Name: chemical dimerization-induced protein condensates on telomeres
Uploaded: 2021-04-12T13:00:00.000+00:00
Duration: 8 min 52 s
Description: Watch this Scientific Journal Video about Chemical Dimerization-Induced Protein Condensates on Telomeres at JoVE.com

This work was supported by US National Institutes of Health (1K22CA23763201 to H.Z., GM118510 to D.M.C.) and Charles E. Kaufman foundation to H.Z. The authors would like to thank Jason Tones for proofreading the manuscript.

1. Production of transient cell lines
<ol>
	<li>Culture U2OS acceptor cells on 22 x 22 mm glass coverslips (for live imaging) or 12 mm diameter circular coverslips (for IF or FISH) coated with poly-D-lysine in 6-well plate with growth medium (10% fetal bovine serum and 1% Penicillin-Streptomycin solution in DMEM) until they reach 60-70% confluency.</li>
	<li>Replace growth medium with 1 mL transfection medium (growth medium without Penicillin-Streptomycin solution) prior to transfection.</li>
	<li>For each transfection well, add 4 &#956;L transfection reagent to 150 &#956;L reduced serum media, vortex for 10 seconds and then incubate for 5 mins.</li>
	<li>For each well, add Halo construct plasmid (Halo-GFP-TRF1 or Halo-TRF1) and eDHFR construct plasmid (mCherry-eDHFR-SIM or mCherry-eDHFR-SIM mutant) at a 1:1 mass ratio (0.5 &#956;g Halo construct plasmid with 0.5 &#956;g eDHFR construct plasmid) to 150 &#956;L reduced serum media, dropwise, mix by pipetting. 
	NOTE: The tags are relatively small (Halo 33 kD, eDHFR 28 kD, mCherry 30 kD, eGFP 27 kD) and no effect on phase separation was observed. However, using mutants such as SIM mutant used here to make sure that the phase behavior is sensitive to the mutations not the tags is advised. SIM is from &#65279;PIASx28,30. SIM sequence is AAAGTCGATGTAATTGACTTAACGATCGAATCTAGCAGCGATGAAGAAGAAGATCCACCGGCTAAACGT. SIM mutant is generated by mutating SIM amino acids VIDL to VADA28, and the sequence is AAAGTCGATGTAGCCGACGCCACGATCGAATCTAGCAGCGATGAAGAAGAAGATCCACCGGCTAAACGT. We deposited our plasmids to addgene: #164644 3XHalo-GFP-TRF1; #164646 mCherry-eDHFR-SIM; #164649 mCherry-eDHFR-SIM mutant.</li>
	<li>Add 150 &#956;L of transfection reagent -reduced serum media mixture to 150 &#956;L reduced serum media with DNA, dropwise, mix by pipetting, incubate for 5 mins.</li>
	<li>Add the 300 &#956;L of transfection reagent-DNA mixture to cells, dropwise and then place cells back to incubator.</li>
	<li>Wait 24-48 hours before live imaging, immunofluorescence (IF) or fluorescence in situ hybridization (FISH).</li>
</ol>
2. Dimerization on telomeres
<ol>
	<li>Dissolve dimerizers in dimethyl sulphoxide at 10&#8201;mM and store in plastic microcentrifuge tubes at &#8722;80&#8201;&#176;C for long term storage. 
	NOTE: Instead of using the dimerizer with TMP directly linked to Halo (TMP-Halo, TH), dimerizer TMP-NVOC-Halo (TNH) that has a photosensitive linker, 6-nitroveratryl oxycarbonyl (NVOC), between TMP and Haloligand is used31. This is because it takes less time for TNH (~5 mins) to diffuse into the cell than TH (~20 mins). Results shown here can also be obtained using TH. When using TNH, be careful not to expose the dimerizer to light to avoid NOVC cleavage. Handle TNH in a dark room with a dim red-light lamp, store the dimerizer in amber plastic tubes and wrap the container containing TNH or treated cells with aluminum foil. Imaging TNH with DIC is safe.</li>
	<li>Take an aliquot of 10 mM dimerizer from &#8722;80 &#176;C and dilute in imaging medium to a stock concentration of 10 &#956;M and store at &#8722;20&#8201;&#176;C.</li>
	<li>When ready to use, dilute dimerizers from 10 &#956;M stock solution to a final working concentration of 100&#8201;nM in growth medium (for fixed imaging) or imaging medium. Treat cells with 100 nM dimerizers (final concentration) on stage for live imaging or incubate for 4-5 hours for immunofluorescence (IF) and fluorescence in situ hybridization (FISH). 
	NOTE: The concentration of dimerizers used affects dimerization efficiency and thus phase separation. The dimerizer concentration allowing maximum dimerization efficiency depends on cell type and anchor protein concentration, so it will need to be determined for different experiments. One simple way is to incubate cells expressing the anchor protein and mCherry-eDHFR (without fusing to the phase separating protein or fused to a non-phase separating mutant) and identify the dimerizer concentration at which the highest mCherry intensity at the anchor is achieved. A more systematic approach is to incubate cells expressing the anchor only with different concentrations of dimerizers and then with a Halo binding dye to help determine the dimerizer concentration at which the Halo binding dye intensity starts to plateau (i.e., all Halo-fused anchors are occupied by the dimerizer and no more left for the Halo binding dye)32.</li>
	<li>To reverse dimerization, incubate cells with dimerizers for 2-5 hours (with or without live imaging) or until desired droplet size is achieved and add 100 &#956;M free TMP (final concentration) diluted in imaging medium to cells.</li>
</ol>
3. Immunofluorescence (IF) 
<ol>
	<li>Seed 105 cells on 12 mm diameter circular cover glasses coated with poly-D-lysine in 6-well plate. Then transfect the two plasmids (Halo-GFP-TRF1 with mCherry-eDHFR-SIM or mCherry-eDHFR-SIM mutant) and wait for 24-48 hours before proceeding to immunofluorescence. 
	NOTE: Wait more than one day after transfection can obtain higher expression. &#160;</li>
	<li>Dilute dimerizers with growth medium to reach a final concentration of 100 nM, add diluted dimerizers to cells and incubate at 37&#8201;&#176;C for 4-5 hours. 
	NOTE: Phase separation is quickly induced after adding dimerizers (&#60; 30 mins). Longer incubation helps droplets coarsen into larger sizes. Following droplet growth with live imaging can be used to determine the time it takes for droplets to reach a desired state.</li>
	<li>Fix cells in PBS solution containing 4% formaldehyde and 0.1% Triton X-100 for 10 mins at room temperature to permeabilize cells. Wash cells 3 times with PBS. 
	NOTE: After this step, it can be paused and cells can be stored at 4&#8201;&#176;C for up to a week. 
	Caution: Formaldehyde is harmful by inhalation and if swallowed, it also irritates eyes, respiratory system and skin and is a possible cancer hazard. Need to wear personal protective equipment, use only in a chemical fume hood. Also put it in a waste container after use, do not dispose it in the sink.</li>
	<li>Wash coverslips two times with 50 &#956;L TBS-Tx and once with 50 &#956;L Antibody Dilution Buffer (AbDil). TBS-Tx was made by TBS, 0.1% Triton X-100 and 0.05% Na-azide. AbDil was made by TBS-Tx, 2% BSA and 0.05% Na-azide.</li>
	<li>Incubate each coverslip with 50 &#956;L primary anti-PML (1:50 dilution in AbDil) / anti-SUMO1 (1:200 dilution in AbDil) / anti-SUMO2/3 antibody (1:200 dilution in AbDil) at 4 &#176;C in a humidified chamber overnight. mCherry antibody can also be used (1:200 dilution in AbDil) to help detect mCherry signal for FISH. 
	NOTE: FISH quenches the mCherry fluorescent signal, which makes it difficult to differentiate cells transfected with mCherry plasmids from those not transfected in FISH experiments. Using mCherry antibody is advised. Alternatively, one can make a stable cell line expressing eDHFR containing protein.</li>
	<li>Wash coverslips 3 times with AbDil to remove unbound primary antibody.</li>
	<li>Incubate cells with secondary antibody [anti-mouse IgG (H+L) secondary antibody conjugated with Alexa Fluor 647 for PML and SUMO, anti-rabbit IgG (H+L) secondary antibody conjugated with Alexa Fluor 555 for mCherry, both at 1:1000 dilution in AbDil] for 1 hour in dark box at room temperature.</li>
	<li>Wash coverslips 3 times with TBS-Tx.</li>
	<li>Label slides, dilute DAPI in mounting media to reach DAPI final concentration of 1 &#956;g/mL. Then put 2 &#956;L diluted DAPI on the slide. Flip the coverslips over and place them onto DAPI drop, aspire extra fluid from the edge of the coverslip.</li>
	<li>Seal with nail polish, let it dry and rinse from top of the coverslip with water. Save in freezer for imaging.</li>
</ol>
4. Fluorescence in situ hybridization (FISH)
<ol>
	<li>Seed 105 cells on 12 mm diameter circular cover glasses coated with poly-D-lysine in 6-well plate. Transfect&#160;cells with Halo-TRF1 and mCherry-eDHFR-SIM or mCherry-eDHFR-SIM mutant plasmids and wait for 24-48 h before proceeding to FISH. The dimerization step is the same as described in 3.2. 
	NOTE: Here TRF1 is not fused with GFP so the green channel is freed up for telomere DNA probe.</li>
	<li>Fix cells with 4% formaldehyde for 10 mins at room temperature and wash 4 times with PBS. For IF-FISH, proceed to IF protocol from here and after washing off secondary antibody in IF (3.8), refix cells with 4% formaldehyde for 10 mins at room temperature and wash three times with PBS.</li>
	<li>Dehydrate coverslips in an ethanol series (70%, 80%, 90%, 2 mins each).</li>
	<li>Incubate coverslips with 488-telC PNA probe (1:2000 ratio) in 5 &#956;L hybridization solution at 75 &#176;C for 5 mins. Hybridization solution contains 70% deionized formamide, 10 mM Tris (pH 7.4), 0.5% blocking reagent. Then incubate overnight in a humidified chamber at room temperature.</li>
	<li>Wash coverslips with wash buffer (70% formamide, 10 mM Tris) 2 mins for 3 times at room temperature and mount with 1 &#956;g/mL DAPI in mounting media for imaging. 
	NOTE: The FISH protocol is a published protocol33&#8217;34.</li>
</ol>
5. Live imaging
<ol>
	<li>When cells are ready for imaging, mount coverslips in magnetic chambers with cells maintained in 1 mL imaging medium without phenol red on a heated stage in an environmental chamber.</li>
	<li>Set up microscope and environmental control apparatus. Images were acquired with a spinning disk confocal microscope with a 100x 1.4 NA objective, a Piezo Z-Drive, an electron multiplying charge-coupled device&#160;(EMCCD) camera, and a laser merge module equipped with 455, 488, 561, 594 and 647 nm lasers controlled by imaging software. Output powers for all lasers are 20 mW measured at the fiber end.</li>
	<li>Locate cells with bright GFP signal on telomeres and diffusively localized mCherry signal in the nucleoplasm. Find around 20 cells, memorize each position with x, y, z information and set up parameters for time lapse imaging with 0.5 &#956;m spacing for a total of 8 &#956;m in Z and 5-minute time interval for 2-4 hours for both GFP and mCherry channels. Use 30% of 594 nm and 50% of 488 nm power intensity, with exposure times of 200 ms and camera gain 300. 
	NOTE: The output power of laser units is 20 mW. Bright GFP foci indicate larger anchor size which can nucleate condensates more easily. Find cells with a wide range of mCherry signal because phase separation depends on SIM concentration in the cell. Cells with too dim or too bright mCherry signal may not phase separate. To avoid photobleaching, do not use too much laser power or too long exposure time.</li>
	<li>Start imaging and take one-time loop as pre-dimerization. Pause imaging, add 0.5 mL imaging media containing 15 &#956;L of 10 &#956;M dimerizer to the imaging chamber on the stage so that the final dimerizer concentration is 100 nM. Resume imaging.</li>
	<li>When ready to reverse dimerization, pause imaging, add 0.5 mL imaging media containing 2 &#956;L of 100 mM stock TMP to the imaging chamber on the stage to get 100 &#956;M TMP final concentration. Continue imaging cells for 1-2 hours.</li>
</ol>
6. Fixed imaging
<ol>
	<li>Same microscope set up as live imaging, stage heating is not needed. Use 488 nm to image telomere FISH, 561 nm for mCherry IF, and 647 nm for PML or SUMO IF. 
	NOTE: If not using a mCherry antibody, just directly image mCherry protein but signal maybe dim because of quenching in FISH.&#160; Still use 561 nm rather than 594 nm laser to image mCherry to avoid signal bleed-through of Cy5 to mCherry.</li>
	<li>Locate around 30-50 cells with red signal (mCherry or mCherry IF) to select for transfected cells.</li>
	<li>Images were taken with 0.3 &#181;m spacing for a total of 8 &#181;m in Z for collecting more signals. Use 80% of 647 nm, 80% of 561 nm, and 70% of 488 nm power intensity, with exposure times of 600 ms and camera gain 300.</li>
</ol>
7. Process time-lapse images
<ol>
	<li>Define binary for telomeres 
	Choose one cell with all time and z-stack information, choose only the GFP channel and create a binary layer by defining threshold. Adjust the lower and upper values of the threshold and use functions such as &#8220;Smooth&#8221;, &#8220;Clean&#8221; and &#8220;Fill holes&#8221; to see how well the threshold picks up the desired objects through all time points.</li>
	<li>Subtract background 
	Choose all channels, draw rectangle Region of Interest (ROI) on the background (aside from the cell). Define this ROI as background and then subtract background intensity.</li>
	<li>Link telomere binary to telomere intensity 
	Choose telomere binary and link it to GFP channel for calculating GFP intensity in the binary objects as telomere intensity.</li>
	<li>Calculate telomere number and intensity over time 
	Specify which information to be exported, such as time, object ID, mean intensity, sum intensity, and export data. Use figure plotting software to read the exported table and generate figures of telomere number and telomere intensity (summarize intensity over the volume in each telomere and then average over all telomeres in a cell) over time.</li>
</ol>
8. Process fixed-cell images
<ol>
	<li>Define binary for APBs 
	Choose transfected cells for analysis by looking for signal in 561nm channel. Following the procedure in 7.1, define threshold in both GFP (telomere DNA FISH) and Cy5 (PML or SUMO IF) channel to generate binary for telomeres and PML bodies or SUMO, respectively. Merge GFP and Cy5 binary layers and create a new layer containing particles that both have GFP and Cy5 signal to represent co-localization of PML body on telomeres, thus APBs.</li>
	<li>Calculate APB/SUMO number and intensity 
	Subtract image background following 7.2. Link APB/SUMO binary layer to Cy5 channel following 7.3. Calculate APB/SUMO number and intensity. Export and plot data following 7.4.</li>
</ol>

<ol>
	<li>Shin, Y., Brangwynne, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liquid+phase+condensation+in+cell+physiology+and+disease.">Liquid phase condensation in cell physiology and disease.</a> Science. 357 (6357), (2017).</li><li>Banani, S. F., Lee, H. O., Hyman, A. A., Rosen, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomolecular+condensates:+organizers+of+cellular+biochemistry.">Biomolecular condensates: organizers of cellular biochemistry.</a> Nature Reviews Molecular Cell Biology. 18 (5), 285-298 (2017).</li><li>Sabari, B. R., Dall'Agnese, A., Young, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomolecular+condensates+in+the+nucleus.">Biomolecular condensates in the nucleus.</a> Trends in Biochemical Sciences. , 1-17 (2020).</li><li>Strom, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phase+separation+drives+heterochromatin+domain+formation.">Phase separation drives heterochromatin domain formation.</a> Nature. 547 (7662), 241-245 (2017).</li><li>Larson, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liquid+droplet+formation+by+HP1&#945;+suggests+a+role+for+phase+separation+in+heterochromatin.">Liquid droplet formation by HP1&#945; suggests a role for phase separation in heterochromatin.</a> Nature. 547 (7662), 236-240 (2017).</li><li>Boija, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+factors+activate+genes+through+the+phase-separation+capacity+of+their+activation+domains.">Transcription factors activate genes through the phase-separation capacity of their activation domains.</a> Cell. 175 (7), 1842-1855 (2018).</li><li>Hur, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CDK-Regulated+phase+separation+seeded+by+histone+genes+ensures+precise+growth+and+function+of+histone+locus+bodies.">CDK-Regulated phase separation seeded by histone genes ensures precise growth and function of histone locus bodies.</a> Developmental Cell. 54 (3), 379-394 (2020).</li><li>McSwiggen, D. T., Mir, M., Darzacq, X., Tjian, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluating+phase+separation+in+live+cells:+diagnosis,+caveats,+and+functional+consequences.">Evaluating phase separation in live cells: diagnosis, caveats, and functional consequences.</a> Genes &amp; Development. 33 (23-24), 1619-1634 (2019).</li><li>Peng, A., Weber, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+and+against+liquid-liquid+phase+separation+in+the+nucleus.">Evidence for and against liquid-liquid phase separation in the nucleus.</a> Non-coding RNA. 5 (4), (2019).</li><li>Erdel, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+heterochromatin+adopts+digital+compaction+states+without+showing+hallmarks+of+HP1-driven+liquid-liquid+phase+separation.">Mouse heterochromatin adopts digital compaction states without showing hallmarks of HP1-driven liquid-liquid phase separation.</a> Molecular Cell. 78 (2), 236-249 (2020).</li><li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+body+phase+separation+drives+telomere+clustering+in+ALT+cancer+cells.">Nuclear body phase separation drives telomere clustering in ALT cancer cells.</a> Molecular Biology of the Cell. 31 (18), 2048-2056 (2020).</li><li>Ballister, E. R., Aonbangkhen, C., Mayo, A. M., Lampson, M. A., Chenoweth, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localized+light-induced+protein+dimerization+in+living+cells+using+a+photocaged+dimerizer.">Localized light-induced protein dimerization in living cells using a photocaged dimerizer.</a> Nature Communications. 5, 1-9 (2014).</li><li>Yeager, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Telomerase-negative+immortalized+human+cells+contain+a+novel+type+of+promyelocytic+leukemia+(PML)+body.">Telomerase-negative immortalized human cells contain a novel type of promyelocytic leukemia (PML) body.</a> Cancer Research. 59 (17), 4175-4179 (1999).</li><li>Zhang, J. M., Zou, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+lengthening+of+telomeres:+From+molecular+mechanisms+to+therapeutic+outlooks.">Alternative lengthening of telomeres: From molecular mechanisms to therapeutic outlooks.</a> Cell and Bioscience. 10 (1), 1-9 (2020).</li><li>Corpet, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PML+nuclear+bodies+and+chromatin+dynamics:+catch+me+if+you+can.">PML nuclear bodies and chromatin dynamics: catch me if you can.</a> Nucleic Acids Research. , 1-23 (2020).</li><li>Li, Y., Ma, X., Wu, W., Chen, Z., Meng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PML+nuclear+body+biogenesis,+carcinogenesis,+and+targeted+therapy.">PML nuclear body biogenesis, carcinogenesis, and targeted therapy.</a> Trends in Cancer. 6 (10), 889-906 (2020).</li><li>Dilley, R. L., Greenberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ALTernative+telomere+maintenance+and+cancer.">ALTernative telomere maintenance and cancer.</a> Trends in Cancer. 1 (2), 145-156 (2015).</li><li>Sobinoff, A. P., Pickett, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+lengthening+of+telomeres:+DNA+repair+pathways+converge.">Alternative lengthening of telomeres: DNA repair pathways converge.</a> Trends in Genetics. 33 (12), 921-932 (2017).</li><li>Draskovic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+PML+body+function+in+ALT+cells+reveals+spatiotemporal+requirements+for+telomere+recombination.">Probing PML body function in ALT cells reveals spatiotemporal requirements for telomere recombination.</a> Proceedings of the National Academy of Sciences. 106 (37), 15726 (2009).</li><li>Zhang, J. M., Yadav, T., Ouyang, J., Lan, L., Zou, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+lengthening+of+telomeres+through+two+distinct+break-induced+replication+pathways.">Alternative lengthening of telomeres through two distinct break-induced replication pathways.</a> Cell Reports. 26 (4), 955-968 (2019).</li><li>Loe, T. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Telomere+length+heterogeneity+in+ALT+cells+is+maintained+by+PML-dependent+localization+of+the+BTR+complex+to+telomeres.">Telomere length heterogeneity in ALT cells is maintained by PML-dependent localization of the BTR complex to telomeres.</a> Genes and Development. 34 (9-10), 650-662 (2020).</li><li>Potts, P. R., Yu, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SMC5/6+complex+maintains+telomere+length+in+ALT+cancer+cells+through+SUMOylation+of+telomere-binding+proteins.">The SMC5/6 complex maintains telomere length in ALT cancer cells through SUMOylation of telomere-binding proteins.</a> Nature Structural and Molecular Biology. 14 (7), 581-590 (2007).</li><li>Chung, I., Leonhardt, H., Rippe, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+assembly+of+a+PML+nuclear+subcompartment+occurs+through+multiple+pathways+and+induces+telomere+elongation.">De novo assembly of a PML nuclear subcompartment occurs through multiple pathways and induces telomere elongation.</a> Journal of Cell Science. 124 (21), 3603-3618 (2011).</li><li>Shen, T. H., Lin, H. K., Scaglioni, P. P., Yung, T. M., Pandolfi, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanisms+of+PML-nuclear+body+formation.">The mechanisms of PML-nuclear body formation.</a> Molecular Cell. 24 (3), 331-339 (2006).</li><li>Shima, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+SUMO+modification+system+is+required+for+the+accumulation+of+RAD51+at+sites+of+DNA+damage.">Activation of the SUMO modification system is required for the accumulation of RAD51 at sites of DNA damage.</a> Journal of Cell Science. 126 (22), 5284-5292 (2013).</li><li>Yal&#231;in, Z., Selenz, C., Jacobs, J. J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitination+and+SUMOylation+in+telomere+maintenance+and+dysfunction.">Ubiquitination and SUMOylation in telomere maintenance and dysfunction.</a> Frontiers in Genetics. 8, 1-15 (2017).</li><li>Sarangi, P., Zhao, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SUMO-mediated+regulation+of+DNA+damage+repair+and+responses.">SUMO-mediated regulation of DNA damage repair and responses.</a> Trends in Biochemical Sciences. 40 (4), 233-242 (2015).</li><li>Banani, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Compositional+control+of+phase-separated+cellular+bodies.">Compositional control of phase-separated cellular bodies.</a> Cell. 166 (3), 651-663 (2016).</li><li>Min, J., Wright, W. E., Shay, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clustered+telomeres+in+phase-separated+nuclear+condensates+engage+mitotic+DNA+synthesis+through+BLM+and+RAD52.">Clustered telomeres in phase-separated nuclear condensates engage mitotic DNA synthesis through BLM and RAD52.</a> Genes and Development. 33 (13-14), 814-827 (2019).</li><li>Song, J., Durrin, L. K., Wilkinson, T. A., Krontiris, T. G., Chen, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+SUMO-binding+motif+that+recognizes+SUMO-modified+proteins.">Identification of a SUMO-binding motif that recognizes SUMO-modified proteins.</a> Proceedings of the National Academy of Sciences of the United States of America. 101 (40), 14373-14378 (2004).</li><li>Zhang, H., Chenoweth, D. M., Lampson, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+7+-+Optogenetic+control+of+mitosis+with+photocaged+chemical+dimerizers.">Chapter 7 - Optogenetic control of mitosis with photocaged chemical dimerizers.</a> Mitosis and Meiosis Part A. 144, 157-164 (2018).</li><li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optogenetic+control+of+kinetochore+function.">Optogenetic control of kinetochore function.</a> Nature Chemical Biology. 13 (10), 1096-1101 (2017).</li><li>Cho, N. W., Dilley, R. L., Lampson, M. A., Greenberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interchromosomal+homology+searches+drive+directional+ALT+telomere+movement+and+synapsis.">Interchromosomal homology searches drive directional ALT telomere movement and synapsis.</a> Cell. 159 (1), 108-121 (2014).</li><li>Dilley, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Break-induced+telomere+synthesis+underlies+alternative+telomere+maintenance.">Break-induced telomere synthesis underlies alternative telomere maintenance.</a> Nature. 539 (7627), 54-58 (2016).</li><li>Aonbangkhen, C., Zhang, H., Wu, D. Z., Lampson, M. A., Chenoweth, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reversible+control+of+protein+localization+in+living+cells+using+a+photocaged-photocleavable+chemical+dimerizer.">Reversible control of protein localization in living cells using a photocaged-photocleavable chemical dimerizer.</a> Journal of the American Chemical Society. 140 (38), 11926-11930 (2018).</li><li>Shin, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatiotemporal+control+of+intracellular+phase+transitions+using+light-activated+optoDroplets.">Spatiotemporal control of intracellular phase transitions using light-activated optoDroplets.</a> Cell. 168 (1-2), 159-171 (2017).</li><li>Shin, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liquid+nuclear+condensates+mechanically+sense+and+restructure+the+genome.">Liquid nuclear condensates mechanically sense and restructure the genome.</a> Cell. 175 (6), 1481-1491 (2018).</li><li>Xiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-mediated+gene+tagging:+a+step-by-step+protocol.">CRISPR/Cas9-mediated gene tagging: a step-by-step protocol.</a> Methods in Molecular Biology. 1961, 255-269 (2019).</li></ol>

The authors have nothing to disclose.

This protocol demonstrated the formation and dissolution of condensates on telomeres with a chemical dimerization system. Kinetics of phase separation and droplet-fusion-induced telomere clustering are monitored with live imaging. Condensate localization and composition are determined with DNA FISH and protein IF.&#160;
There are two critical steps in this protocol. The first is to determine protein and dimerizer concentration. The success in inducing local phase separation at a genomic locus ...

Many proteins and nucleic acids undergo liquid-liquid phase separation (LLPS) and self-assemble into biomolecular condensates to organize biochemistry in cells1,2. LLPS of chromatin-binding proteins leads to the formation of condensates that are associated with specific genomic loci and are implicated in various local chromatin functions3. For example, LLPS of HP1 protein underlies the formation of heterochromatin domains to organize the genome4,5, LLPS of transcription factors forms transcription centers to regulate transcription6, &#65279; LLPS of nascent mRNAs and multi-sex combs protein generates histone locus bodies to regulate the transcription and processing of histone mRNAs7. &#160;However, despite many examples of chromatin-associated condensates being discovered, the underlying mechanisms of condensate formation, regulation and function remain poorly understood. In particular, not all chromatin-associated condensates are formed through LLPS and careful evaluations of condensate formation in live cells are still needed8,9. For example, &#65279; HP1 protein in mouse is shown to have only a weak capacity to form liquid droplets in live cells and &#65279;heterochromatin foci behave as collapsed polymer globules10. Therefore, tools to induce de novo condensates on chromatin in living cells are desirable, particularly those that allow the use of live imaging and biochemical assays to monitor the kinetics of condensate formation, the physical and chemical properties of the resulting condensates, and the cellular consequences of condensate formation.
This protocol reports a chemical dimerization system to induce protein condensates on chromatin11 (Figure 1A). The dimerizer consists of two linked protein-interacting ligands: trimethoprim (TMP) and Halo ligand and can dimerize proteins fused to the cognate receptors: Escherichia coli dihydrofolate reductase (eDHFR) and a bacterial alkyldehalogenase enzyme (Halo enzyme), respectively12. The interaction between Halo ligand and Halo enzyme is covalent, allowing &#160;Halo enzyme to be used as an anchor by fusing it to a chromatin-binding protein to recruit a phase-separating protein fused to eDHFR to chromatin. After the initial recruitment, increased local concentration of the phase separating protein passes the critical concentration needed for phase separation and thus nucleates a condensate at the anchor (Figure 1B). By fusing fluorescent proteins (e.g. mCherry and eGFP) to eDHFR and Halo, nucleation and growth of condensates can be visualized in real time with fluorescence microscopy. Because the interaction between eDHFR and TMP is non-covalent, excess free TMP can be added to compete with the dimerizer for eDHFR binding. This will then release the phase separation protein from the anchor and dissolve the chromatin-associated condensate.
We used this tool to induce de novo promyelocytic leukemia (PML) nuclear body formation on telomeres in telomerase-negative cancer cells that use an alternative lengthening of telomeres&#160;(ALT) pathway for telomere maintenance13,14. &#160;PML nuclear bodies are membrane-less compartments involved in many nuclear processes15,16 and are uniquely localized to ALT telomeres to form APBs, for ALT telomere-associated PML bodies17,18. Telomeres cluster within APBs, presumably to provide repair templates for homology-directed telomere DNA synthesis in ALT19. Indeed, telomere DNA synthesis has been detected in APBs and APBs play essential roles in enriching DNA repair factors on telomeres20,21. However, the mechanisms underlying APB assembly and telomere clustering within APBs were unknown. Since telomere proteins in ALT cells are uniquely modified by small ubiquitin-like modifier (SUMOs)22, many APB components contain sumoylation sites 22,23,24,25 and/or SUMO-interacting motifs (SIMs)26,27 and SUMO-SIM interactions drive phase separation28, we hypothesized that sumoylation on telomeres leads to enrichment of SUMO/SIM containing proteins and SUMO-SIM interactions between those proteins lead to phase separation. &#160;PML protein, which has three sumoylation sites and one SIM site, can be recruited to sumoylated telomeres to form APBs and coalescence of liquid APBs leads to telomeres clustering. To test this hypothesis, we used the chemical dimerization system to mimic sumoylation-induced APB formation by recruiting SIM to telomeres (Figure 2A)11. GFP is fused to Haloenzyme for visualization and to the telomere-binding protein TRF1 to anchor the dimerizer to telomeres. SIM is fused to eDHFR and mCherry. Kinetics of condensate formation and droplet fusion-induced telomere clustering are followed with live cell imaging. &#160;Phase separation is reversed by adding excess free TMP to compete with eDHFR binding. Immunofluorescence (IF) and fluorescence in situ hybridization (FISH) are used to determine condensate composition and telomeric association. Recruiting SIM enriches SUMO on telomeres and the induced condensates contain PML and therefore are APBs. Recruiting a SIM mutant that cannot interact with SUMO does not enrich SUMO on telomeres or induce phase separation, indicating that the fundamental driving force for APB condensation is SUMO-SIM interaction. Agreeing with this observation, polySUMO-polySIM polymers that fused to a TRF2 binding factor RAP1 can also induce APB formation29. Compared to the polySUMO-polySIM fusion system where phase separation occurs as long as enough proteins are produced, the chemical dimerization approach presented here induces phase separation on demand and thus offers better temporal resolution to monitor the kinetics of phase separation and telomere clustering process. In addition, this chemical dimerization system permits the recruitment of other proteins to assess their ability in inducing phase separation and telomere clustering. For example, a disordered protein recruited to telomeres can also form droplets and cluster telomeres without inducing APB formation, suggesting telomere clustering is independent of APB chemistry and only relies on APB liquid property11.&#160;

<table><tbody><tr><td>0.25% Trypsin, 0.1% EDTA in HBSS w/o Calcium, Magnesium and Sodium Bicarbonate</td><td>Corning</td><td>MT25053CI</td><td></td></tr><tr><td>16% Formaldehyde (w/v), Methanol-free</td><td>Thermo Scientific</td><td>28906</td><td>Prepare 1% in 1x PBS</td></tr><tr><td>6 Well Culture Plate</td><td>VWR</td><td>10861-554</td><td></td></tr><tr><td>Aluminum Foil</td><td>Fisher Scientific</td><td>01-213-101</td><td></td></tr><tr><td>Anti-mCherry antibody</td><td>Abcam</td><td>Ab183628</td><td></td></tr><tr><td>Anti-PML antibody</td><td>Santa Cruz</td><td>sc966</td><td></td></tr><tr><td>Anti-SUMO1 antibody</td><td>Abcam</td><td>Ab32058</td><td></td></tr><tr><td>Anti-SUMO2/3 antibody</td><td>Cytoskeleton</td><td>Asm23</td><td></td></tr><tr><td>Blocking Reagent</td><td>Roche</td><td>11096176001</td><td></td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Fisher Scientific</td><td>BP9706100</td><td></td></tr><tr><td>BTX Tube micro 1.5ML&amp;nbsp;</td><td>VWR</td><td>89511-258</td><td></td></tr><tr><td>Circle Cover Slips</td><td>Thermo Scientific</td><td>3350</td><td></td></tr><tr><td>Confocal microscope&amp;nbsp;</td><td>Nikon</td><td>MQS31000</td><td></td></tr><tr><td>DAPI</td><td>Fisher Scientific</td><td>D1306</td><td></td></tr><tr><td>Dimethyl Sulphoxide&amp;nbsp;</td><td>Sigma-Aldrich</td><td>472301</td><td></td></tr><tr><td>DMEM with L-Glutamine, 4.5g/L Glucose and Sodium Pyruvate</td><td>Corning</td><td>MT10017CV</td><td></td></tr><tr><td>EMCCD Camera</td><td>iXon Life&amp;nbsp;</td><td>897</td><td></td></tr><tr><td>Ethanol</td><td>Fisher Scientific</td><td>4355221</td><td></td></tr><tr><td>Fetal Bovine Serum, Qualified, USDA-approved Regions</td><td>Gibco</td><td>A4766801</td><td></td></tr><tr><td>Formamide, Deionized</td><td>MilliporeSigma</td><td>46-101-00ML</td><td></td></tr><tr><td>Goat anti-Mouse IgG (H+L), Recombinant Secondary Antibody, Alexa Fluor 647</td><td>Invitrogen</td><td>A28181</td><td></td></tr><tr><td>Goat anti-Rabbit IgG (H+L), Recombinant Secondary Antibody, Alexa Fluor 647</td><td>Invitrogen</td><td>A32733</td><td></td></tr><tr><td>High Precision Straight Tapered Ultra Fine Point Tweezers/Forceps</td><td>Fisher Scientific</td><td>12-000-122</td><td></td></tr><tr><td>Laser merge module&amp;nbsp;</td><td>Nikon</td><td>NIIMHF47180</td><td></td></tr><tr><td>Leibovitz&#039;s L-15 Medium</td><td>Gibco</td><td>21083027</td><td></td></tr><tr><td>Lipofectamine 2000 Transfection Reagent</td><td>Invitrogen</td><td>11668027</td><td></td></tr><tr><td>Figure plotting software, MATLAB</td><td>The MathWorks</td><td></td><td></td></tr><tr><td>Microscope Slide Box</td><td>Fisher Scientific</td><td>34487</td><td></td></tr><tr><td>Nail Polish</td><td>Fisher Scientific</td><td>50-949-071</td><td></td></tr><tr><td>Imaging software, NIS-Elements&amp;nbsp;</td><td>Nikon</td><td></td><td></td></tr><tr><td>Opti-MEM Reduced Serum Media</td><td>Gibco</td><td>51985091</td><td></td></tr><tr><td>Parafilm</td><td>Bemis</td><td>13-374-12</td><td></td></tr><tr><td>PBS 10x, pH 7.4</td><td>Fisher Scientific</td><td>70-011-044</td><td></td></tr><tr><td>Penicillin-Streptomycin Solution,100X</td><td>Gibco</td><td>15140122</td><td></td></tr><tr><td>Piezo Z-Drive&amp;nbsp;</td><td>Physik Instrumente (PI)</td><td>91985</td><td></td></tr><tr><td>Pipet Tips</td><td>VWR</td><td>10017</td><td></td></tr><tr><td>Plain and Frosted Clipped Corner Microscope Slides</td><td>Fisher Scientific</td><td>22-037-246</td><td></td></tr><tr><td>Poly-D-Lysine solution</td><td>Sigma-Aldrich</td><td>A-003-E</td><td></td></tr><tr><td>Sodium Azide</td><td>Fisher Scientific</td><td>BP922I-500</td><td></td></tr><tr><td>Spinning disk</td><td>Yokogawa</td><td>CSU-X1</td><td></td></tr><tr><td>Square Cover Slips</td><td>Thermo Scientific</td><td>3305</td><td></td></tr><tr><td>TBS 10x solution</td><td>Fisher Scientific</td><td>BP2471500</td><td></td></tr><tr><td>TelC-Alexa488</td><td>PNA Bio</td><td>F1004</td><td></td></tr><tr><td>TMP</td><td>Synthesized by Chenoweth lab</td><td></td><td>Available upon request</td></tr><tr><td>TNH</td><td>Synthesized by Chenoweth lab</td><td></td><td>Available upon request</td></tr><tr><td>Tris Solution</td><td>Fisher Scientific</td><td>92-901-00ML</td><td></td></tr><tr><td>Triton X-100 10% Solution</td><td>MilliporeSigma</td><td>64-846-350ML</td><td>Prepare 0.5% in 1x PBS</td></tr><tr><td>U2Os cell line</td><td>From E.V. Makayev lab (Nanyang Technological University, Singapore)</td><td>HTB-96</td><td></td></tr><tr><td>VECTASHIELD Antifade Mounting Medium</td><td>Vector Laboratories</td><td>NC9524612</td><td></td></tr></tbody></table>

chemical dimerization-induced protein condensates on telomeres

Chromatin-associated condensates are implicated in many nuclear processes, but the underlying mechanisms remain elusive. This protocol describes a chemically-induced protein dimerization system to create condensates on telomeres. The chemical dimerizer consists of two linked ligands that can each bind to a protein: Halo ligand to Halo-enzyme and trimethoprim (TMP) to E. coli dihydrofolate reductase (eDHFR), respectively. Fusion of Halo enzyme to a telomere protein anchors dimerizers to telomeres through covalent Halo ligand-enzyme binding. Binding of TMP to eDHFR recruits eDHFR-fused phase separating proteins to telomeres and induces condensate formation. Because TMP-eDHFR interaction is non-covalent, condensation can be reversed by using excess free TMP to compete with the dimerizer for eDHFR binding. An example of inducing promyelocytic leukemia (PML) nuclear body formation on telomeres and determining condensate growth, dissolution, localization and composition is shown. This method can be easily adapted to induce condensates at other genomic locations by fusing Halo to a protein that directly binds to the local chromatin or to dCas9 that is targeted to the genomic locus with a guide RNA. By offering the temporal resolution required for single cell live imaging while maintaining phase separation in a population of cells for biochemical assays, this method is suitable for probing both the formation and function of chromatin-associated condensates.

Representative images of telomeric localization of SUMO identified by telomere DNA FISH and SUMO protein IF are shown in Figure 2. Cells with SIM recruitment enriched SUMO1 and SUMO 2/3 on telomeres compared to cells with SIM mutant recruitment. This indicates that SIM dimerization-induced SUMO enrichment on telomeres depends on SUMO-SIM interactions.
A representative time lapse movie of TRF1 and SIM after dimerization is shown in Video 1. Snapsho...

Watch this Scientific Journal Video about Chemical Dimerization-Induced Protein Condensates on Telomeres at JoVE.com

Chemical Dimerization-Induced Protein Condensates on Telomeres

This protocol illustrates a chemically induced protein dimerization system to create condensates on chromatin.&#160; The formation of promyelocytic leukemia (PML) nuclear body on telomeres with chemical dimerizers is demonstrated. Droplet growth, dissolution, localization and composition are monitored with live cell imaging, immunofluorescence (IF) and fluorescence in situ hybridization (FISH).

Chromatin-associated condensates are implicated in many nuclear processes, but the underlying mechanisms remain elusive. This protocol describes a ...

chemical-dimerization-induced-protein-condensates-on-telomeres

Research

JoVE Journal

Biology

3.1K Views.  Carnegie Mellon University. This protocol illustrates a chemically induced protein dimerization system to create condensates on chromatin.  The formation of promyelocytic leukemia (PML) nuclear body on telomeres with chemical dimerizers is demonstrated. Droplet growth, dissolution, localization and composition are monitored with live cell imaging, immunofluorescence (IF) and fluorescence in situ hybridization (FISH).

Video: Chemical Dimerization-Induced Protein Condensates on Telomeres

Droplet Digital TRAP (ddTRAP): Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction

The telomere repeat amplification protocol (TRAP) is the most widely used assay to detect telomerase activity within a given a sample. The polymerase chain reaction (PCR)-based method allows for robust measurements of enzyme activity from most cell lysates. The gel-based TRAP with fluorescently labeled primers limits sample throughput, and the ability to detect differences in samples is restricted to two fold or greater changes in enzyme activity. The droplet digital TRAP, ddTRAP, is a highly sensitive approach that has been modified from the traditional TRAP assay, enabling the user to perform a robust analysis on 96 samples per run and obtain absolute quantification of the DNA (telomerase extension products) input within each PCR. Therefore, the newly developed ddTRAP assay overcomes the limitations of the traditional gel-based TRAP assay and provides a more efficient, accurate, and quantitative approach to measuring telomerase activity within laboratory and clinical settings.

Droplet Digital TRAP ddTRAP: Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction

We successfully converted the standard telomere repeat amplification protocol (TRAP) assay to be employed in droplet digital polymerase chain reactions. This new assay, called ddTRAP, is more sensitive and quantitative, allowing for better detection and statistical analysis of telomerase activity within various human cells.

The telomere repeat amplification protocol (TRAP) is the most widely used assay to detect telomerase activity within a given a sample. The polymerase ...

Cancer Research

Creating Highly Specific Chemically Induced Protein Dimerization Systems by Stepwise Phage Selection of a Combinatorial Single-Domain Antibody Library

Protein dimerization events that occur only in the presence of a small-molecule ligand enable the development of small-molecule biosensors for the dissection and manipulation of biological pathways. Currently, only a limited number of chemically induced dimerization (CID) systems exist and engineering new ones with desired sensitivity and selectivity for specific small-molecule ligands remains a challenge in the field of protein engineering. We here describe a high throughput screening method, combinatorial binders-enabled selection of CID (COMBINES-CID), for the de novo engineering of CID systems applicable to a large variety of ligands. This method uses the two-step selection of a phage-displayed combinatorial nanobody library to obtain 1) &#34;anchor binders&#34; that first bind to a ligand of interest and then 2) &#34;dimerization binders&#34; that only bind to anchor binder-ligand complexes. To select anchor binders, a combinatorial library of over 109 complementarity-determining region (CDR)-randomized nanobodies is screened with a biotinylated ligand and hits are validated with the unlabeled ligand by bio-layer interferometry (BLI). To obtain dimerization binders, the nanobody library is screened with anchor binder-ligand complexes as targets for positive screening and the unbound anchor binders for negative screening. COMBINES-CID is broadly applicable to select CID binders with other immunoglobulin, non-immunoglobulin, or computationally designed scaffolds to create biosensors for in vitro and in vivo detection of drugs, metabolites, signaling molecules, etc.

Creating chemically induced protein dimerization systems with desired affinity and specificity for any given small molecule ligand would have many biological sensing and actuation applications. Here, we describe an efficient, generalizable method for de novo engineering of chemically induced dimerization systems via the stepwise selection of a phage-displayed combinatorial single-domain antibody library.

Protein dimerization events that occur only in the presence of a small-molecule ligand enable the development of small-molecule biosensors for the ...

Biochemistry

Single-Molecule Imaging of EWS-FLI1 Condensates Assembling on DNA

The fusion genes resulting from chromosomal translocation have been found in many solid tumors or leukemia. EWS-FLI1, which belongs to the FUS/EWS/TAF15 (FET) family of fusion oncoproteins, is one of the most frequently involved fusion genes in Ewing sarcoma. These FET family fusion proteins typically harbor a low-complexity domain (LCD) of FET protein at their N-terminus and a DNA-binding domain (DBD) at their C-terminus. EWS-FLI1 has been confirmed to form biomolecular condensates at its target binding loci due to LCD-LCD and LCD-DBD interactions, and these condensates can recruit RNA polymerase II to enhance gene transcription. However, how these condensates are assembled at their binding sites remains unclear. Recently, a single-molecule biophysics method-DNA Curtains-was applied to visualize these assembling processes of EWS-FLI1 condensates. Here, the detailed experimental protocol and data analysis approaches are discussed for the application of DNA Curtains in studying the biomolecular condensates assembling on target DNA.

Here, we describe the use of the single-molecule imaging method, DNA Curtains, to study the biophysical mechanism of EWS-FLI1 condensates assembling on DNA.

The fusion genes resulting from chromosomal translocation have been found in many solid tumors or leukemia. EWS-FLI1, which belongs to the FUS/EWS/TAF15 ...

Measuring Ubiquitylated, SUMOylated, and ADP-Ribosylated DNA-Protein Crosslinks

Quantitative Detection of DNA-Protein Crosslinks and Their Post-Translational Modifications

DNA-protein crosslinks (DPCs) are frequent, ubiquitous, and deleterious DNA lesions, which arise from endogenous DNA damage, enzyme (topoisomerases, methyltransferases, etc.) malfunctioning, or exogenous agents such as chemotherapeutics and crosslinking agents. Once DPCs are induced, several types of post-translational modifications (PTMs) are promptly conjugated to them as early response mechanisms. It has been shown that DPCs can be modified by ubiquitin, small ubiquitin-like modifier (SUMO), and poly-ADP-ribose, which prime the substrates to signal their respective designated repair enzymes and, in some cases, coordinate the repair in sequential manners. As PTMs transpire quickly and are highly reversible, it has been challenging to isolate and detect PTM-conjugated DPCs that usually remain at low levels. Presented here is an immunoassay to purify and quantitatively detect ubiquitylated, SUMOylated, and ADP-ribosylated DPCs (drug-induced topoisomerase DPCs and aldehyde-induced non-specific DPCs) in vivo. This assay is derived from the RADAR (rapid approach to DNA adduct recovery) assay that is used for the isolation of genomic DNA containing DPCs by ethanol precipitation. Following normalization and nuclease digestion, PTMs of DPCs, including ubiquitylation, SUMOylation, and ADP-ribosylation, are detected by immunoblotting using their corresponding antibodies. This robust assay can be utilized to identify and characterize novel molecular mechanisms that repair enzymatic and non-enzymatic DPCs&#160;and has the potential to discover small molecule inhibitors targeting specific factors that regulate PTMs to repair DPCs.

Author Spotlight: Quantitative Detection of DNA Protein Crosslinks and Their Post-Translational Modifications  

The present protocol highlights a modified method to detect and quantify DNA-protein crosslinks (DPCs) and their post-translational modifications (PTMs), including ubiquitylation, SUMOylation, and ADP-ribosylation induced by topoisomerase inhibitors and by formaldehyde, thereby allowing the study of the formation and repair of DPCs and their PTMs.

DNA-protein crosslinks (DPCs) are frequent, ubiquitous, and deleterious DNA lesions, which arise from endogenous DNA damage, enzyme (topoisomerases, ...

Studying TRF1/2 Interactions with Telomeric DNA Using Single-Molecule Assay

Analyzing Telomeric Protein-DNA Interactions Using Single-Molecule Magnetic Tweezers

Telomeres, the protective structures at the ends of chromosomes, are crucial for maintaining cellular longevity and genome stability. Their proper function depends on tightly regulated processes of replication, elongation, and damage response. The shelterin complex, especially Telomere Repeat-binding Factor 1 (TRF1) and TRF2, plays a pivotal role in telomere protection and has emerged as a potential anti-cancer target for drug discovery. These proteins bind to the repetitive telomeric DNA motif TTAGGG, facilitating the formation of protective structures and recruitment of other telomeric proteins. Structural methods and advanced imaging techniques have provided insights into telomeric protein-DNA interactions, but probing the dynamic processes requires single-molecule approaches. Tools like magnetic tweezers, optical tweezers, and atomic force microscopy (AFM) have been employed to study telomeric protein-DNA interactions, revealing important details such as TRF2-dependent DNA distortion and telomerase catalysis. However, the preparation of single-molecule constructs with telomeric repetitive motifs continues to be a challenging task, potentially limiting the breadth of studies utilizing single-molecule mechanical methods. To address this, we developed a method to study interactions using full-length human telomeric DNA with magnetic tweezers. This protocol describes how to express and purify TRF2, prepare telomeric DNA, set up single-molecule mechanical assays, and analyze data. This detailed guide will benefit researchers in telomere biology and telomere-targeted drug discovery.

Author Spotlight: Advanced Single-Molecule Techniques for Investigating Telomeric Protein-DNA Interactions

This protocol demonstrates using single-molecule magnetic tweezers to study interactions between telomeric DNA-binding proteins (Telomere Repeat-binding Factor 1 [TRF1] and TRF2) and long telomeres extracted from human cells. It describes the preparatory steps for telomeres and telomeric repeat-binding factors, the execution of single-molecule experiments, and the data collection and analysis methods.

Telomeres, the protective structures at the ends of chromosomes, are crucial for maintaining cellular longevity and genome stability. Their proper ...

Two- and Three-Dimensional Live Cell Imaging of DNA Damage Response Proteins

Double-strand breaks (DSBs) are the most deleterious DNA lesions a cell can encounter. If left unrepaired, DSBs harbor great potential to generate mutations and chromosomal aberrations1. To prevent this trauma from catalyzing genomic instability, it is crucial for cells to detect DSBs, activate the DNA damage response (DDR), and repair the DNA. When stimulated, the DDR works to preserve genomic integrity by triggering cell cycle arrest to allow for repair to take place or force the cell to undergo apoptosis. The predominant mechanisms of DSB repair occur through nonhomologous end-joining (NHEJ) and homologous recombination repair (HRR) (reviewed in2). There are many proteins whose activities must be precisely orchestrated for the DDR to function properly. Herein, we describe a method for 2- and 3-dimensional (D) visualization of one of these proteins, 53BP1.
The p53-binding protein 1 (53BP1) localizes to areas of DSBs by binding to modified histones3,4, forming foci within 5-15 minutes5. The histone modifications and recruitment of 53BP1 and other DDR proteins to DSB sites are believed to facilitate the structural rearrangement of chromatin around areas of damage and contribute to DNA repair6. Beyond direct participation in repair, additional roles have been described for 53BP1 in the DDR, such as regulating an intra-S checkpoint, a G2/M checkpoint, and activating downstream DDR proteins7-9. Recently, it was discovered that 53BP1 does not form foci in response to DNA damage induced during mitosis, instead waiting for cells to enter G1 before localizing to the vicinity of DSBs6. DDR proteins such as 53BP1 have been found to associate with mitotic structures (such as kinetochores) during the progression through mitosis10.
In this protocol we describe the use of 2- and 3-D live cell imaging to visualize the formation of 53BP1 foci in response to the DNA damaging agent camptothecin (CPT), as well as 53BP1's behavior during mitosis. Camptothecin is a topoisomerase I inhibitor that primarily causes DSBs during DNA replication. To accomplish this, we used a previously described 53BP1-mCherry fluorescent fusion protein construct consisting of a 53BP1 protein domain able to bind DSBs11. In addition, we used a histone H2B-GFP fluorescent fusion protein construct able to monitor chromatin dynamics throughout the cell cycle but in particular during mitosis12. Live cell imaging in multiple dimensions is an excellent tool to deepen our understanding of the function of DDR proteins in eukaryotic cells.

This protocol describes a method for visualizing a DNA double-strand break signaling protein activated in response to DNA damage as well as its localization during mitosis.

Double-strand breaks (DSBs) are the most deleterious DNA lesions a cell can encounter. If left unrepaired, DSBs harbor great potential to generate ...

Versatile Biomolecular Condensates from Amphiphilic DNA Nanostars or C-Stars

Synthetic Condensates and Cell-Like Architectures from Amphiphilic DNA Nanostructures

Synthetic droplets and condensates are becoming increasingly common constituents of advanced biomimetic systems and synthetic cells, where they can be used to establish compartmentalization and sustain life-like responses. Synthetic DNA nanostructures have demonstrated significant potential as condensate-forming building blocks owing to their programmable shape, chemical functionalization, and self-assembly behavior. We have recently demonstrated that amphiphilic DNA "nanostars", obtained by labeling DNA junctions with hydrophobic moieties, constitute a particularly robust and versatile solution. The resulting amphiphilic DNA condensates can be programmed to display complex, multi-compartment internal architectures, structurally respond to various external stimuli, synthesize macromolecules, capture and release payloads, undergo morphological transformations, and interact with live cells. Here, we demonstrate protocols for preparing amphiphilic DNA condensates starting from constituent DNA oligonucleotides. We will address (i) single-component systems forming uniform condensates, (ii) two-component systems forming core-shell condensates, and (iii) systems in which the condensates are modified to support in vitro transcription of RNA nanostructures.

Author Spotlight: Developing Synthetic Cells from Programmable Amphiphilic DNA Nanostructures

We present a protocol for preparing synthetic biomolecular condensates consisting of amphiphilic DNA nanostars starting from their constituent DNA oligonucleotides. Condensates are produced from either a single nanostar component or two components and are modified to sustain in vitro transcription of RNA from an embedded DNA template.

Synthetic droplets and condensates are becoming increasingly common constituents of advanced biomimetic systems and synthetic cells, where they can be ...

Bioengineering

Live Cell Single-Molecule Imaging-Based Quantification of Protein Interactions

Single-Molecule Measurement of Protein Interaction Dynamics Within Biomolecular Condensates

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number of cellular functions. Characterizing LLPS in live cells is also important because aberrant condensation has been linked to numerous diseases, including cancers and neurodegenerative disorders. LLPS is often driven by selective, transient, and multivalent interactions between intrinsically disordered proteins. Of great interest are the interaction dynamics of proteins participating in LLPS, which are well-summarized by measurements of their binding residence time (RT), that is, the amount of time they spend bound within condensates. Here, we present a method based on live-cell single-molecule imaging that allows us to measure the mean RT of a specific protein within condensates. We simultaneously visualize individual protein molecules and the condensates with which they associate, use single-particle tracking (SPT) to plot single-molecule trajectories, and then fit the trajectories to a model of protein-droplet binding to extract the mean RT of the protein. Finally, we show representative results where this single-molecule imaging method was applied to compare the mean RTs of a protein at its LLPS condensates when fused and unfused to an oligomerizing domain. This protocol is broadly applicable to measuring the interaction dynamics of any protein that participates in LLPS.

Author Spotlight: Evaluation of Protein-Condensate Dynamics in Live Human Cells

Many intrinsically disordered proteins have been shown to participate in the formation of highly dynamic biomolecular condensates, a behavior important for numerous cellular processes. Here, we present a single-molecule imaging-based method for quantifying the dynamics by which proteins interact with each other in biomolecular condensates in live cells.

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number ...

Single-Molecule Imaging to Visualize Fusion Protein Condensates Assembly on DNA Curtains

Source: Zuo, L. et al., <a href="https://app.jove.com/v/62974">Single-Molecule Imaging of EWS-FLI1 Condensates Assembling on DNA.</a> J. Vis. Exp. (2021)
This video describes a method to visualize the assembly of fusion protein condensates on DNA molecules at specific loci using single-molecule imaging. These condensates are formed due to LCD-LCD and LCD-DBD interactions, which allow for the recruitment of RNA polymerase II and enhanced gene transcription.

Source: Zuo, L. et al., Single-Molecule Imaging of EWS-FLI1 Condensates Assembling on DNA. J. Vis. Exp. (2021)
This video describes a method to visualize ...

JoVE Encyclopedia of Experiments

Biological Techniques

Biomolecular Interaction Detection Techniques

Protein-nucleic acid interactions

Condensins

Condensins are large protein complexes that use ATP to fuel the assembly of chromosomes during mitosis. They transform the tangled, shapeless mass of post-interphase DNA into individualized chromosomes by compacting, organizing, and segregating chromosomal DNA.
The plant and animal cells contain two types of condensin complexes&#8212;condensin I and condensin II. Both complexes have five subunits: two SMC (Structural Maintenance of Chromosomes) subunits, a kleisin subunit, and two HEAT-repeat subunits.
The core subunits of both condensin I and condensin II are SMC2 and SMC4. SMC proteins alter the arrangement of DNA in an ATP-dependent fashion. The other three subunits&#8212;the non-SMC or auxiliary subunits&#8212;differ between the two complexes.
Studies where vertebrate condensin is depleted have shown distinct roles for condensins I and II in mitotic chromosome formation. Condensin II removal results in longer, more flexible chromosomes, chromosome entanglement, bulky chromatin bridging during anaphase, and a drastic shortening of prophase. In contrast, removal of condensin I leads to shorter, wider chromosomes and a disruption of anaphase that is less severe but still results in cytokinesis failure.
A popular explanation for how condensins compact chromosomes is the loop extrusion model. This model posits that a condensin molecule can bind to two nearby DNA sites and slide them in opposite directions, creating a growing DNA loop. Condensins may also interact with one another to form multimers that link distant segments of chromatin.
Condensin mutations have been linked to several types of cancer. For example, mice with a missense mutation in the gene for a condensin II subunit developed T cell lymphomas. While the mechanisms through which condensins influence chromosomal architecture are still being elucidated, these protein complexes are integral to the cell cycle and cell survival.

Condensins and Condensation of Chromosomes

Condensins are large protein complexes that use ATP to fuel the assembly of chromosomes during mitosis. They transform the tangled, shapeless mass of ...