The authors also thank Nicholas Cesari for editing the manuscript. The work was supported by grants from National Institute of Health (S.H., R01DK110108, R01CA204044).

&#8203;1. CTCF sgRNALibrary Design Using an Online Tool
<ol>
	<li>Design the sgRNA targeting CTCF binding sites in the human HOX loci using the genetic perturbation platform (GPP) designer tool (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design).</li>
	<li>Synthesize a total of 1,070 sgRNAs consisting of sgRNAs targeting 303 random targeting genes, 60 positive controls, 500 non-Human-targeting controls, and 207 CTCF elements or lncRNA targeting genes (Figure 1, Table 1). Each targeting DNA element is targeted by 5-10 different sgRNAs.</li>
</ol>
2. sgRNA Library Cloning
<ol>
	<li>Clone the synthesized oligonucleotides into the CRISPR lentiviral backbone vector (lentiCRISPRv2).
	<ol>
		<li>Digest the LentiCRISPRv2 vector with BsmBI restriction enzyme at 37 &#176;C for 2 h.</li>
		<li>Look for the presence of the larger band (around 12,873 bp) on the gel after BsmBI digestion, and then purify it with the gel extraction kit. 
		NOTE: A 2kb small filler piece is also present on the gel after digestion, but this should be ignored.</li>
		<li>Ligate the synthesized oligonucleotides and digested LentiCRISPR vector with 150 ng of digested LentiCRISPR DNA, 1 &#181;L of 10 &#181;M oligos, 2 &#181;L of 10x T4 ligase buffer, 1 &#181;L of T4 ligase, and then incubate them at 16 &#176;C overnight.</li>
	</ol>
	</li>
	<li>Transform the lentiviral CRISPR/sgRNA library into electro-competent cells for amplification.
	<ol>
		<li>Prepare the electroporator at 1.8 kV, 200 &#937; and 25 &#181;F. Then pre-warm the recovery SOC media in a 37 &#176;C water bath, and pre-warm LB ampicillin antibiotic plates at 37 &#176;C.</li>
		<li>Thaw the competent cells on ice for 10 min.</li>
		<li>Prepare 1.5 mL micro-centrifuge tubes and 1 mm electroporation cuvettes on ice.</li>
		<li>Mix 1 &#181;L of a 10 ng/&#181;L library plasmid DNA into 25 &#181;L of competent cells in a 1.5 mL micro-centrifuge tube, and gently mix by flicking the bottom of the tube a few times manually.</li>
		<li>Once the cuvette is cold enough, transfer the DNA/competent cell mixture to it. Tap twice on the countertop and wipe any water droplets from the exterior of cuvette with a tissue paper. Then place the cuvette in the electroporation module and press pulse.</li>
		<li>Immediately add 975 &#181;L of 37 &#176;C pre-warmed SOC media. Mix by pipetting up and down and transfer to a 15 mL tube.</li>
		<li>Rotate and incubate at 37 &#176;C for 1 h.</li>
		<li>Dilute 100 &#181;L cells into 900 &#181;L of SOC media and place 100 &#181;L on a LB ampicillin antibiotic agar plate. Incubate overnight at 37 &#176;C.</li>
	</ol>
	</li>
	<li>Extract the plasmid DNA from the combined colonies using a maxi-prep column as detailed in the manufacturer&#39;s protocol.
	<ol>
		<li>Scrape all the colonies from the LB agar plate and inoculate a starter culture of 2 mL of LB ampicillin antibiotic medium and incubate overnight at 37 &#176;C with vigorous shaking (~200 x g).</li>
		<li>Dilute the starter culture 1:500 into 100 mL of LB ampicillin medium and incubate at 37 &#176;C for 12-16 h with vigorous shaking (~200 x g).</li>
		<li>Harvest the bacterial cell pellet by centrifugation at 6,000 x g for 15 min at 4 &#176;C.</li>
		<li>Re-suspend the bacterial pellet in 10 mL of suspension buffer.</li>
		<li>Lyse the suspended pellet with 10 mL of the lysis buffer, and vigorously invert 4-6 times. Incubate the lysate for 5 min at room temperature.</li>
		<li>Neutralize the lysate with 10 mL of chilled Neutralization Buffer. Mix by gently inverting the tubes 4-6 times and incubate it for 20 min on ice.</li>
		<li>Spin down at 13,500 x g for 30 min at 4 &#176;C. Promptly transfer the supernatant containing the plasmid DNA to a new tube.</li>
		<li>Repeat step 2.3.7, and promptly transfer the supernatant containing the plasmid DNA to a new tube.</li>
		<li>Equilibrate the column by applying 10 mL of equilibration buffer and allow the column to empty by gravity flow.</li>
		<li>Add the supernatant to the column and allow it to enter the resin by gravity flow.</li>
		<li>Wash the column with 2x 30 mL of washing buffer.</li>
		<li>Elute the DNA with 15 mL of elution buffer.</li>
		<li>Precipitate the DNA with 10.5 mL of room-temperature isopropanol to the eluted DNA. Mix and spin down immediately at 15,000 x g for 30 min at 4 &#176;C, and gently decant the supernatant.</li>
		<li>Wash the DNA pellet with 5 mL of 70% ethanol, centrifuge DNA pellet at 15,000 x g for 10 min and discard the clear supernatant.</li>
		<li>Repeat step 2.5.14 twice more.</li>
		<li>Centrifuge DNA pellet at 15,000 x g for 10 min, and gently decant the supernatant without disturbing the DNA pellet.</li>
		<li>Air-dry the pellet for 5-10 min, and dissolve the DNA in a required volume of buffer (TE buffer, pH 8.0).</li>
	</ol>
	</li>
</ol>
3. The High Titer sgRNA Library Lentivirus Generation
<ol>
	<li>Cell preparation: Culture HEK293T cells in Dulbecco&#39;s Modified Eagle Medium (DMEM) supplemented with 10% (vol/vol) fetal bovine serum (FBS) and 1% (vol/vol) penicillin-streptomycin (PS) antibiotic in T-25 flasks. Place them in the incubator at 37 &#176;C and 5% CO2.</li>
	<li>Package lentivirus: Co-transfect HEK293T cells with 20 &#181;g of purified library vectors from step 2, 15 &#181;g of the package plasmid (psPAX2) and 10 &#181;g of the envelope plasmid (pMD2.G) for 48 h before harvesting the viruses.</li>
	<li>Virus collection: After 48 h, collectthe virus supernatant and filter the virus supernatant through a 0.45 &#181;m low protein binding PVDF membrane.</li>
	<li>Virus concentration: Concentrate the lentiviral supernatant by 50-fold using the concentrator and test the virus MOI in step 5.</li>
	<li>Virus storage: Aliquot the concentrated viruses and store in a -80 &#176;C freezer.</li>
</ol>
4. Optimized Puromycin Concentration
<ol>
	<li>Leukemia cell culture: Culture MOLM13 AML cells in RPMI 1640 supplemented with 10% (vol/vol) fetal bovine serum (FBS) and 1x penicillin-streptomycin (PS) antibiotics in a T-125 flask. Place them in an incubator at 37 &#176;C and 5% CO2. 
	NOTE: Cells are typically passed every 4-5 d at a split ratio of 1:4 or 1:6, never allowing cells to reach more than 70% confluency.</li>
	<li>Set up MOLM13 cells in a 12-well plate with a density of 1.0 x 104 cell/mL, at a total volume of 2 mL per well (2.0 x 104 cells).</li>
	<li>Time-course assay: Treat MOLM13 cells with puromycin for 7 days in increasing concentrations (0.1 &#181;g/mL, 0.2 &#181;g/mL, 0.5 &#181;g/mL, 1.0 &#181;g/mL and 2.0 &#181;g/mL)
	<ol>
		<li>Set up MOLM13 cells without puromycin treatment on day 0 and set up 3 replicate wells without puromycin treatment as a control from day 0 to day 7.</li>
		<li>Treat MOLM13 cells with 0.1 &#181;g/mL, 0.2 &#181;g/mL, 0.5 &#181;g/mL, 1.0 &#181;g/mL and 2.0 &#181;g/mL, separately, with each experimental condition containing 3 replicate wells.</li>
		<li>Count the live cell ratio and make a survival curve from day 0 to day 7 containing all conditions.</li>
	</ol>
	</li>
	<li>Survival curve: Stain cells with Trypan blue and count viability daily to obtain the survival curves for each puromycin concentration.</li>
	<li>Optimizing minimal puromycin concentration: Determine the minimal puromycin concentration through Trypan blue staining, in which all MOLM13 cells are killed between 5-7 days.</li>
</ol>
5. Titration of Lentiviral Library in MOLM13 Leukemia Cells
<ol>
	<li>AML cells preparation: Collect MOLM13 AML cells with the transduction medium (RPMI 1640, 10% FBS, 1% PS, and 8.0 &#181;g/mL coating medium) at a density of 1.5 x 106 cells /mL.</li>
	<li>Place MOLM13 cells in the 12-well plate with 1.5 x 106 cells in each well.</li>
	<li>Thaw the lentivirus: Remove the concentrated lentivirus from the -80 &#176;C freezer and thaw it on ice.</li>
	<li>Mix MOLM13 cells with a different dose of the concentrated lentivirus in separate wells, including 0, 1, 2.5, 5, 7.5 and 10 &#181;L (total 6 groups).</li>
	<li>Immediately centrifuge these mixtures at 1,000 x g for 2 h at 33 &#176;C and transfer the 12-well plates back to the incubator at 37 &#176;C and 5% CO2 for 4 h.</li>
	<li>After 4 h, spin down the infected cells at 400 x g for 5 min at room temperature.</li>
	<li>Gently aspirate the supernatant without disturbing the cell pellet, and re-suspend the transduced cells with fresh media (RPMI 1640, 10% FBS and 1% PS), and then transfer them to T-25 flasks and incubate at 37 &#176;C for 48 h without puromycin.</li>
	<li>After 48 h, split these cells into 2 flasks (2 groups): an experimental group treated with 1 &#181;g/mL puromycin for 5 days, and a control group without puromycin treatment for 5 days.</li>
	<li>Carry out puromycin selection for 5 days with 1 &#181;g/mL puromycin according to the step 4 until all the non-transduced control cells are dead. Exchange for fresh media every 2 days.</li>
	<li>Measure the optimized MOI value for transduction by dividing the number of live cells treated with puromycin with the number of cells without puromycin treatment.</li>
</ol>
6. Transduction of the Pooled CRISPR-Cas9 KO Library
<ol>
	<li>Transduction with lentivirus: Infect 1.5 x 106 MOLM13 cells with 0.3 MOI of sgRNA pooled lentivirus in medium (RPMI 1640, 10% FBS, 1% PS, and 8 &#181;g/mL coating medium) in 6-well plate and use the cells without the lentivirus infection as a control.</li>
	<li>Immediately centrifuge the 6-well plate at 1,000 x g for 2 h at 33 &#176;C to spinfect the cells and transfer the plates back to the incubator at 37 &#176;C and 5% CO2 for 4 h.</li>
	<li>Spin down the infected cells at 400 x g for 5 min at room temperature.</li>
	<li>Gently aspirate supernatant without disturbing the cell pellet, and re-suspend the transduced cells with fresh media (RPMI 1640, 10% FBS and 1% PS), and then transfer them to T-25 flasks and incubate at 37 &#176;C for 48 h without puromycin.</li>
	<li>After 48 h, treat cells with 1 &#181;g/mL puromycin for 5 days. Exchange for fresh media after 2 days and keep at an optimal cell density.</li>
	<li>Seed the single clone in 96-well plates with limiting dilution methods and incubate these single clones at 37 &#176;C and 5% CO2. Culture them for 3-4 weeks.</li>
	<li>After a single cell grows up into a population, transfer half of the cells into 24-well plates for further culture under puromycin selection and verify these clones in the next step. Keep the rest of the cells.</li>
</ol>
7. Screening of the Pooled CRISPR-Cas9 KO Library with One-step RT-qPCR
<ol>
	<li>Determine the effectiveness of the sgRNA integrated clone screening by evaluating the expression of the marker gene HOXA9 with one step reverse-transcriptase polymerase chain reaction (one-step RT-qPCR). 
	NOTE: HOXA9 are highly expressed in MOLM13 AML cells in leukemogenesis22,23.</li>
	<li>Count the sgRNA integrated MOLM13 cell and transfer 1 x 104 cells per well to a 96-well PCR plate.</li>
	<li>Centrifuge the tube at 1,000 x g for 5 min, and then thoroughly remove and discard the supernatant with a pipet without disturbing the cell pellet.</li>
	<li>Wash cells with 125 &#181;L of PBS buffer, and centrifuge the tube at 1,000 x g for 5 min. Then remove 120 &#181;L of the supernatant using a pipette and retain approximately 5 &#181;L of PBS in each well.</li>
	<li>Add 50 &#181;L of the cell lysis master mix containing 48 &#181;L of cell lysis buffer, 1 &#181;L of proteinase K solution (10 mg/mL) and 1 &#181;L of DNase solution (1 mg/mL) to each well. Then pipet up and down 5 times to re-suspend the cell pellet.</li>
	<li>Incubate the mix for 10 min at room temperature, followed by 5 min at 37 &#176;C, and then 75 &#176;C for 5 min.</li>
	<li>Store the cell lysate at -80 &#176;C freezer.</li>
	<li>The preparation of one-step RT-qPCR reaction: Thaw the one-step reaction mix and other reaction components to 4 &#176;C. Then spin down briefly to collect solutions at the bottom of tubes, and place on ice without light. Mix and spin gently.</li>
	<li>Add 1 &#181;L of cell lysate to the PCR wells with the RT-qPCR reaction mix, including 1 &#181;L of the marker gene&#39;s forward primer (300 nM) and reverse primer (300 nM), 0.125 &#181;L of reverse transcriptase (10 U/&#181;L), and 5 &#181;L of one-step reaction mix (2x).</li>
	<li>Seal wells with optically transparent film, and gently vortex and mix the reaction components.</li>
	<li>Place the 96-well PCR plate on a real-time PCR instrument.</li>
	<li>Run the reverse transcription reaction for 10 min at 50 &#176;C, followed by polymerase inactivation and DNA denaturation for 1 min at 95 &#176;C.</li>
	<li>Perform RT-PCR with 40 cycles of PCR reaction: denaturation for 15 s at 95 &#176;C, annealing/extension and plate fluorescence reading for 20 s at 60 &#176;C, and then melt curve analysis at 65-95 &#176;C via 0.5 &#176;C increments at 2-5 s/step.</li>
	<li>Set up upregulated, downregulated and no change groups according to the expression levels of HOXA9 gene by comparison to the control, separately. Use &#946;-actin gene as a housekeeping gene control.</li>
</ol>
8. Verification of Integrated sgRNAs Positive Clones through Genotyping and Sanger Sequence
<ol>
	<li>Verify the HOXA9 decreased expression clones through Sanger sequencing and perform PCR with 50-100 ng MOLM13 genome DNA, 5 &#181;L polymerase reaction buffer (10x), 1 &#181;L forward primer (10 &#181;M) (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG) and 1 &#181;L reverse primer (10 &#181;M) (TCTACTATTCTTTCCCCTGCACTGTTGTGGGCGATGTGCGCTCTG), 1 &#181;L dNTP (10mM), 1 unit polymerase (5 U /&#181;L). Perform the PCR reaction with the initial denaturation at 94 &#176;C for 30 s, and then more denaturation at 94 &#176;C for 20 s, annealing at 56 &#176;C for 20 s, extension at 68 &#176;C for 20 s (total 30 cycles), final extension at 68 &#176;C for 10 min, and then holding at 4 &#176;C.</li>
	<li>Extract and purify the PCR products (size 285 bp) with a PCR Purification Kit.</li>
	<li>Ligate the purified PCR products into the T vector with 2 &#181;L T4 ligation buffer (10x), 50 ng T vector DNA (50 ng/&#181;L), 25 ng purified PCR DNA (285 bp), 1 &#181;L T4 ligase (3 units/&#181;L), and place the ligation mix into an incubator at 16 &#176;C overnight.</li>
	<li>Transfer the ligation mix into DH5&#945; competent cell, grow on a LB ampicillin antibiotic agar plate, and incubate overnight at 37 &#176;C.</li>
	<li>Pick the single clones from the LB plate and verify them by genotyping and Sanger sequencing.</li>
</ol>
9. Detection of sgRNAs Induced Indel Mutation by Nuclease Digestion Assay
<ol>
	<li>Detect the sgRNA integrated single clone induced Indel rates by a nuclease test assay.</li>
	<li>Separately prepare PCR amplicons with 50-100 ng Indel mutant (test) and wild-type (WT, reference) DNA as PCR template, 5 &#181;L polymerase reaction buffer (10x), 1 &#181;L dNTP (10mM), 1 unit polymerase (5 U/&#181;L), 1 &#181;L forward primer (10 &#181;M)( 5&#39;-GAGATGGCGGCGCGGAAG-3&#39;), and 1 &#181;L reverse primer (10 &#181;M) (5&#39;-AAATATAGGGCGGCTGTTCACT-3&#39;). The PCR reaction was performed with initial denaturation at 98 &#176;C for 30 s, and then denaturation at 98 &#176;C for 20 s, annealing at 56 &#176;C for 20 s, extension at 72 &#176;C for 30 s (total 30 cycles), and final extension at 72 &#176;C for 10 min, and holding at 4 &#176;C.</li>
	<li>Set up the heteroduplex mixture group with 200 ng of the &#34;reference&#34; (20 ng/&#181;L) and 200 ng of &#34;test&#34; (20 ng/&#181;L) PCR amplicons in 0.2 mL PCR tube, and the homoduplex mixture group with only 400 ng of &#34;reference&#34; PCR amplicons as a control.</li>
	<li>Separately incubate the heteroduplex and homoduplex mixture at 95 &#176;C for 5 min in a 1 L beaker filled with 800 mL of water and then cool down gradually to room temperature to anneal and form heteroduplex or homoduplexes.</li>
	<li>Separately digest 400 ng of the annealed heteroduplex and homoduplex mixture with 1 &#181;L indel mutation detection nuclease (2.5 U/&#181;L) and 2 &#181;L nuclease reaction buffer (10x) at 42 &#176;C for 60 min.</li>
	<li>Analyze the digested samples with agarose gel electrophoresis, the heteroduplex mixture DNA should be cut into small fragments (70-250 bp), and the homoduplex DNA (320 bp) should not be cut.</li>
</ol>

<ol>
	<li>Dixon, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Topological+domains+in+mammalian+genomes+identified+by+analysis+of+chromatin+interactions.">Topological domains in mammalian genomes identified by analysis of chromatin interactions.</a> Nature. 485 (7398), 376-380 (2012).</li><li>Cuddapah, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+analysis+of+the+insulator+binding+protein+CTCF+in+chromatin+barrier+regions+reveals+demarcation+of+active+and+repressive+domains.">Global analysis of the insulator binding protein CTCF in chromatin barrier regions reveals demarcation of active and repressive domains.</a> Genome research. 19 (1), 24-32 (2009).</li><li>Phillips, J. E., Corces, V. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF:+master+weaver+of+the+genome.">CTCF: master weaver of the genome.</a> Cell. 137 (7), 1194-1211 (2009).</li><li>Tang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF-Mediated+Human+3D+Genome+Architecture+Reveals+Chromatin+Topology+for+Transcription.">CTCF-Mediated Human 3D Genome Architecture Reveals Chromatin Topology for Transcription.</a> Cell. 163 (7), 1611-1627 (2015).</li><li>Lupianez, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disruptions+of+topological+chromatin+domains+cause+pathogenic+rewiring+of+gene-enhancer+interactions.">Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions.</a> Cell. 161 (5), 1012-1025 (2015).</li><li>Dowen, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+cell+identity+genes+occurs+in+insulated+neighborhoods+in+mammalian+chromosomes.">Control of cell identity genes occurs in insulated neighborhoods in mammalian chromosomes.</a> Cell. 159 (2), 374-387 (2014).</li><li>Phillips-Cremins, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architectural+protein+subclasses+shape+3D+organization+of+genomes+during+lineage+commitment.">Architectural protein subclasses shape 3D organization of genomes during lineage commitment.</a> Cell. 153 (6), 1281-1295 (2013).</li><li>Narendra, V., Bulajic, M., Dekker, J., Mazzoni, E. O., Reinberg, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF-mediated+topological+boundaries+during+development+foster+appropriate+gene+regulation.">CTCF-mediated topological boundaries during development foster appropriate gene regulation.</a> Genes &amp; Development. 30 (24), 2657-2662 (2016).</li><li>Narendra, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+establishes+discrete+functional+chromatin+domains+at+the+Hox+clusters+during+differentiation.">CTCF establishes discrete functional chromatin domains at the Hox clusters during differentiation.</a> Science. 347 (6225), 1017-1021 (2015).</li><li>Deng, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HoxBlinc+RNA+Recruits+Set1/MLL+Complexes+to+Activate+Hox+Gene+Expression+Patterns+and+Mesoderm+Lineage+Development.">HoxBlinc RNA Recruits Set1/MLL Complexes to Activate Hox Gene Expression Patterns and Mesoderm Lineage Development.</a> Cell Reports. 14 (1), 103-114 (2016).</li><li>Patel, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aberrant+TAL1+activation+is+mediated+by+an+interchromosomal+interaction+in+human+T-cell+acute+lymphoblastic+leukemia.">Aberrant TAL1 activation is mediated by an interchromosomal interaction in human T-cell acute lymphoblastic leukemia.</a> Leukemia. 28 (2), 349-361 (2014).</li><li>Luo, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+boundary+remodels+chromatin+domain+and+drives+aberrant+HOX+gene+transcription+in+acute+myeloid+leukemia.">CTCF boundary remodels chromatin domain and drives aberrant HOX gene transcription in acute myeloid leukemia.</a> Blood. 132 (8), 837-848 (2018).</li><li>Dou, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Medial+HOXA+genes+demarcate+haematopoietic+stem+cell+fate+during+human+development.">Medial HOXA genes demarcate haematopoietic stem cell fate during human development.</a> Nature Cell Biology. 18 (6), 595-606 (2016).</li><li>Lawrence, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+expression+of+the+Hoxa-9+homeobox+gene+impairs+the+proliferation+and+repopulating+ability+of+hematopoietic+stem+cells.">Loss of expression of the Hoxa-9 homeobox gene impairs the proliferation and repopulating ability of hematopoietic stem cells.</a> Blood. 106 (12), 3988-3994 (2005).</li><li>Deng, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=USF1+and+hSET1A+mediated+epigenetic+modifications+regulate+lineage+differentiation+and+HoxB4+transcription.">USF1 and hSET1A mediated epigenetic modifications regulate lineage differentiation and HoxB4 transcription.</a> PLOS Genetics. 9 (6), e1003524 (2013).</li><li>Rawat, V. P., Humphries, R. K., Buske, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beyond+Hox:+the+role+of+ParaHox+genes+in+normal+and+malignant+hematopoiesis.">Beyond Hox: the role of ParaHox genes in normal and malignant hematopoiesis.</a> Blood. 120 (3), 519-527 (2012).</li><li>Alharbi, R. A., Pettengell, R., Pandha, H. S., Morgan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+HOX+genes+in+normal+hematopoiesis+and+acute+leukemia.">The role of HOX genes in normal hematopoiesis and acute leukemia.</a> Leukemia. 27 (5), 1000-1008 (2013).</li><li>Rice, K. L., Licht, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HOX+deregulation+in+acute+myeloid+leukemia.">HOX deregulation in acute myeloid leukemia.</a> Journal of Clinical Investigation. 117 (4), 865-868 (2007).</li><li>Bassett, A. R., Kong, L., Liu, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genome-wide+CRISPR+library+for+high-throughput+genetic+screening+in+Drosophila+cells.">A genome-wide CRISPR library for high-throughput genetic screening in Drosophila cells.</a> Journal of Genetics and Genomics. 42 (6), 301-309 (2015).</li><li>Zhu, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+deletion+screening+of+human+long+non-coding+RNAs+using+a+paired-guide+RNA+CRISPR-Cas9+library.">Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library.</a> Nature Biotechnology. 34 (12), 1279-1286 (2016).</li><li>Kurata, J. S., Lin, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA-focused+CRISPR-Cas9+library+screen+reveals+fitness-associated+miRNAs.">MicroRNA-focused CRISPR-Cas9 library screen reveals fitness-associated miRNAs.</a> RNA. 24 (7), 966-981 (2018).</li><li>Collins, C. T., Hess, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+HOXA9+in+leukemia:+dysregulation,+cofactors+and+essential+targets.">Role of HOXA9 in leukemia: dysregulation, cofactors and essential targets.</a> Oncogene. 35 (9), 1090-1098 (2016).</li><li>Kroon, E., Thorsteinsdottir, U., Mayotte, N., Nakamura, T., Sauvageau, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NUP98-HOXA9+expression+in+hemopoietic+stem+cells+induces+chronic+and+acute+myeloid+leukemias+in+mice.">NUP98-HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice.</a> The EMBO Journal. 20 (3), 350-361 (2001).</li><li>Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+recessive+genetic+screening+in+mammalian+cells+with+a+lentiviral+CRISPR-guide+RNA+library.">Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library.</a> Nature Biotechnology. 32 (3), 267-273 (2014).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+screens+in+human+cells+using+the+CRISPR-Cas9+system.">Genetic screens in human cells using the CRISPR-Cas9 system.</a> Science. 343 (6166), 80-84 (2014).</li><li>Zhou, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+sgRNAs+facilitate+CRISPR/Cas9-mediated+mouse+genome+targeting.">Dual sgRNAs facilitate CRISPR/Cas9-mediated mouse genome targeting.</a> The FEBS Journal. 281 (7), 1717-1725 (2014).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+interrogation+of+functional+elements+in+the+noncoding+genome.">High-resolution interrogation of functional elements in the noncoding genome.</a> Science. 353 (6307), 1545-1549 (2016).</li><li>Rajagopal, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+mapping+of+regulatory+DNA.">High-throughput mapping of regulatory DNA.</a> Nature Biotechnology. 34 (2), 167-174 (2016).</li><li>Korkmaz, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genetic+screens+for+enhancer+elements+in+the+human+genome+using+CRISPR-Cas9.">Functional genetic screens for enhancer elements in the human genome using CRISPR-Cas9.</a> Nature Biotechnology. 34 (2), 192-198 (2016).</li><li>Rezaei, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMS-Like+Tyrosine+Kinase+3+(FLT3)+and+Nucleophosmin+1+(NPM1)+in+Iranian+Adult+Acute+Myeloid+Leukemia+Patients+with+Normal+Karyotypes:+Mutation+Status+and+Clinical+and+Laboratory+Characteristics.">FMS-Like Tyrosine Kinase 3 (FLT3) and Nucleophosmin 1 (NPM1) in Iranian Adult Acute Myeloid Leukemia Patients with Normal Karyotypes: Mutation Status and Clinical and Laboratory Characteristics.</a> Turkish Journal of Haematology. 34 (4), 300-306 (2017).</li><li>Yaragatti, M., Basilico, C., Dailey, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+active+transcriptional+regulatory+modules+by+the+functional+assay+of+DNA+from+nucleosome-free+regions.">Identification of active transcriptional regulatory modules by the functional assay of DNA from nucleosome-free regions.</a> Genome Research. 18 (6), 930-938 (2008).</li><li>Wilken, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNase+I+hypersensitivity+analysis+of+the+mouse+brain+and+retina+identifies+region-specific+regulatory+elements.">DNase I hypersensitivity analysis of the mouse brain and retina identifies region-specific regulatory elements.</a> Epigenetics Chromatin. 8, 8 (2015).</li><li>Narlikar, L., Ovcharenko, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+regulatory+elements+in+eukaryotic+genomes.">Identifying regulatory elements in eukaryotic genomes.</a> Briefings in Functional Genomics and Proteomics. 8 (4), 215-230 (2009).</li><li>Hnisz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+proto-oncogenes+by+disruption+of+chromosome+neighborhoods.">Activation of proto-oncogenes by disruption of chromosome neighborhoods.</a> Science. 351 (6280), 1454-1458 (2016).</li></ol>

We have no conflicts of interest related to this report.

Protein-coding gene related sgRNA libraries have been applied in a functional screening system to identifying genes and networks regulating specific cellular functions through sgRNA enrichment24,25,26,27,28. Several non-coding region related sgRNA libraries were also shown in gene-specific functional screens for distal and proximal regulating elements, includi...

Recent genome interaction studies revealed that the human nuclear genome forms stable topologically associating domains (TADs) that are conserved across cell types and species. The organization of the genome into separate domains facilitates and restricts interactions between regulatory elements (e.g., enhancers and promoters). The CCCTC-binding factor (CTCF) binds to TAD boundaries and plays a critical role in constraining interactions of DNA elements that are located in neighboring TADs1. However, genome wide CTCF binding data revealed that although CTCF mostly interacts with the same DNA-sites in different cell types, it often functions as a chromatin barrier at a specific site in one cell type but not in the other, suggesting that CTCF functions together with other activities in the formation of chromatin boundaries2. What remains unknown is whether the boundary elements (CTCF-binding sites) are directly linked to the biological function of CTCF, and how these links occur. Therefore, we hypothesize that specific CTCF binding sites in the genome directly regulate the formation of TADs and control promoter/enhancer interactions within these domains or between neighboring domains. The completion of the human and mouse genome sequencing projects and subsequent epigenetic analyses have uncovered new molecular and genetic signatures of the genome. However, the role of specific signatures/modifications in gene regulation and cellular function, as well as their molecular mechanism(s), have yet to be fully understood.
Multiple lines of evidence support that the CTCF-mediated TADs represent functional chromatin domains3,4,5. Although CTCF mostly interacts with the same DNA-sites in different cell types, genome wide CTCF ChIP-seq data revealed that CTCF often functions as a chromatin barrier in one cell type but not in the other2. CTCF plays an essential role during development by mediating genome organization4,6,7. Disruption of CTCF boundaries impaired enhancer/promoter interactions and gene expression, leading to developmental blockage. This suggests that CTCF mediated TADs are not only structural components, but also regulatory units required for proper enhancer action and gene transcription5,8,9.
HOX genes play critical roles during embryonic development and they are temporally and spatially restricted in their expression patterns. The HOXA locus forms two stable TADs separating anterior and posterior genes by a CTCF-associated boundary element in both hESCs and IMR90 cells1. Recent reports demonstrated that HoxBlinc, a HoxB locus associated lncRNA, mediates the formation of CTCF directed TADs and enhancer/promoter interactions in the HOXB locus. This leads to anterior HOXB gene activation during ESC commitment and differentiation10. Furthermore, at specific gene loci including the HOXA locus, alteration of CTCF mediated TAD domains changed lineage specific gene expression profiles and was associated with the development of disease states11,12. The evidence supports a primary function for CTCF in coordinating gene transcription and determining cell identity by organizing the genome into functional domains.
Despite its role in the embryonic development, during hematopoiesis, HOX genes regulate hematopoietic stem and progenitor cell (HS/PC) function. This is done by controlling the balance between proliferation and differentiation10,13,14,15. The expression of HOX genes is tightly regulated throughout the specification and differentiation of hematopoietic cells, with highest expression in HS/PCs. HOX gene expression gradually decreases during maturation, with its lowest levels occurring in differentiated hematopoietic cells16. HOX gene dysregulation is a dominant mechanism of leukemic transformation by dysregulating self-renewal and differentiation properties of HS/PCs leading to leukemic transformation17,18. However, the mechanism of establishing and maintaining normal vs. oncogenic expression patterns of HOX genes as well as associated regulatory networks remains unclear.
CRISPR-Cas9 sgRNA library screening has been widely used to interrogate protein-coding genes19 as well as non-coding genes, such as lncRNA20 and miRNA21 in different species. However, the cost to use the CRISPR-Cas9 sgRNA library to identify new genomic targets remains high, because high-throughput genome sequencing is often applied to verify the sgRNA library screening. Our sgRNA screening system is focused on the specific genome loci and evaluates the targeting sgRNAs through one-step RT-PCR according to the marker gene expression, such as HOXA9. Additionally, Sanger sequencing confirmed that the sgRNA was integrated into the genome, and Indel mutations can be detected to identify the sgRNA targeting site. Through the loci-specific CRISPR-Cas9 genetic screening, the CBS7/9 chromatin boundary has been identified as a critical regulator for establishing oncogenic chromatin domain and maintaining ectopic HOX gene expression patterns in AML pathogenesis12. The method can be widely applied to identify not only specific function of CTCF boundary in embryonic development, hematopoiesis, leukemogenesis, but also CTCF boundary as potential therapeutic targets for future epigenetic therapy.

<table border="0" cellpadding="0" cellspacing="0" style="width:689px;" width="689">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Lipofectamine 3000 reagent</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:100px;">L3000-008</td>
			<td style="width:172px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K</td>
			<td>Thermo Fisher Scientific</td>
			<td>25530049</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Puromycin</td>
			<td>Thermo Fisher Scientific</td>
			<td>A1113802</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stbl3 cells&#160;</td>
			<td>Life Technologies</td>
			<td>&#160;C737303</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HEK293T</td>
			<td>ATCC</td>
			<td>CRL-3216</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MOLM-13</td>
			<td>DSMZ</td>
			<td>ACC 554</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">lentiCRISPRv2</td>
			<td>Addgene</td>
			<td>52961</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pMD2.G</td>
			<td>Addgene</td>
			<td>12259</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">psPAX2</td>
			<td>Addgene</td>
			<td>12260</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pGEM&#174;-T Easy Vector Systems&#160;</td>
			<td>Promega</td>
			<td>A137A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T4 ligase&#160;</td>
			<td>New England Biolabs</td>
			<td>&#160;M0202S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAquick Gel Extract kit</td>
			<td>QIAGEN</td>
			<td>28706</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAuick PCR purification kit</td>
			<td>QIAGEN</td>
			<td>28106</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SingleShot&#8482; SYBR&#174;&#160;Green One-Step Kit</td>
			<td>Bio-Rad Laboratories</td>
			<td>1725095</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">QIAGEN Plasmid Maxi Kit</td>
			<td>QIAGEN</td>
			<td style="width:100px;">12163</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dulbecco&#8217;s Modified Eagle Medium&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">&#160;11965084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RPMI 1640&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">11875093</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fetal bovine serum (FBS)&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">10-082-147</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/streptomycin/L-glutamine&#160;</td>
			<td>Life Technologies&#160;</td>
			<td style="width:100px;">10378016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lenti-X Concentrator&#160;</td>
			<td style="width:155px;">Clontech</td>
			<td style="width:100px;">631232</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Trypan Blue Solution</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">15250061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Polybrene</td>
			<td style="width:155px;">Santa Cruz Biotechnology</td>
			<td>sc-134220</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Phosphate Buffered Saline (PBS)&#160;</td>
			<td style="width:155px;">Genessee Scientific</td>
			<td>&#160;25-507</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">TAE buffer&#160;</td>
			<td style="width:155px;">Thermo Fisher Scientific&#160;</td>
			<td>FERB49</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Surveyor&#174; Mutation Detection Kits</td>
			<td style="width:155px;">Integrated DNA Technologies</td>
			<td style="width:100px;">706020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Biorad Universal Hood II Gel Doc System</td>
			<td style="width:155px;">Bio-Rad</td>
			<td style="width:100px;">170-8126</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Centrifuge 5424 R</td>
			<td style="width:155px;">Eppendorf</td>
			<td style="width:100px;">5404000138</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Digital Dry Baths/Block Heaters</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">88870002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">TSX Series Ultra-Low Freezers</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">TSX40086V</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Forma&#8482; Steri-Cult&#8482; CO2&#160;Incubators</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">3308</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Herasafe&#8482; KS, Class II Biological Safety Cabinet</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">51022484</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Sorvall&#8482; Legend&#8482; XT/XF Centrifuge Series</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">75004506</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Fisherbrand&#8482;&#160;Isotemp&#8482; Water Baths</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">FSGPD02</td>
			<td></td>
		</tr>
		<tr height="32">
			<td height="32" style="height:32px;width:263px;">Thermo Scientific&#8482;&#160;Locator&#8482; Plus Rack and Box Systems</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">13-762-353</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">CFX96 Touch Real-Time PCR Detection System</td>
			<td style="width:155px;">Bio-Rad</td>
			<td style="width:100px;">1855195</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">MiniAmp&#8482; Thermal Cycler</td>
			<td style="width:155px;">Applied Biosystems technology</td>
			<td style="width:100px;">A37834</td>
			<td></td>
		</tr>
		<tr height="32">
			<td height="32" style="height:32px;width:263px;">Thermo Scientific&#8482;&#160;Owl&#8482; EC300XL2 Compact Power Supply</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">7217581</td>
			<td></td>
		</tr>
		<tr height="32">
			<td height="32" style="height:32px;width:263px;">Thermo Scientific&#8482;&#160;Owl&#8482; EasyCast&#8482; B1 Mini Gel Electrophoresis Systems</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:100px;">09-528-178</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">VWR&#174; Tube Rotator and Rotisseries</td>
			<td style="width:155px;">VWR International</td>
			<td style="width:100px;">10136-084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">VWR&#174; Incubating Mini Shaker</td>
			<td style="width:155px;">VWR International</td>
			<td style="width:100px;">12620-942</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Analytical Balance MS104TS/00</td>
			<td style="width:155px;">METTLER TOLEDO</td>
			<td style="width:100px;">30133522</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">DS-11 FX and DS-11 FX+ Spectrophotometer</td>
			<td style="width:155px;">DeNovix Inc.</td>
			<td style="width:100px;">DS-11 FX</td>
			<td></td>
		</tr>
	</tbody>
</table>

hox loci focused crispr/sgrna library screening identifying critical ctcf boundaries

CCCTC-binding factor (CTCF)-mediated stable topologically associating domains (TADs) play a critical role in constraining interactions of DNA elements that are located in neighboring TADs. CTCF plays an important role in regulating the spatial and temporal expression of HOX genes that control embryonic development, body patterning, hematopoiesis, and leukemogenesis. However, it remains largely unknown whether and how HOX loci associated CTCF boundaries regulate chromatin organization and HOX gene expression. In the current protocol, a specific sgRNA pooled library targeting all CTCF binding sites in the HOXA/B/C/D loci has been generated to examine the effects of disrupting CTCF-associated chromatin boundaries on TAD formation and HOX gene expression. Through CRISPR-Cas9 genetic screening, the CTCF binding site located between HOXA7/HOXA9 genes (CBS7/9) has been identified as a critical regulator of oncogenic chromatin domain, as well as being important for maintaining ectopic HOX gene expression patterns in MLL-rearranged acute myeloid leukemia (AML). Thus, this sgRNA library screening approach provides novel insights into CTCF mediated genome organization in specific gene loci and also provides a basis for the functional characterization of the annotated genetic regulatory elements, both coding and noncoding, during normal biological processes in the post-human genome project era.

CRISPR-Cas9 technology is a powerful research tool for functional genomic studies. It is rapidly replacing conventional gene editing techniques and has high utility for both genome-wide and individual gene-focused applications. Here, the first individually cloned loci-specific CRISPR-Cas9-arrayed sgRNA library contains 1,070 sgRNAs consisting of sgRNAs targeting 303 random targeting genes, 60 positive controls, 500 non-Human-targeting controls, and 207 CTCF elements or lncRNA targeting ge...

Watch this Scientific Journal Video about HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries at JoVE.com

HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries

A CRISPR/sgRNA library has been applied to interrogating protein-coding genes.However, the feasibility of a sgRNA library to uncover the function of a CTCF boundary in gene regulation remains unexplored. Here, we describe a HOX loci specific sgRNA library to elucidate the function of CTCF boundaries in HOX loci.

HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries

CCCTC-binding factor (CTCF)-mediated stable topologically associating domains (TADs) play a critical role in constraining interactions of DNA elements ...

hox-loci-focused-crisprsgrna-library-screening-identifying-critical

Research

JoVE Journal

Genetics

8.1K Views.  Pennsylvania State University College of Medicine. A CRISPR/sgRNA library has been applied to interrogating protein-coding genes.However, the feasibility of a sgRNA library to uncover the function of a CTCF boundary in gene regulation remains unexplored. Here, we describe a HOX loci specific sgRNA library to elucidate the function of CTCF boundaries in HOX loci.

Video: HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries

A Universal Protocol for Large-scale gRNA Library Production from any DNA Source

The popularity of the CRISPR/Cas9 system for both genome and epigenome engineering stems from its simplicity and adaptability. An effector (the Cas9 nuclease or a nuclease-dead dCas9 fusion protein) is targeted to a specific site in the genome by a small synthetic RNA known as the guide RNA, or gRNA. The bipartite nature of the CRISPR system enables its use in screening approaches since plasmid libraries containing expression cassettes of thousands of individual gRNAs can be used to interrogate many different sites in a single experiment. 
To date, gRNA sequences for the construction of libraries have been almost exclusively generated by oligonucleotide synthesis, which limits the achievable complexity of sequences in the library and is relatively cost-intensive. Here, a detailed protocol for CORALINA (comprehensive gRNA library generation through controlled nuclease activity), a simple and cost-effective method for the generation of highly complex gRNA libraries based on enzymatic digestion of input DNA, is described. Since CORALINA libraries can be generated from any source of DNA, plenty of options for customization exist, enabling a large variety of CRISPR-based screens.

Methods for generating large-scale gRNA libraries should be simple, efficient and cost-effective. We describe a protocol for the production of gRNA libraries based on enzymatic digestion of target DNA. This method, CORALINA (comprehensive gRNA library generation through controlled nuclease activity) presents an alternative to costly custom oligonucleotide synthesis.

The popularity of the CRISPR/Cas9 system for both genome and epigenome engineering stems from its simplicity and adaptability. An effector (the Cas9 ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have been directed toward elucidation of the location and timing of initiation of genome duplication rather than its completion. However, it is critical that we understand regions of the genome that are last to complete replication, because these regions suffer elevated levels of chromosomal breakage and mutation, and they have been associated with both disease and aging. Here we describe how we have extended a technique that has been used to monitor replication initiation to instead identify those regions of the genome last to complete replication. This approach is based on a combination of flow cytometry and high throughput sequencing. Although this report focuses on the application of this technique to yeast, the approach can be used with any cells that can be sorted in a flow cytometer according to DNA content.

We describe a technique for combining flow cytometry and high throughput sequencing to identify late replicating regions of the genome.

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.

This article demonstrates a detailed protocol for DNA isolation and high-throughput sequencing library construction from herbarium material including rescue of exceptionally poor-quality DNA.

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

Retrospective MicroRNA Sequencing: Complementary DNA Library Preparation Protocol Using Formalin-fixed Paraffin-embedded RNA Specimens

&#8211;Archived, clinically classified formalin-fixed paraffin-embedded (FFPE) tissues can provide nucleic acids for retrospective molecular studies of cancer development. By using non-invasive or pre-malignant lesions from patients who later develop invasive disease, gene expression analyses may help identify early molecular alterations that predispose to cancer risk. It has been well described that nucleic acids recovered from FFPE tissues have undergone severe physical damage and chemical modifications, which make their analysis difficult and generally requires adapted assays. MicroRNAs (miRNAs), however, which represent a small class of RNA molecules spanning only up to ~18&#8211;24 nucleotides, have been shown to withstand long-term storage and have been successfully analyzed in FFPE samples. Here we present a 3&#39; barcoded complementary DNA (cDNA) library preparation protocol specifically optimized for the analysis of small RNAs extracted from archived tissues, which was recently demonstrated to be robust and highly reproducible when using archived clinical specimens stored for up to 35 years. This library preparation is well adapted to the multiplex analysis of compromised/degraded material where RNA samples (up to 18) are ligated with individual 3&#39; barcoded adapters and then pooled together for subsequent enzymatic and biochemical preparations prior to analysis. All purifications are performed by polyacrylamide gel electrophoresis (PAGE), which allows size-specific selections and enrichments of barcoded small RNA species. This cDNA library preparation is well adapted to minute RNA inputs, as a pilot polymerase chain reaction (PCR) allows determination of a specific amplification cycle to produce optimal amounts of material for next-generation sequencing (NGS). This approach was optimized for the use of degraded FFPE RNA from specimens archived for up to 35 years and provides highly reproducible NGS data.

Formalin-fixed paraffin-embedded specimens represent a valuable source of molecular biomarkers of human diseases. Here we present a laboratory-based cDNA library preparation protocol, initially designed with fresh frozen RNA, and optimized for the analysis of archived microRNAs from tissues stored up to 35 years.

&#8211;Archived, clinically classified formalin-fixed paraffin-embedded (FFPE) tissues can provide nucleic acids for retrospective molecular studies of ...

Ultralow Input Genome Sequencing Library Preparation from a Single Tardigrade Specimen

Tardigrades are microscopic animals that enter an ametabolic state called anhydrobiosis when facing desiccation and can return to their original state when water is supplied. The genomic sequencing of microscopic animals such as tardigrades risks bacterial contamination that sometimes leads to erroneous interpretations, for example, regarding the extent of horizontal gene transfer in these animals. Here, we provide an ultralow input method to sequence the genome of the tardigrade, Hypsibius dujardini, from a single specimen. By employing rigorous washing and contaminant exclusion along with an efficient extraction of the 50 ~ 200 pg genomic DNA from a single individual, we constructed a library sequenced with a DNA sequencing instrument. These libraries were highly reproducible and unbiased, and an informatics analysis of the sequenced reads with other H. dujardini genomes showed a minimal amount of contamination. This method can be applied to unculturable tardigrades that could not be sequenced using previous methods.

Contamination during the genomic sequencing of microscopic organisms remains a large problem. Here, we show a method to sequence the genome of a tardigrade from a single specimen with as little as 50 pg of genomic DNA without whole genome amplification to minimize the risk of contamination.

Tardigrades are microscopic animals that enter an ametabolic state called anhydrobiosis when facing desiccation and can return to their original state ...

Bronchoalveolar Lavage Exosomes in Lipopolysaccharide-induced Septic Lung Injury

Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) represent a heterogeneous group of lung diseases which continues to have a high morbidity and mortality. The molecular pathogenesis of ALI is being better defined; however, because of the complex nature of the disease molecular therapies have yet to be developed. Here we use a lipopolysaccharide (LPS) induced mouse model of acute septic lung injury to delineate the role of exosomes in the inflammatory response. Using this model, we were able to show that mice that are exposed to intraperitoneal LPS secrete exosomes in Broncho-alveolar lavage (BAL) fluid from the lungs that are packaged with miRNA and cytokines which regulate inflammatory response. Further using a co-culture model system, we show that exosomes released from macrophages disrupt expression of tight junction proteins in bronchial epithelial cells. These results suggest that 1) cross talk between innate immune and structural cells through the exosomal shuttling contribute to the inflammatory response and disruption of the structural barrier and 2) targeting these miRNAs may provide a novel platform to treat ALI and ARDS.

Mice exposed to intraperitoneal LPS secrete exosomes in Broncho-alveolar lavage (BAL) fluid that are packaged with miRNAs. Using a co-culture system, we show that exosomes released in the BAL fluid disrupt expression of tight junction proteins in bronchial epithelial cells and increase expression of pro-inflammatory cytokines that accentuate lung injury.

Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) represent a heterogeneous group of lung diseases which continues to have a high ...

Mating-based Overexpression Library Screening in Yeast

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool commonly used in yeast studies. The expression of a number of neurodegenerative disease-associated proteins in yeast causes cytotoxicity and aggregate formation, recapitulating findings seen in patients with these disorders. Here, we describe a method for screening a yeast model of the Amyotrophic Lateral Sclerosis-associated protein FUS for modifiers of its toxicity. Instead of using transformation, this new screening platform relies on the mating of yeast to introduce an arrayed library of plasmids into the yeast model. The mating method has two clear advantages: first, it is highly efficient; second, the pre-transformed arrayed library of plasmids can be stored for long-term as a glycerol stock, and quickly applied to other screens without the labor-intensive step of transformation into the yeast model each time. We demonstrate how this method can successfully be used to screen for genes that modify the toxicity of FUS.

This article presents a mating-based method to facilitate overexpression screening in budding yeast using an arrayed plasmid library.

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool ...

Screening Cotton Genotypes for Reniform Nematode Resistance

A rapid non-destructive reniform nematode (Rotylenchulus reniformis) screening protocol is needed for the development of resistant cotton (Gossypium hirsutum) varieties to improve nematode management. Most protocols involve extracting vermiform nematodes or eggs from the cotton root system or potting soil to determine population density or reproduction rate. These approaches are generally time-consuming with a small number of genotypes evaluated. An alternative approach is described here in which the root system is visually examined for nematode infection. The protocol involves inoculating cotton seedling 7 days after planting with vermiform nematodes and determining the number of females attached to the root system 28 days after inoculation. Data are expressed as the number of females per gram of fresh root weight to adjust for variation in root growth. The protocol provides an excellent method for evaluating host-plant resistance associated with the ability of the nematode to establish an infection site; however, resistance that hinders nematode reproduction is not assessed. As with other screening protocols, variation is commonly observed in nematode infection among individual genotypes within and between experiments. Data are presented to illustrate the range of variation observed using the protocol. To adjust for this variation, control genotypes are included in experiments. Nonetheless, the protocol provides a simple and rapid method to evaluate host-plant resistance. The protocol has been successfully used to identify resistant accessions from the G. arboreum germplasm collection and evaluate segregating populations of more than 300 individuals to determine the genetics of resistance. A vegetative propagation method for recovering plants for resistance breeding was also developed. After removal of the root system for nematode evaluation, the vegetative shoot is replanted to allow the development of a new root system. More than 95% of the shoots typically develop a new root system with plants reaching maturity.

Here, a protocol is presented for the rapid non-destructive screening of cotton genotypes for reniform nematode resistance. The protocol involves visually examining the roots of nematode-infected cotton seedlings to determine infection response. The vegetative shoot from each plant is then propagated to recover plants for seed production.

A rapid non-destructive reniform nematode (Rotylenchulus reniformis) screening protocol is needed for the development of resistant cotton (Gossypium ...

Identifying Mutations by High Resolution Melting in a TILLING Population of Rice

Target Induced Local Lesions In Genomes (TILLING) is a strategy of reverse genetics for the high-throughput screening of induced mutations. However, the TILLING system has less applicability for insertion/deletion (Indel) detection and traditional TILLING needs more complex steps, like CEL I nuclease digestion and gel electrophoresis. To improve the throughput and selection efficiency, and to make the screening of both Indels and single base substitions (SBSs) possible, a new high-resolution melting (HRM)-based TILLING system is developed. Here, we present a detailed HRM-TILLING protocol and show its application in mutation screening. This method can analyze the mutations of PCR amplicons by measuring the denaturation of double-stranded DNA at high temperatures. HRM analysis is directly performed post-PCR without additional processing. Moreover, a simple, safe and fast (SSF) DNA extraction method is integrated with HRM-TILLING to identify both Indels and SBSs. Its simplicity, robustness and high throughput make it potentially useful for mutation scanning in rice and other crops.

In this article, we present the protocol that is described as high-resolution melting analysis (HRM)-based Target Induced Local Lesions In Genomes (TILLING). This method utilizes fluorescence changes during the melting of the DNA duplex and is suitable for high-throughput screening of both insertion/deletion (Indel) and single base substition (SBS).

Target Induced Local Lesions In Genomes (TILLING) is a strategy of reverse genetics for the high-throughput screening of induced mutations. However, the ...

A Screening Method for Identification of Heterochromatin-Promoting Drugs Using Drosophila

Drosophila is an excellent model organism that can be used to screen compounds that might be useful for cancer therapy. The method described here is a cost-effective in vivo method to identify heterochromatin-promoting compounds by using Drosophila. The Drosophila&#39;s DX1 strain, having a variegated eye color phenotype that reflects the extents of heterochromatin formation, thereby providing a tool for a heterochromatin-promoting drug screen. In this screening method, eye variegation is quantified based on the surface area of red pigmentation occupying parts of the eye and is scored on a scale from 1 to 5. The screening method is straightforward and sensitive and allows for testing compounds in vivo. Drug screening using this method provides a fast and inexpensive way for identifying heterochromatin-promoting drugs that could have beneficial effects in cancer therapeutics. Identifying compounds that promote the formation of heterochromatin could also lead to the discovery of epigenetic mechanisms of cancer development.

A Screening Method for Identification of Heterochromatin-Promoting Drugs Using Drosophila

Drosophila is a widely used experimental model suitable for screening drugs with potential applications for cancer therapy. Here, we describe the use of Drosophila variegated eye color phenotypes as a method for screening small-molecule compounds that promote heterochromatin formation.

Drosophila is an excellent model organism that can be used to screen compounds that might be useful for cancer therapy. The method described here is a ...