This work was supported by National Natural Science Foundation of China (81402535 and 81672969) and National Key Research and Development Project (2016YFC0904703).

NOTE: Steps are performed under the indicated temperature. For steps in which the temperature is not mentioned, perform under room temperature (18&#8211;25 &#176;C). Cell culture medium should be stored at 4 &#176;C, and other reagents should be stored according to the manufacturer&#8217;s guides. Medium should be pre-warmed to 37 &#176;C before being added to cells.
1. Cell sorting
<ol>
	<li>Antibody conjugation 
	NOTE: Considering the shorter incubation time, direct-labeled antibody is preferred for cell sorting. If no commercial direct-labeled antibody is available, use fluorescein-conjugating reagents to conjugate the antibody to a fluorescent dye according to the manufacturer&#8217;s guide (see Table of Materials). As cells will be cultured after sorting, all steps should be performed in a biological safety cabinet or laminar clean bench. To avoid contamination, antibiotics (penicillin and streptomycin) are recommended to be added to the culture medium after sorting.
	<ol>
		<li>Add 1 &#181;L of modifier reagent for each 10 &#181;L of antibody to be labeled. Mix gently.</li>
		<li>Add the mixture of antibody and modifier directly onto the lyophilized fluorescein. Pipet gently. Leave the vial standing for 3 h or overnight at room temperature (RT) in the dark.</li>
		<li>Add 1 &#181;L of quencher reagent for every 10 &#181;L of antibody. The conjugate can be used after 30 min. The fluorescein conjugate can be stored at 4 &#176;C for up to 18 months.</li>
		<li>Before sorting, titration of conjugated antibody is recommended. Prepare cells that express (e.g., H1299 or A549 for &#945;2&#948;1) and do not express (e.g., H1975) the marker. Aliquot the cells and incubate them with antibody at different concentrations (e.g., 15 &#956;g/mL, 7.5 &#956;g/mL, 1.5 &#956;g/mL, and 0.75 &#956;g/mL, respectively).</li>
		<li>Perform flow cytometric analysis (with histogram or dot plot) and choose the concentration in which positive cells of H1299 or A549 can be separated from the isotype control and H1975 cells&#160;have little unspecific signals.</li>
	</ol>
	</li>
	<li>Cell labeling
	<ol>
		<li>Culture A549 cells in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) in 10 cm dishes at 37 &#176;C and 5% CO2 in a cell culture incubator. Digest cells as follows for sorting when they reach 80%&#8211;90% confluence (about 5&#8211;10 x 106 cells per dish).</li>
		<li>Remove the culture medium. Wash cells with 3 mL of phosphate buffered saline (PBS) briefly. Add 3 mL of 0.05% trypsin to each dish. Remove the trypsin and leave the residuary trypsin to digest cells at 37 &#176;C for 1&#8211;3 min. Check the detachment of the cells frequently to avoid overdigestion. 
		NOTE: Some cell lines may be relatively difficult to digest, such as NSCLC cell lines H520 and PC9. In such situation, 3 mL of trypsin can be left in the dish, rather than digestion with residuary trypsin. Moreover, the digestion time can be extended.</li>
		<li>When cells become loose and begin to detach from the dishes, add 3 mL of RPMI 1640 medium supplemented with 10% FBS and pipette the cell suspension into a 50 mL tube.</li>
		<li>Centrifuge at 300 x g at 4 &#176;C for 5 min. Discard the supernatant. Add 10 mL of PBS to resuspend the cells. Transfer 0.5 mL (or at least 5 x 105 cells) of cell suspension into a new tube as an isotype control.&#160;The remaining cells are for sorting.</li>
		<li>Centrifuge both the control and experimental tubes at 300 x g at 4 &#176;C for 5 min. Discard the supernatant.</li>
		<li>Prepare the working solution for staining by diluting the fluorescent dye-conjugated isotype control or antibody in PBS to the optimal concentration titrated as mentioned above. 
		NOTE: In this experiment, FITC-conjugated 1B50-1 (the antibody of &#945;2&#948;1) was diluted into 7.5 &#956;g/mL. The volume of working solution is dependent on the cell amount.</li>
		<li>Resuspend the control and experimental cells with each working solution at about 2&#8211;5 x 107 cells/mL and mix gently. Incubate the samples at RT for 30&#8211;40 min in the dark.</li>
		<li>Wash the cells by adding 10 mL of PBS to samples, mix gently and centrifuge at 300 x g at 4 &#176;C for 5 min. Discard the supernatant. Resuspend cells with 10 mL of PBS.</li>
		<li>Put 40 &#956;m cell strainers on new 50 mL tubes for control and experimental cells respectively. Apply cell suspension onto the strainer and collect the flow-through. 
		NOTE: This step removes the cell clumps that may block the capillary of the cell sorter.</li>
		<li>Centrifuge the flow-through at 300 x g at 4 &#176;C for 5 min. Discard the supernatant. Resuspend the cells with 0.2&#8211;1.0 mL PBS then transfer into a 5 mL tube for flow cytometry.</li>
	</ol>
	</li>
	<li>Cell sorting by flow cytometry
	<ol>
		<li>Prepare two 5 mL tubes to collect the positive and negative cell populations. Add 1 mL of RPMI 1640 medium in each tube. Place the tubes at the collection platform of the cell sorter.</li>
		<li>Analyze the control cells and experimental cells respectively with the dot plot. Gate the live cells with the parameters forward scatter (FSC) and side scatter (SSC). Gate the positive and negative population of live cells according to the FL-1 intensity.</li>
		<li>Collect the &#945;2&#948;1-positive cells and &#945;2&#948;1-negative cells. Record the number of cells obtained.</li>
		<li>To confirm that the harvested cell populations have different level of &#945;2&#948;1 expression, a quantitative polymerase chain reaction (QPCR) can be performed.
		<ol>
			<li>Extract RNA of positive and negative cells with guanidinium thiocyanate reagent and reverse transcript the RNA into cDNA according to the manufacturer&#8217;s guide. Perform QPCR with SYBR green reagent. The sequences of primers are as follows: &#945;2&#948;1-F, CAGTTGAGATGGAGGATGATG; &#945;2&#948;1-R, TTGTATGAGCAGTCGTGTGTC; GAPDH-F, GTCGGAGTCAACGGATTTGG; and GAPDH-R, AAAAGCAGCCCTGGTGACC.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Sphere formation assay
NOTE: Sphere formation assay is applied to determine the self-renewal capacity of cells. Cells with self-renewal capacity could form spheres in this serum-free semisolid medium supplemented with growth factors. All steps should be performed in a biological safety cabinet or laminar clean bench. To avoid contamination, antibiotics (penicillin and streptomycin) are recommended to be added to the culture medium after sorting.
<ol>
	<li>Medium preparation
	<ol>
		<li>Prepare 2x DMEM/F-12 medium by reconstituting a 1 L package of DMEM/F-12 powder into 475 mL of distilled water. Add 2.438 g of NaHCO3. Adjust the pH to 7.0&#8211;7.2 by slowly adding 1 N NaOH or 1 N HCl with stirring. Add distilled water to a final volume of 500 mL. Sterilize the medium by filtering through a 0.2 &#956;m filter.</li>
		<li>Prepare a 2% methylcellulose solution by adding 2 g of methylcellulose into 100 mL of distilled water. Autoclave the solution. The methylcellulose may show a cotton-like state after autoclaving. Mix it by reversing the bottle up and down gently for few times and leave it for natural cooling. It will become a transparent semisolid overnight.</li>
		<li>To obtain 20 mL of self-renewal medium, add 10 mL of 2x DMEM/F-12 medium to a 50 mL tube. Add 400 &#956;L of B27 to the medium. Add recombinant human epidermal growth factor (EGF) to a final concentration of 25 ng/mL. Add recombinant human basic fibroblast growth factor (bFGF) to a final concentration of 25 ng/mL. Add 2% methylcellulose to reach a final volume of 20 mL.</li>
		<li>Mix the medium by vortex so that the self-renewal medium is obtained.</li>
	</ol>
	</li>
	<li>Cell seeding
	<ol>
		<li>Transfer the harvested cells into the self-renewal medium to reach 2000 cells/mL and mix them with a brief vortex. Add 100 &#956;L of cell suspension to each well of an ultra-low attachment 96 well plate. Do not use the wells at the rim of the plate, as the medium is more likely to evaporate in these wells. Add sterilized water to these wells.</li>
		<li>Culture at 37 &#176;C with 5% CO2 in cell culture incubator for 10&#8211;14 days. Add 50 &#956;L of self-renewal medium at day 5&#8211;7.</li>
	</ol>
	</li>
	<li>Sphere counting and calculation
	<ol>
		<li>10&#8211;14 days after seeding, count the number of spheres with more than 50 cells (approximately) or with a diameter more than 100 &#956;m under a microscope (4x objective lens, 10x eyepiece). 
		NOTE: Starting from the upper left of the well, count the spheres while moving the objective table horizontally towards the right with the joystick of the microscope. Then, move the objective table to the middle row of the visual field and count the spheres from right to left. Then, move to the lower row and count from left to right. A well of 96 well plate can be counted within three rows.</li>
		<li>Calculate the sphere formation efficiency as the number of spheres divided by the number of cells seeded. Compare the sphere formation efficiency between the positive and negative cell populations.</li>
	</ol>
	</li>
</ol>
3. Colony formation assay
NOTE: Colony formation assay is applied to determine the radiosensitivity of cells. Radiation can be delivered by a linear accelerator used for radiotherapy. Cell irradiation system for laboratory use can also be used if the equipment is available. Steps 3.1, 3.2.3, and 3.2.6 should be performed in a biological safety cabinet or laminar clean bench. To avoid contamination, antibiotics (penicillin and streptomycin) are recommended to be added to the culture medium after sorting.
<ol>
	<li>Cell seeding
	<ol>
		<li>Prepare one 6 well plate for each radiation dose including the 0 Gy group. Add 1.5 mL of medium to each well of 6 well plate. Culture medium for colony formation assay is the conventional RPMI 1640 medium supplemented with 10% FBS (named as &#8220;completed 1640&#8221;).</li>
		<li>Dilute harvested cells with completed 1640 medium&#160;to 1000 cells/mL.</li>
		<li>Add cell suspension to the wells. Shake the plates horizontally to make cells distribute evenly in the wells. Record the volume added in each dose group. 
		NOTE: Generally, seed 200 cells per well for 0 Gy, 200 cells for 2 Gy, 400 cells for 4 Gy, 800 cells for 6 Gy, and 1600 cells for 8 Gy, respectively. It is better to adjust the cell numbers in unsorted cells in pre-experiments.</li>
		<li>Culture at 37 &#176;C with 5% CO2 in cell culture incubator.</li>
	</ol>
	</li>
	<li>Radiation
	<ol>
		<li>After cells have attached to the bottom of the wells (usually one day after seeding, and longer time is not recommended considering cell proliferation), proceed to perform cell radiation.</li>
		<li>Calculate the number of monitor units (MU) for each dose at a depth of 1 cm in a 20 cm x 20 cm radiation field. 
		NOTE: Number of MU = dose (cGy)/output factor for the radiation field/percentage depth dose (PDD) for the depth. For example, the output factor for a 20 cm x 20 cm field is 1.066, PDD for 1.0 cm is 0.987, and number of MU for 8 Gy (800 cGy) is 760 (800/1.066/0.987 = 760.35). If multiple plates need to be radiated for each dose, a larger field can also be used, and the numbers of MU need to be recalculated according to the size of the field. Output factor and PDD differ in different accelerators. Refer to radiation physicists for these parameters.</li>
		<li>Add completed 1640 to each well to reach 1 cm for the height of the medium. 
		NOTE: Cell growth area of 6 well plate can be found on the manufacturer&#8217;s guide. For example, if the growth area is 9.5 cm2 for each well of 6 well plate, and 1.5 mL of medium and 0.4 mL of cell suspension has been added on the day before, then add 7.6 mL medium to the well. The height is needed for dose build-up. A medium height of less than 0.8 cm is not recommended. 
		NOTE:&#160;Keep the plates covered during radiation. When the plates are transferred between cell culture room and radiation therapy room, wrap the plates with aluminum foil or put them in a clean box to avoid contamination. Hold the plates flat to avoid medium spilling out.</li>
		<li>Set a 20 cm x 20 cm radiation field. Place a tissue-equivalent bolus of 1.0 cm thickness on the treatment couch, and place the 6 well plate on the bolus to keep them in contact. Make sure the whole plate is within the radiation field. Set the source skin distance as 100 cm. Align the medium surface level to the laser level by adjusting the height of the treatment couch. 
		NOTE: Plates with the same radiation dose can be radiated at the same time. For this case, a larger radiation field is needed, and the number of MU should be recalculated according to the corresponding output factor. Make sure all the plates are within the radiation field.</li>
		<li>Deliver the each assigned dose to each plate in sequence. 
		CAUTION: The linear accelerator can only be operated by qualified technicians. Keep away from radiation.</li>
		<li>Take the plates back to the cell culture room. Change the medium with 2 mL of completed medium for each well. Culture at 37 &#176;C with 5% CO2 in cell culture incubator. Change the medium every 3&#8211;5 days.</li>
	</ol>
	</li>
	<li>Staining
	<ol>
		<li>7&#8211;10 days after radiation, when many colonies form and before they grow too large and merge together, then perform staining and counting as follows. Remove the medium and wash briefly with PBS. Add 1 mL of 4% formaldehyde to each well to fix the cells. 
		CAUTION: Formaldehyde is volatile. Use formaldehyde in a fume hood.</li>
		<li>After 10 min of fixation, remove the formaldehyde and wash with 2 mL of distilled water each well twice.</li>
		<li>Add 1 mL of 1% crystal violet stain solution to each well. Stain for 10 min. Remove the crystal violet stain solution, and wash with distilled water 3 times. Remove the water and dry the plates.</li>
	</ol>
	</li>
	<li>Colony counting and calculation
	<ol>
		<li>Count the number of colonies with more than 50 cells. Do not include small colonies with less than 50 cells. Check the colonies under a microscope to get an impression of a colony constituted by 50 cells and mark it on the bottom of the plate with a marker pen. 
		NOTE: Photographing the wells and using the software ImageJ will facilitate the counting process.</li>
		<li>Calculate the colony formation efficiency as the number of colonies divided by the number of cells seeded. Calculate the survival fraction as the colony formation efficiency at a certain irradiation dose divided by the colony formation efficiency at 0 Gy.</li>
		<li>Using the dose as the x-axis and survival fraction as the y-axis, a survival curve can be obtained. Compare the survival curves between the positive and negative cell populations.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Brunner, T. B., Kunz-Schughart, L. A., Grosse-Gehling, P., Baumann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells+as+a+predictive+factor+in+radiotherapy.">Cancer stem cells as a predictive factor in radiotherapy.</a> Seminars in Radiation Oncology. 22 (2), 151-174 (2012).</li><li>Baumann, M., Krause, M., Hill, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+role+of+cancer+stem+cells+in+radioresistance.">Exploring the role of cancer stem cells in radioresistance.</a> Nature Reviews Cancers. 8 (7), 545-554 (2008).</li><li>Clarke, M. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells--perspectives+on+current+status+and+future+directions:+AACR+Workshop+on+cancer+stem+cells.">Cancer stem cells--perspectives on current status and future directions: AACR Workshop on cancer stem cells.</a> Cancer Research. 66 (19), 9339-9344 (2006).</li><li>Bao, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glioma+stem+cells+promote+radioresistance+by+preferential+activation+of+the+DNA+damage+response.">Glioma stem cells promote radioresistance by preferential activation of the DNA damage response.</a> Nature. 444 (7120), 756-760 (2006).</li><li>Wang, W. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MYC+regulation+of+CHK1+and+CHK2+promotes+radioresistance+in+a+stem+cell-like+population+of+nasopharyngeal+carcinoma+cells.">MYC regulation of CHK1 and CHK2 promotes radioresistance in a stem cell-like population of nasopharyngeal carcinoma cells.</a> Cancer Research. 73 (3), 1219-1231 (2012).</li><li>Diehn, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Association+of+reactive+oxygen+species+levels+and+radioresistance+in+cancer+stem+cells.">Association of reactive oxygen species levels and radioresistance in cancer stem cells.</a> Nature. 458 (7239), 780-783 (2009).</li><li>Gomez-Casal, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-small+cell+lung+cancer+cells+survived+ionizing+radiation+treatment+display+cancer+stem+cell+and+epithelial-mesenchymal+transition+phenotypes.">Non-small cell lung cancer cells survived ionizing radiation treatment display cancer stem cell and epithelial-mesenchymal transition phenotypes.</a> Molecular Cancer. 12 (1), 94 (2013).</li><li>Mihatsch, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+radioresistant+tumor+cells+and+presence+of+ALDH1+activity+in+vitro.">Selection of radioresistant tumor cells and presence of ALDH1 activity in vitro.</a> Radiotherapy and Oncology. 99 (3), 300-306 (2011).</li><li>Sui, X., Geng, J. H., Li, Y. H., Zhu, G. Y., Wang, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+channel+&#945;2&#948;1+subunit+(CACNA2D1)+enhances+radioresistance+in+cancer+stem-like+cells+in+non-small+cell+lung+cancer+cell+lines.">Calcium channel &#945;2&#948;1 subunit (CACNA2D1) enhances radioresistance in cancer stem-like cells in non-small cell lung cancer cell lines.</a> Cancer Management and Research. 10, 5009-5018 (2018).</li><li>Zhao, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=1B50-1,+a+mAb+raised+against+recurrent+tumor+cells,+targets+liver+tumor-initiating+cells+by+binding+to+the+calcium+channel+&#945;2&#948;1+subunit.">1B50-1, a mAb raised against recurrent tumor cells, targets liver tumor-initiating cells by binding to the calcium channel &#945;2&#948;1 subunit.</a> Cancer Cell. 23 (4), 541-556 (2013).</li><li>Moncharmont, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+a+cornerstone+of+radiation+resistance:+Cancer+stem+cell.">Targeting a cornerstone of radiation resistance: Cancer stem cell.</a> Cancer Letters. 322 (2), 139-147 (2012).</li><li>Zhang, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycine+decarboxylase+activity+drives+non-small+cell+lung+cancer+tumor-initiating+cells+and+tumorigenesis.">Glycine decarboxylase activity drives non-small cell lung cancer tumor-initiating cells and tumorigenesis.</a> Cell. 148 (1-2), 259-272 (2012).</li><li>Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clonogenic+assay+of+cells+in+vitro.">Clonogenic assay of cells in vitro.</a> Nature Protocols. 1 (5), 2315-2319 (2006).</li><li>O'Brien, C. A., Kreso, A., Jamieson, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells+and+self-renewal.">Cancer stem cells and self-renewal.</a> Clinical Cancer Research. 16 (12), 3113-3120 (2010).</li><li>Morgan, M. A., Lawrence, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+pathways:+overcoming+radiation+resistance+by+targeting+DNA+damage+response+pathways.">Molecular pathways: overcoming radiation resistance by targeting DNA damage response pathways.</a> Clinical Cancer Research. 21 (13), 2898-2904 (2015).</li><li>Yu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanistic+exploration+of+cancer+stem+cell+marker+voltage-dependent+calcium+channel+&#945;2&#948;1+subunit-mediated+chemotherapy+resistance+in+small-cell+lung+cancer.">Mechanistic exploration of cancer stem cell marker voltage-dependent calcium channel &#945;2&#948;1 subunit-mediated chemotherapy resistance in small-cell lung cancer.</a> Clin Cancer Res. 24 (9), 2148-2158 (2018).</li></ol>

The authors declare no conflict of interest.

This protocol describes methods to study the radiosensitivity of CSCs in cancer cell lines in vitro. In this study, the expression of &#945;2&#948;1 is continuous in NSCLC cell lines. Therefore, gating is based on an isotype control. Before sorting, &#945;2&#948;1 expression should be examined in multiple cell lines by flow cytometry and validated by QPCR or western blot. It is recommended to re-analyze &#945;2&#948;1 expression of the sorted &#945;2&#948;1-high and &#945;2&#948;1-low cells by flow cytometry, by observin...

Radiotherapy plays an important role in cancer treatment. However, existence of radioresistant cancer stem cells (CSCs) may lead to relapse or poor outcomes after radiotherapy1,2. CSCs are characterized by their self-renewal capacity and ability to generate heterogenous cancer cells3. Armored with a more efficient DNA damage repair capacity or higher levels of free-radical scavenging systems or other mechanisms, CSCs are relatively resistant to radiotherapy4,5,6,7,8. Identifying CSC markers and exploring their mechanisms will facilitate the development of drugs that will overcome radioresistance without increasing normal tissue damage.
Voltage-gated calcium channel &#945;2&#948;1 subunit isoform 5 has been reported as a marker for radioresistant CSCs in NSCLC cell lines9. &#945;2&#948;1 was originally identified as a CSC marker for hepatocellular carcinoma (HCC)10. Using subtractive immunization with a pair of HCC cell lines derived from the primary and recurrent tumors in the same patient, an antibody named 1B50-1 was identified to target recurrent HCC cells specifically. 1B50-1-positive cells showed high sphere formation efficiency in vitro and high tumorigenicity in vivo. Its antigen was identified by mass spectrometry, as calcium channel &#945;2&#948;1 subunit isoform 5. &#945;2&#948;1 specifically expresses in CSCs and is undetectable in most normal tissues, making it a potential candidate for targeting CSCs10. &#945;2&#948;1 can also serve as a CSC marker for NSCLC cell lines, and it has been shown to impart radioresistance to NSCLC cells partially by enhancing the efficiency of DNA damage repair in response to radiation9.
Studying radioresistant CSCs may provide clues to overcoming radioresistance. Using &#945;2&#948;1 in NSCLC as an example, major methods to study the radiosensitivity of CSCs are presented. Usually, CSCs are isolated with a putative surface marker, and the stem cell characteristics and radiosensitivity of the positive and negative cell populations are compared. Sphere formation in a serum-free medium supplemented with growth factors that support self-renewal is a useful assay to evaluate the stemness of cells in vitro. Cells with high sphere formation capacity are likely to show high tumorigenicity when injected into immunodeficient mice10,11,12. Colony formation assay is then used to assess the radiosensitivity of cells, which determines how many have lost the ability to generate descendants forming the colony after a dose of radiation13.

<table>
	<tbody>
		<tr>
			<td>0.5% Trypsin-EDTA (10X), no phenol red</td>
			<td>Thermo Fisher</td>
			<td>15400054</td>
			<td>Dilute in to 0.05% (1X) with autoclaved distilled water</td>
		</tr>
		<tr>
			<td>1B50-1</td>
			<td></td>
			<td></td>
			<td>This antibody is produced and friendly supplied by Laboratory of Carcinogenesis and Translational Reseach (Ministry of Education/Beijing), Department of Cell Biology, Peking University Cancer Hospital and Institute. See reference 10. Alternatively, commercial antibody of calcium channel &#945;2&#948;1 subunit can be used (ABCAM, ab2864) (Yu, et al., Am J Cancer Res, 2016; 6(9): 2088-2097)</td>
		</tr>
		<tr>
			<td>4% formaldehyde solution</td>
			<td>Solarbio</td>
			<td>G2160</td>
			<td></td>
		</tr>
		<tr>
			<td>A549</td>
			<td>ATCC</td>
			<td></td>
			<td>RRID: CVCL_0023</td>
		</tr>
		<tr>
			<td>B27</td>
			<td>Thermo Fisher</td>
			<td>17504044</td>
			<td></td>
		</tr>
		<tr>
			<td>Biological Safety Cabinet</td>
			<td>Thermo Fisher</td>
			<td>1336</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5910R</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F-12</td>
			<td>Thermo Fisher</td>
			<td>12500062</td>
			<td></td>
		</tr>
		<tr>
			<td>EGF Recombinant Human Protein</td>
			<td>Thermo Fisher</td>
			<td>PHG0311</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum</td>
			<td>Thermo Fisher</td>
			<td>16140071</td>
			<td></td>
		</tr>
		<tr>
			<td>FGF-Basic (AA 1-155) Recombinant Human Protein</td>
			<td>Thermo Fisher</td>
			<td>PHG0261</td>
			<td></td>
		</tr>
		<tr>
			<td>Flow cytometer/cell sorter</td>
			<td>BD</td>
			<td>FACSARIA III</td>
			<td></td>
		</tr>
		<tr>
			<td>H1299</td>
			<td>ATCC</td>
			<td></td>
			<td>RRID: CVCL_0060</td>
		</tr>
		<tr>
			<td>H1975</td>
			<td>ATCC</td>
			<td></td>
			<td>RRID: CVCL_1511</td>
		</tr>
		<tr>
			<td>Lightning-Link Fluorescein Kit</td>
			<td>Innova Biosciences</td>
			<td>310-0010</td>
			<td></td>
		</tr>
		<tr>
			<td>linear accelerator</td>
			<td>VARIAN</td>
			<td>CLINAC 600C/D</td>
			<td></td>
		</tr>
		<tr>
			<td>Methyl cellulose</td>
			<td>Sigma Aldrich</td>
			<td>M7027</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin, Liquid</td>
			<td>Thermo Fisher</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate buffered saline</td>
			<td>Solarbio</td>
			<td>P1020</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI-1640</td>
			<td>Thermo Fisher</td>
			<td>11875093</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBRGREEN</td>
			<td>TOYOBO</td>
			<td>QPK-201</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Thermo Fisher</td>
			<td>15596026</td>
			<td></td>
		</tr>
		<tr>
			<td>Violet crystal staining solution</td>
			<td>Solarbio</td>
			<td>G1062</td>
			<td></td>
		</tr>
	</tbody>
</table>

radiosensitivity of cancer stem cells in lung cancer cell lines

The presence of cancer stem cells (CSCs) has been associated with relapse or poor outcomes after radiotherapy. Studying radioresistant CSCs may provide clues to overcoming radioresistance. Voltage-gated calcium channel &#945;2&#948;1 subunit isoform 5 has been reported as a marker for radioresistant CSCs in non-small cell lung cancer (NSCLC) cell lines. Using calcium channel &#945;2&#948;1 subunit as an example of a CSC marker, methods to study the radiosensitivity of CSCs in NSCLC cell lines are presented. CSCs are sorted with putative markers by flow cytometry, and the self-renewal capacity of sorted cells is evaluated by sphere formation assay. Colony formation assay, which determines how many cells lose the ability to generate descendants forming the colony after a certain dose of radiation, is then performed to assess the radiosensitivity of sorted cells. This manuscript provides initial steps for studying the radiosensitivity of CSCs, which establishes the basis for further understanding of the underlying mechanisms.

&#945;2&#948;1-high and &#945;2&#948;1-low A549 cells were sorted (Figure 1A). Some markers may show distinct populations and are easy to gate. However, some markers just show high and low expression patterns, rather than distinct positive and negative populations. In this situation, an isotype control is very important for gating. The expression of &#945;2&#948;1 in sorted cells is validated by qPCR. The expression of CACNA2D1, the gene that encode &#945;2&#948;1, is higher in sort...

Watch this Scientific Journal Video about Radiosensitivity of Cancer Stem Cells in Lung Cancer Cell Lines at JoVE.com

Radiosensitivity of Cancer Stem Cells in Lung Cancer Cell Lines

The presence of cancer stem cells have been associated with relapse or poor outcomes after radiotherapy. This manuscript describes the methods to study the radiosensitivity of cancer stem cells in lung cancer cell lines.

The presence of cancer stem cells (CSCs) has been associated with relapse or poor outcomes after radiotherapy. Studying radioresistant CSCs may provide ...

radiosensitivity-of-cancer-stem-cells-in-lung-cancer-cell-lines

Research

JoVE Journal

Cancer Research

6.8K Views.  Peking University Cancer Hospital and Institute. The presence of cancer stem cells have been associated with relapse or poor outcomes after radiotherapy. This manuscript describes the methods to study the radiosensitivity of cancer stem cells in lung cancer cell lines.

Video: Radiosensitivity of Cancer Stem Cells in Lung Cancer Cell Lines

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma (DIPG)

Diffuse Intrinsic Pontine Glioma (DIPG) is a childhood brainstem tumor that carries a universally fatal prognosis. Because surgical resection is not a viable treatment strategy and biopsy is not routinely performed, the availability of patient samples for research is limited. Consequently, efforts to study this disease have been challenged by a paucity of faithful disease models. To address this need, we describe here a protocol for the rapid processing of post-mortem autopsy tissue samples in order to generate durable patient-derived cell culture models that can be used in in vitro assays or in vivo orthotopic xenograft experiments. These models can be used to screen for potential drug targets and to study fundamental pathobiological processes within DIPG. This protocol can further be extended to analyze and isolate tumor and microenvironmental cells using Fluorescence-activated Cell Sorting (FACS), which enables subsequent analysis of gene expression, protein expression, or epigenetic modifications of DNA at the bulk cell or single cell level. Finally, this protocol can also be adapted to generate patient-derived cultures for other central nervous system tumors.

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma DIPG

This protocol describes a method for the rapid processing of post-mortem diffuse intrinsic pontine glioma samples for the establishment of patient-derived cell culture models or direct characterization of tumor and microenvironmental cells.

Diffuse Intrinsic Pontine Glioma (DIPG) is a childhood brainstem tumor that carries a universally fatal prognosis. Because surgical resection is not a ...

The Establishment of a Lung Colonization Assay for Circulating Tumor Cell Visualization in Lung Tissues

Metastasis is the major cause of cancer death. The role of circulating tumor cells (CTCs) in promoting cancer metastasis, in which lung colonization by CTCs critically contributes to early lung metastatic processes, has been vigorously investigated. As such, animal models are the only approach that captures the full systemic process of metastasis. Given that problems occur in previous experimental designs for examining the contributions of CTCs to blood vessel extravasation, we established an in vivo lung colonization assay in which a long-term-fluorescence cell-tracer, carboxyfluorescein succinimidyl ester (CFSE), was used to label suspended tumor cells and lung perfusion was performed to clear non-specifically trapped CTCs prior to lung removal, confocal imaging, and quantification. Polymeric fibronectin (polyFN) assembled on CTC surfaces has been found to mediate lung colonization in the final establishment of metastatic tumor tissues. Here, to specifically test the requirement of polyFN assembly on CTCs for lung colonization and extravasation, we performed short term lung colonization assays in which suspended Lewis lung carcinoma cells (LLCs) stably expressing FN-shRNA (shFN) or scramble-shRNA (shScr) and pre-labeled with 20 &#956;M of CFSE were intravenously inoculated into C57BL/6 mice. We successfully demonstrated that the abilities of shFN LLC cells to colonize the mouse lungs were significantly diminished in comparison to shScr LLC cells. Therefore, this short-term methodology may be widely applied to specifically demonstrate the ability of CTCs within the circulation to colonize the lungs.

An animal model is needed to decipher the role of circulating tumor cells (CTCs) in promoting lung colonization during cancer metastasis. Here, we established and successfully performed an in vivo assay to specifically test the requirement of polymeric fibronectin (polyFN) assembly on CTCs for lung colonization.

Metastasis is the major cause of cancer death. The role of circulating tumor cells (CTCs) in promoting cancer metastasis, in which lung colonization by ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and eosin (H&amp;E) staining but can be visualized through elastic staining. One of the important benefits of elastic staining is that it makes it easy to determine whether tumor cells have invaded beyond the elastic lamina. This helps in examining the extent of peritoneal surface invasion, thereby distinguishing the pT3 and pT4 stages in gastrointestinal cancer. In this study, we present a protocol to identify elastic fibers in the formalin-fixed, paraffin-embedded pT3N0M0 gastric cancer tissue sections. We prepare 5-&#181;m paraffin sections fixed on slides, and then all the slides are deparaffinated and rehydrated during the staining procedure. Subsequently, all the sections are oxidized by potassium permanganate, bleached by oxalic acid, stained by elastic staining, and counterstained by Van Gieson's. Finally, we examine the effect of staining; elastic lamina is stained blue-black and collagen fibers are stained red, while the cancer cells are stained in varying shades of yellow. We also describe in detail the methods used for determining the positional relationship between cancer cells and elastic lamina. This method is simple, low-cost, and widely applicable in the identification of peritoneal surface invasion in gastrointestinal cancer because of its outstanding selectivity for elastic fibers and authentic results.

Here, we present a protocol of elastic staining to identify elastic fibers in pT3N0M0 gastric cancer tissues on formalin-fixed, paraffin-embedded sections. Subsequently, we describe a method to determine whether tumor cells invade beyond the elastic lamina.

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Mesenchymal Stem Cell Isolation from Pulp Tissue and Co-Culture with Cancer Cells to Study Their Interactions

Cancer as a multistep process and complicated disease is not only regulated by individual cell proliferation and growth but also controlled by tumor environment and cell-cell interactions. Identification of cancer and stem cell interactions, including changes in extracellular environment, physical interactions, and secreted factors, might enable the discovery of new therapy options. We combine known co-culture techniques to create a model system for mesenchymal stem cells (MSCs) and cancer cell interactions. In the current study, dental pulp stem cells (DPSCs) and PC-3 prostate cancer cell interactions were examined by direct and indirect co-culture techniques. Condition medium (CM) obtained from DPSCs and 0.4 &#181;m pore sized trans-well membranes were used to study paracrine activity. Co-culture of different cell types together was performed to study direct cell-cell interaction. The results revealed that CM increased cell proliferation and decreased apoptosis in prostate cancer cell cultures. Both CM and trans-well system increased cell migration capacity of PC-3 cells. Cells stained with different membrane dyes were seeded into the same culture vessels, and DPSCs participated in a self-organized structure with PC-3 cells under this direct co-culture condition. Overall, the results indicated that co-culture techniques could be useful for cancer and MSC interactions as a model system.

We provide protocols for evaluation of mesenchymal stem cells isolated from dental pulp and prostate cancer cell interactions based on direct and indirect co-culture methods. Condition medium and trans-well membranes are suitable to analyze indirect paracrine activity. Seeding differentially stained cells together is an appropriate model for direct cell-cell interaction.

Cancer as a multistep process and complicated disease is not only regulated by individual cell proliferation and growth but also controlled by tumor ...

Establishment and Characterization of Three Afatinib-resistant Lung Adenocarcinoma PC-9 Cell Lines Developed with Increasing Doses of Afatinib

Acquired resistance to molecular target inhibitors is a severe problem in cancer therapy. Lung cancer remains the leading cause of cancer-related death in most countries. The discovery of "oncogenic driver mutations," such as epidermal growth factor receptor (EGFR)-activating mutations, and subsequent development of molecular targeted agents of EGFR tyrosine kinase inhibitors (TKIs) (gefitinib, erlotinib, afatinib, dacomitinib, and osimertinib) have dramatically altered lung cancer treatment in recent decades. However, these drugs are still not effective in patients with non-small cell lung cancer (NSCLC) carrying EGFR-activating mutations. Following acquired resistance, the systemic progression of NSCLC remains a significant obstacle in treating patients with EGFR mutation-positive NSCLC. Here, we present a stepwise dose escalation method for establishing three independent acquired afatinib-resistant cell lines from NSCLC PC-9 cells harboring EGFR-activating mutations of 15-base pair deletions in EGFR exon 19. Methods for characterizing the three independent afatinib-resistance cell lines are briefly presented. The acquired resistance mechanisms to EGFR TKIs are heterogeneous. Therefore, multiple cell lines with acquired resistance to EGFR-TKIs must be examined. Ten to twelve months are required to obtain cell lines with acquired resistance using this stepwise dose escalation approach. The discovery of novel acquired resistance mechanisms will contribute to the development of more effective and safe therapeutic strategies.

A method for establishing afatinib-resistance cell lines from lung adenocarcinoma PC-9 cells was developed, and resistant cells were characterized. The resistant cells can be used to investigate epidermal growth factor receptor tyrosine kinase inhibitor-resistance mechanisms, applicable for patients with non-small cell lung cancer.

Acquired resistance to molecular target inhibitors is a severe problem in cancer therapy. Lung cancer remains the leading cause of cancer-related death in ...

Flow Cytometric Analysis of Mitochondrial Reactive Oxygen Species in Murine Hematopoietic Stem and Progenitor Cells and MLL-AF9 Driven Leukemia

We present a flow cytometric approach for analyzing mitochondrial ROS in various live bone marrow (BM)-derived stem and progenitor cell populations from healthy mice as well as mice with AML driven by MLL-AF9. Specifically, we describe a two-step cell staining process, whereby healthy or leukemia BM cells are first stained with a fluorogenic dye that detects mitochondrial superoxides, followed by staining with fluorochrome-linked monoclonal antibodies that are used to distinguish various healthy and malignant hematopoietic progenitor populations. We also provide a strategy for acquiring and analyzing the samples by flow cytometry. The entire protocol can be carried out in a timeframe as short as 3-4 h. We also highlight the key variables to consider as well as the advantages and limitations of monitoring ROS production in the mitochondrial compartment of live hematopoietic and leukemia stem and progenitor subpopulations using fluorogenic dyes by flow cytometry. Furthermore, we present data that mitochondrial ROS abundance varies among distinct healthy HSPC sub-populations and leukemia progenitors and discuss the possible applications of this technique in hematologic research.

We describe a method for using multiparameter flow cytometry to detect mitochondrial reactive oxygen species (ROS) in murine healthy hematopoietic stem and progenitor cells (HSPCs) and leukemia cells from a mouse model of acute myeloid leukemia (AML) driven by MLL-AF9.

We present a flow cytometric approach for analyzing mitochondrial ROS in various live bone marrow (BM)-derived stem and progenitor cell populations from ...

Characterize Disease-related Mutants of RAF Family Kinases by Using a Set of Practical and Feasible Methods

The rapidly accelerated fibrosarcoma (RAF) family kinases play a central role in cell biology and their dysfunction leads to cancers and developmental disorders. A characterization of disease-related RAF mutants will help us select appropriate therapeutic strategies for treating these diseases. Recent studies have shown that RAF family kinases have both catalytic and allosteric activities, which are tightly regulated by dimerization. Here, we constructed a set of practical and feasible methods to determine the catalytic and allosteric activities and the relative dimer affinity/stability of RAF family kinases and their mutants. Firstly, we amended the classical in vitro kinase assay by reducing the detergent concentration in buffers, utilizing a gentle quick wash procedure, and employing a glutathione S-transferase (GST) fusion to prevent RAF dimers from dissociating during purification. This enables us to measure the catalytic activity of constitutively active RAF mutants appropriately. Secondly, we developed a novel RAF co-activation assay to evaluate the allosteric activity of kinase-dead RAF mutants by using N-terminal truncated RAF proteins, eliminating the requirement of active Ras in current protocols and thereby achieving a higher sensitivity. Lastly, we generated a unique complementary split luciferase assay to quantitatively measure the relative dimer affinity/stability of various RAF mutants, which is more reliable and sensitive compared to the traditional co-immunoprecipitation assay. In summary, these methods have the following advantages: (1) user-friendly; (2) able to carry out effectively without advanced equipment; (3) cost-effective; (4) highly sensitive and reproducible.

In this article, we presented a set of practical and feasible methods for characterizing disease-related mutants of RAF family kinases, which include in vitro kinase assay, RAF co-activation assay, and complementary split luciferase assay.

The rapidly accelerated fibrosarcoma (RAF) family kinases play a central role in cell biology and their dysfunction leads to cancers and developmental ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. Although there are many established gastric cancer cell lines and many conventional transgenic mouse models for preclinical research, the disadvantages of these in vitro and in vivo models limit their applications. Because the characteristics of these models have changed in culture, they no longer model tumor heterogeneity, and their responses have not been able to predict responses in humans. Thus, alternative models that better represent tumor heterogeneity are being developed. Patient-derived xenograft (PDX) models preserve the histologic appearance of cancer cells, retain intratumoral heterogeneity, and better reflect the relevant human components of the tumor microenvironment. However, it usually takes 4-8 months to develop a PDX model, which is longer than the expected survival of many gastric patients. For this reason, establishing primary cancer cell lines may be an effective complementary method for drug response studies. The current protocol describes methods to establish PDX models and primary cancer cell lines from surgical gastric cancer samples. These methods provide a useful tool for drug development and cancer biology research.

The current protocol describes methods to establish patient-derived xenograft (PDX) models and primary cancer cell lines from surgical gastric cancer samples. The methods provide a useful tool for drug development and cancer biology research.

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Semi-automatic PD-L1 Characterization and Enumeration of Circulating Tumor Cells from Non-small Cell Lung Cancer Patients by Immunofluorescence

Circulating tumor cells (CTCs) derived from the primary tumor are shed into the bloodstream or lymphatic system. These rare cells (1&#8722;10 cells per mL of blood) warrant a poor prognosis and are correlated with shorter overall survival in several cancers (e.g., breast, prostate and colorectal). Currently, the anti-EpCAM-coated magnetic bead-based CTC capturing system is the gold standard test approved by the U.S. Food and Drug Administration (FDA) for enumerating CTCs in the bloodstream. This test is based on the use of magnetic beads coated with anti-EpCAM markers, which specifically target epithelial cancer cells. Many studies have illustrated that EpCAM is not the optimal marker for CTC detection. Indeed, CTCs are a heterogeneous subpopulation of cancer cells and are able to undergo an epithelial-to-mesenchymal transition (EMT) associated with metastatic proliferation and invasion. These CTCs are able to reduce the expression of cell surface epithelial marker EpCAM, while increasing mesenchymal markers such as vimentin. To address this technical hurdle, other isolation methods based on physical properties of CTCs have been developed. Microfluidic technologies enable a label-free approach to CTC enrichment from whole blood samples. The spiral microfluidic technology uses the inertial and Dean drag forces with continuous flow in curved channels generated within a spiral microfluidic chip. The cells are separated based on the differences in size and plasticity between normal blood cells and tumoral cells. This protocol details the different steps to characterize the programmed death-ligand 1 (PD-L1) expression of CTCs, combining a spiral microfluidic device with customizable immunofluorescence (IF) marker set.

The characterization of circulating tumor cells (CTCs) is a popular topic in translational research. This protocol describes a semi-automatic immunofluorescence (IF) assay for PD-L1 characterization and enumeration of CTCs in non-small cell lung cancer (NSCLC) patient samples.

Circulating tumor cells (CTCs) derived from the primary tumor are shed into the bloodstream or lymphatic system. These rare cells (1&#8722;10 cells per mL ...

Using Human Induced Pluripotent Stem Cells for the Generation of Tumor Antigen-specific T Cells

The generation and expansion of functional T cells in vitro can lead to a broad range of clinical applications. One such use is for the treatment of patients with advanced cancer. Adoptive T cell transfer (ACT) of highly enriched tumor antigen-specific T cells has been shown to cause durable regression of metastatic cancer in some patients. However, during expansion, these cells may become exhausted or senescent, limiting their effector function and persistence in vivo. Induced pluripotent stem cell (iPSC) technology may overcome these obstacles by leading to in vitro generation of large numbers of less differentiated tumor antigen-specific T cells. Human iPSC (hiPSC) have the capacity to differentiate into any type of somatic cell, including lymphocytes, which retain the original T cell receptor (TCR) genomic rearrangement when a T cell is used as a starting cell. Therefore, reprogramming of human tumor antigen-specific T cells to hiPSC followed by redifferentiation to T cell lineage has the potential to produce rejuvenated tumor antigen-specific T cells. Described here is a method for generating tumor antigen-specific CD8&#945;&#946;+ single positive (SP) T cells from hiPSC using OP9/DLL1 co-culture system. This method is a powerful tool for in vitro T cell lineage generation and will facilitate the development of in vitro derived T cells for use in regenerative medicine and cell-based therapies.

This article describes a method to generate functional tumor antigen-specific induced pluripotent stem cell-derived CD8&#945;&#946;+ single positive T cells using OP9/DLL1 co-culture system.

The generation and expansion of functional T cells in vitro can lead to a broad range of clinical applications. One such use is for the treatment of ...