage is applied between the anode and cathode reservoirs, and each protein mixture is electrophoretically driven from a loading chamber into a specially designed gel column gel. Proteins are concentrated into a tight band in a stacking gel, and separated based on their respective electrophoretic mobilities in a resolving gel. As proteins elute from the column, they are trapped and concentrated in liquid phase in the collection chamber, free of the gel. The instrument is then paused at specific time intervals, and fractions are collected using a pipette. This process is repeated until all desired fractions have been collected. If fewer than 8 samples are run on a cartridge, any unused chambers can be used in subsequent separations.
This novel technology facilitates the quick and simple separation of up to 8 complex protein mixtures simultaneously, and offers several advantages when compared to previously available fractionation methods. This system is capable of fractionating up to 1mg of total protein per channel, for a total of 8mg per cartridge. Intact proteins over a broad mass range are separated on the basis of molecular weight, retaining important physiochemical properties of the analyte. The liquid phase entrapment provides for high recovery while eliminating the need for band or spot cutting, making the fractionation process highly reproducible1.

The accompanying video describes the use of the GELFREE 8100 Fractionation System, which partitions complex protein samples on the basis of molecular weight and recovers the fractions in liquid phase. The video describes how the technology works, how it is used, and provides resultant data, with polyacrylamide gel electrophoresis analysis of fractionated bovine liver homogenate.

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based ...

In-vivo Detection of Protein-protein Interactions on Micro-patterned Surfaces

Unraveling the interaction network of molecules in-vivo is key to understanding the mechanisms that regulate cell function and metabolism. A multitude of methodological options for addressing molecular interactions in cells have been developed, but most of these methods suffer from being rather indirect and therefore hardly quantitative. On the contrary, a few high-end quantitative approaches were introduced, which however are difficult to extend to high throughput. To combine high throughput capabilities with the possibility to extract quantitative information, we recently developed a new concept for identifying protein-protein interactions (Schwarzenbacher et al., 2008). Here, we describe a detailed protocol for the design and the construction of this system which allows for analyzing interactions between a fluorophore-labeled protein ("prey") and a membrane protein ("bait") in-vivo. Cells are plated on micropatterned surfaces functionalized with antibodies against the bait exoplasmic domain. Bait-prey interactions are assayed via the redistribution of the fluorescent prey. The method is characterized by high sensitivity down to the level of single molecules, the capability to detect weak interactions, and high throughput capability, making it applicable as screening tool.

In-vivo Detection of Protein-protein Interactions on Micro-patterned Surfaces

This video shows experiments with subsequent analysis of protein-protein interactions by the use of micro-patterned surfaces. The approach offers the possibility to detect protein interactions in living cells and combines high throughput capabilities with the possibility to extract quantitative information.

Unraveling the interaction network of molecules in-vivo is key to understanding the mechanisms that regulate cell function and metabolism. A multitude of ...

A Protocol for the Identification of Protein-protein Interactions Based on 15N Metabolic Labeling, Immunoprecipitation, Quantitative Mass Spectrometry and Affinity Modulation

Protein-protein interactions are fundamental for many biological processes in the cell. Therefore, their characterization plays an important role in current research and a plethora of methods for their investigation is available1. Protein-protein interactions often are highly dynamic and may depend on subcellular localization, post-translational modifications and the local protein environment2. Therefore, they should be investigated in their natural environment, for which co-immunoprecipitation approaches are the method of choice3. Co-precipitated interaction partners are identified either by immunoblotting in a targeted approach, or by mass spectrometry (LC-MS/MS) in an untargeted way. The latter strategy often is adversely affected by a large number of false positive discoveries, mainly derived from the high sensitivity of modern mass spectrometers that confidently detect traces of unspecifically precipitating proteins. A recent approach to overcome this problem is based on the idea that reduced amounts of specific interaction partners will co-precipitate with a given target protein whose cellular concentration is reduced by RNAi, while the amounts of unspecifically precipitating proteins should be unaffected. This approach, termed QUICK for QUantitative Immunoprecipitation Combined with Knockdown4, employs Stable Isotope Labeling of Amino acids in Cell culture (SILAC)5 and MS to quantify the amounts of proteins immunoprecipitated from wild-type and knock-down strains. Proteins found in a 1:1 ratio can be considered as contaminants, those enriched in precipitates from the wild type as specific interaction partners of the target protein. Although innovative, QUICK bears some limitations: first, SILAC is cost-intensive and limited to organisms that ideally are auxotrophic for arginine and/or lysine. Moreover, when heavy arginine is fed, arginine-to-proline interconversion results in additional mass shifts for each proline in a peptide and slightly dilutes heavy with light arginine, which makes quantification more tedious and less accurate5,6. Second, QUICK requires that antibodies are titrated such that they do not become saturated with target protein in extracts from knock-down mutants.
Here we introduce a modified QUICK protocol which overcomes the abovementioned limitations of QUICK by replacing SILAC for 15N metabolic labeling and by replacing RNAi-mediated knock-down for affinity modulation of protein-protein interactions. We demonstrate the applicability of this protocol using the unicellular green alga Chlamydomonas reinhardtii as model organism and the chloroplast HSP70B chaperone as target protein7 (Figure 1). HSP70s are known to interact with specific co-chaperones and substrates only in the ADP state8. We exploit this property as a means to verify the specific interaction of HSP70B with its nucleotide exchange factor CGE19.

A Protocol for the Identification of Protein-protein Interactions Based on 15N Metabolic Labeling, Immunoprecipitation, Quantitative Mass Spectrometry and Affinity Modulation

We present a variation of the QUICK (QUantitative Immunoprecipitation Combined with Knockdown) approach that was introduced previously to distinguish between true and false protein-protein interactions. Our approach is based on 15N metabolic labeling, the modulation of affinities of protein-protein interactions by the presence/absence of ATP, immunoprecipitation, and quantitative mass spectrometry.

Protein-protein interactions are fundamental for many biological processes in the cell. Therefore, their characterization plays an important role in ...

Protein WISDOM: A Workbench for In silico De novo Design of BioMolecules

The aim of de novo protein design is to find the amino acid sequences that will fold into a desired 3-dimensional structure with improvements in specific properties, such as binding affinity, agonist or antagonist behavior, or stability, relative to the native sequence. Protein design lies at the center of current advances drug design and discovery. Not only does protein design provide predictions for potentially useful drug targets, but it also enhances our understanding of the protein folding process and protein-protein interactions. Experimental methods such as directed evolution have shown success in protein design. However, such methods are restricted by the limited sequence space that can be searched tractably. In contrast, computational design strategies allow for the screening of a much larger set of sequences covering a wide variety of properties and functionality. We have developed a range of computational de novo protein design methods capable of tackling several important areas of protein design. These include the design of monomeric proteins for increased stability and complexes for increased binding affinity.
To disseminate these methods for broader use we present Protein WISDOM (<a href="http://www.proteinwisdom.org" target="_blank">http://www.proteinwisdom.org</a>), a tool that provides automated methods for a variety of protein design problems. Structural templates are submitted to initialize the design process. The first stage of design is an optimization sequence selection stage that aims at improving stability through minimization of potential energy in the sequence space. Selected sequences are then run through a fold specificity stage and a binding affinity stage. A rank-ordered list of the sequences for each step of the process, along with relevant designed structures, provides the user with a comprehensive quantitative assessment of the design. Here we provide the details of each design method, as well as several notable experimental successes attained through the use of the methods.

Protein WISDOM: A Workbench for In silico De novo Design of BioMolecules

We developed computational de novo protein design methods capable of tackling several important areas of protein design. To disseminate these methods we present Protein WISDOM, an online tool for protein design (<a href="http://www.proteinwisdom.org" target="_blank">http://www.proteinwisdom.org</a>). Starting from a structural template, design of monomeric proteins for increased stability and complexes for increased binding affinity can be performed.

The aim of de novo protein design is to find the amino acid sequences that will fold into a desired 3-dimensional structure with improvements in specific ...

Genetically-encoded Molecular Probes to Study G Protein-coupled Receptors

To facilitate structural and dynamic studies of G protein-coupled receptor (GPCR) signaling complexes, new approaches are required to introduce informative probes or labels into expressed receptors that do not perturb receptor function. We used amber codon suppression technology to genetically-encode the unnatural amino acid, p-azido-L-phenylalanine (azF) at various targeted positions in GPCRs heterologously expressed in mammalian cells. The versatility of the azido group is illustrated here in different applications to study GPCRs in their native cellular environment or under detergent solubilized conditions. First, we demonstrate a cell-based targeted photocrosslinking technology to identify the residues in the ligand-binding pocket of GPCR where a tritium-labeled small-molecule ligand is crosslinked to a genetically-encoded azido amino acid. We then demonstrate site-specific modification of GPCRs by the bioorthogonal Staudinger-Bertozzi ligation reaction that targets the azido group using phosphine derivatives. We discuss a general strategy for targeted peptide-epitope tagging of expressed membrane proteins in-culture and its detection using a whole-cell-based ELISA approach. Finally, we show that azF-GPCRs can be selectively tagged with fluorescent probes. The methodologies discussed are general, in that they can in principle be applied to any amino acid position in any expressed GPCR to interrogate active signaling complexes.

We genetically-encode the unnatural amino acid, p-azido-L-phenylalanine at various targeted positions in GPCRs and show the versatility of the azido group in different applications. These include a targeted photocrosslinking technology to identify residues in the ligand-binding pocket of a GPCR, and site-specific bioorthogonal modification of GPCRs with a peptide-epitope tag or fluorescent probe.

To facilitate structural and dynamic studies of G protein-coupled receptor (GPCR) signaling complexes, new approaches are required to introduce ...

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and the inherent instability of many membrane proteins once solubilized in detergents. A protocol is described that combines ligation independent cloning of membrane proteins as GFP fusions with expression in Escherichia coli detected by GFP fluorescence. This enables the construction and expression screening of multiple membrane protein/variants to identify candidates suitable for further investment of time and effort. The GFP reporter is used in a primary screen of expression by visualizing GFP fluorescence following SDS polyacrylamide gel electrophoresis (SDS-PAGE). Membrane proteins that show both a high expression level with minimum degradation as indicated by the absence of free GFP, are selected for a secondary screen. These constructs are scaled and a total membrane fraction prepared and solubilized in four different detergents. Following ultracentrifugation to remove detergent-insoluble material, lysates are analyzed by fluorescence detection size exclusion chromatography (FSEC). Monitoring the size exclusion profile by GFP fluorescence provides information about the mono-dispersity and integrity of the membrane proteins in different detergents. Protein: detergent combinations that elute with a symmetrical peak with little or no free GFP and minimum aggregation are candidates for subsequent purification. Using the above methodology, the heterologous expression in E. coli of SED (shape, elongation, division, and sporulation) proteins from 47 different species of bacteria was analyzed. These proteins typically have ten transmembrane domains and are essential for cell division. The results show that the production of the SEDs orthologues in E. coli was highly variable with respect to the expression levels and integrity of the GFP fusion proteins. The experiment identified a subset for further investigation.

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

A streamlined approach to screening for the expression of recombinant membrane proteins in Escherichia coli based on fusion to green fluorescent protein is presented.

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

High-throughput Screening for Protein-based Inheritance in S. cerevisiae

The encoding of biological information that is accessible to future generations is generally achieved via changes to the DNA sequence. Long-lived inheritance encoded in protein conformation (rather than sequence) has long been viewed as paradigm-shifting but rare. The best characterized examples of such epigenetic elements are prions, which possess a self-assembling behavior that can drive the heritable manifestation of new phenotypes. Many archetypal prions display a striking N/Q-rich sequence bias and assemble into an amyloid fold. These unusual features have informed most screening efforts to identify new prion proteins. However, at least three known prions (including the founding prion, PrPSc) do not harbor these biochemical characteristics. We therefore developed an alternative method to probe the scope of protein-based inheritance based on a property of mass action: the transient overexpression of prion proteins increases the frequency at which they acquire a self-templating conformation. This paper describes a method for analyzing the capacity of the yeast ORFeome to elicit protein-based inheritance. Using this strategy, we previously found that &gt;1% of yeast proteins could fuel the emergence of biological traits that were long-lived, stable, and arose more frequently than genetic mutation. This approach can be employed in high throughput across entire ORFeomes or as a targeted screening paradigm for specific genetic networks or environmental stimuli. Just as forward genetic screens define numerous developmental and signaling pathways, these techniques provide a methodology to investigate the influence of protein-based inheritance in biological processes.

High-throughput Screening for Protein-based Inheritance in S. cerevisiae

This protocol describes a high-throughput methodology to functionally screen for protein-based inheritance in S. cerevisiae.

The encoding of biological information that is accessible to future generations is generally achieved via changes to the DNA sequence. Long-lived ...

Combining Chemical Cross-linking and Mass Spectrometry of Intact Protein Complexes to Study the Architecture of Multi-subunit Protein Assemblies

Proteins interact with their ligands to form active and dynamic assemblies which carry out various cellular functions. Elucidating these interactions is therefore fundamental for the understanding of cellular processes. However, many protein complexes are dynamic assemblies and are not accessible by conventional structural techniques. Mass spectrometry contributes to the structural investigation of these assemblies, and particularly the combination of various mass spectrometric techniques delivers valuable insights into their structural arrangement.
In this article, we describe the application and combination of two complementary mass spectrometric techniques, namely chemical cross-linking coupled with mass spectrometry and native mass spectrometry. Chemical cross-linking involves the covalent linkage of amino acids in close proximity by using chemical reagents. After digestion with proteases, cross-linked di-peptides are identified by mass spectrometry and protein interactions sites are uncovered. Native mass spectrometry on the other hand is the analysis of intact protein assemblies in the gas phase of a mass spectrometer. It reveals protein stoichiometries as well as protein and ligand interactions. Both techniques therefore deliver complementary information on the structure of protein-ligand assemblies and their combination proved powerful in previous studies.

The architecture of protein complexes is essential for their function. Combining various mass spectrometric techniques proved powerful to study their assembly. We provide protocols for chemical cross-linking and native mass spectrometry and show how these complementary techniques help to elucidate the architecture of multi-subunit protein assemblies.

Proteins interact with their ligands to form active and dynamic assemblies which carry out various cellular functions. Elucidating these interactions is ...

Quantification of Site-specific Protein Lysine Acetylation and Succinylation Stoichiometry Using Data-independent Acquisition Mass Spectrometry

Post-translational modification (PTM) of protein lysine residues by N&#400;-acylation induces structural changes that can dynamically regulate protein functions, for example, by changing enzymatic activity or by mediating interactions. Precise quantification of site-specific protein acylation occupancy, or stoichiometry, is essential for understanding the functional consequences of both global low-level stoichiometry and individual high-level acylation stoichiometry of specific lysine residues. Other groups have reported measurement of lysine acetylation stoichiometry by comparing the ratio of peptide precursor isotopes from endogenous, natural abundance acylation and exogenous, heavy isotope-labeled acylation introduced after quantitative chemical acetylation of proteins using stable isotope-labeled acetic anhydride. This protocol describes an optimized approach featuring several improvements, including: (1) increased chemical acylation efficiency, (2) the ability to measure protein succinylation in addition to acetylation, and (3) improved quantitative accuracy due to reduced interferences using fragment ion quantification from data-independent acquisitions (DIA) instead of precursor ion signal from data-dependent acquisition (DDA). The use of extracted peak areas from fragment ions for quantification also uniquely enables differentiation of site-level acylation stoichiometry from proteolytic peptides containing more than one lysine residue, which is not possible using precursor ion signals for quantification. Data visualization in Skyline, an open source quantitative proteomics environment, allows for convenient data inspection and review. Together, this workflow offers unbiased, precise, and accurate quantification of site-specific lysine acetylation and succinylation occupancy of an entire proteome, which may reveal and prioritize biologically relevant acylation sites.

Here, we present unbiased quantification of site-specific protein acetylation and/or succinylation occupancy (stoichiometry) of an entire proteome through a ratiometric analysis of endogenous modifications to modifications introduced after quantitative chemical acylation using stable isotope-labeled anhydrides. In combination with sensitive data-independent acquisition mass spectrometry, accurate site occupancy measurements are obtained.

Post-translational modification (PTM) of protein lysine residues by N&#400;-acylation induces structural changes that can dynamically regulate protein ...